Real-time fluorescent quantitative PCR (Polymerase Chain Reaction) detection method for rice content in fresh and wet rice noodles
Through real-time fluorescence quantitative PCR detection method, rice-specific primers and probes were used, combined with standard curve method, the accuracy of rice content detection in fresh wet rice flour was solved, and the rice content was quickly and specifically detected to meet the production and market supervision needs.
Patent Information
- Application Number
- CN202510882333.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-27
- Publication Date
- 2025-08-08
AI Technical Summary
The prior art lacks efficient and accurate detection methods to detect the rice content in fresh wet rice flour, especially fresh wet rice flour with a rice content greater than or equal to 90%. The traditional method operates complex and has low sensitivity.
Real-time fluorescence quantitative PCR detection was performed using rice-specific primers and probes, and the rice DNA content was quantitatively analyzed in combination with standard curve method. Sample DNA was extracted and real-time fluorescence PCR amplified.
It realizes rapid, accurate and specific detection of the rice content in fresh wet rice flour, especially fresh wet rice flour with a temperature of more than or equal to 90%, providing improvements to production processes and market supervision support.
Smart Images
Figure CN120442853A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of food detection, relates to the detection of rice content, and particularly relates to a real-time fluorescence quantitative PCR detection method for the rice content in fresh wet rice noodles. Background Art
[0002] Fresh wet rice noodles are pre-packaged fresh wet rice noodles such as cut noodles (rice noodles, rolled noodles) or squeezed noodles (round noodles) made from rice or brown rice as the main raw material, with a rice or brown rice content ≥90%. They are made through production processes such as cleaning, soaking, grinding or crushing, slurry adjustment, fermentation or non-fermentation, maturation, molding, cooling, and packaging.
[0003] Accurately measuring the rice content of fresh wet rice noodles is crucial for product quality control. Traditional detection methods, such as near-infrared spectroscopy (NIR), exploit the differences in chemical composition between rice and other substances, such as starch and protein, resulting in distinct NIR spectral signatures. Calibration models are then established to predict the proportions of each component in the mixture. Microscopic observation methods, such as GB / T 35877-2018, "Inspection of Cereals and Oils—Microscopic Counting Method for Determination of Cereal Content in Cereals and Their Products," grind the sample and prepare a slide. The cell structure is then observed under a microscope, and image analysis software is used to calculate the proportion of characteristic particles of different cereals. These existing technologies suffer from complex operation and low sensitivity. Currently, commonly used detection methods can only estimate rice content based on protein content, lacking accurate and specific detection.
[0004] Real-time polymerase chain reaction (PCR) technology offers advantages such as high sensitivity, high specificity, and rapidity. However, existing technologies lack standardized methods for detecting the rice content in fresh wet rice noodles, particularly those with a rice content of 90% or more. Therefore, developing an efficient and accurate detection method is crucial for practical production and market supervision. Summary of the Invention
[0005] In view of the existing technical situation, the present invention provides a real-time fluorescence quantitative PCR detection method for rice content in fresh wet rice noodles. The method is simple to operate, highly sensitive and specific, and is suitable for quality control of fresh wet rice noodles.
[0006] The technical solutions for achieving the purpose of the present invention are as follows: A real-time fluorescent quantitative PCR detection primer and probe for rice content in fresh wet rice noodles, comprising rice-specific primers and probe, wherein the primers are as follows: 1019GB18S-F:GAGAGGGAGCCTGAGAAACG; 1019GB18S-R: CACCAGACTTGCCCTCCAAT; QS-SPS-F1:agtttgtaaccccggatgac; QS-SPS-R1: gggagagattgtgtaagtcg; The probes are as follows: 1019GB18S-P: ACCACATCCAAGGAAGGCAGCA, the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group; QS-SPS-P1: tcgtgctcgcgccgcggttg; the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.
[0007] Furthermore, the 1019GB18S-P fluorescent reporter group is VIC, and the fluorescent quencher group is BHQ1; the QS-SPS-P1 fluorescent reporter group is 6-FAM, and the fluorescent quencher group is BHQ1.
[0008] A real-time fluorescence quantitative PCR method for detecting rice content in fresh wet rice noodles comprises the following steps: S1, extract DNA from samples; S2, real-time fluorescence quantitative PCR amplification using rice-specific primers and probes; S3, quantitatively analyze the rice DNA content using the standard curve method to obtain the mass percentage of rice in the sample.
[0009] Furthermore, the reaction system of the real-time fluorescence quantitative PCR includes: ddH2O: 4 μL; Premix 2×BioZues ® HS Taq U+Multiple Master Mix (Probe qPCR): 10 μL; Primer (rice-specific primers and probe, referred to as primer) mix: 1 μL; Template DNA: 5 μL.
[0010] The preparation of the probe mix includes the following components and amounts: QS-SPS-F1, concentration 100 μM, volume 5 μL; QS-SPS-R1, concentration 100 μM, volume 5 μL; QS-SPS-P1, concentration 100 μM, volume 2.5 μL; 1019GB18S-F, concentration 100 μM, volume 5 μL; 1019GB18S-R, concentration 100 μM, volume 5 μL; 1019GB18S-P, concentration 100 μM, volume 2.5 μL; TE (Tris-EDTA buffer, tris (hydroxymethyl)aminomethane-ethylenediaminetetraacetic acid buffer), the amount used is 75 μL.
[0011] Furthermore, the reaction procedure of the real-time fluorescence quantitative PCR is: The amplification procedure was pre-denaturation at 95°C for 3 min; The PCR cycle program was then performed: denaturation at 95°C for 15 s, fluorescence collection at 60°C for 30 s, for a total of 45 cycles.
[0012] Furthermore, the method for drawing the standard curve is: Total rice DNA was extracted, and a standard curve was drawn between the logarithmic value of the rice mass percentage and the Ct value, with the logarithmic value of 100%, 80%, 60%, 40%, 20% and 10% of the rice mass percentage as the abscissa and the corresponding Ct value as the ordinate.
[0013] Furthermore, the DNA extraction method is a magnetic bead method, which specifically includes the following steps: 1) Grind the sample into a powder, weigh 30-100 mg of sample into a centrifuge tube, add 1 ml of MagZol Reagent, and vortex for 1-3 minutes. Place the centrifuge tube in a 65°C water bath for 25-30 minutes, inverting several times during mixing. 2) Add 100 μL of Buffer BCP to the lysate per 1 mL of MagZol Reagent, shake vigorously by hand for 15 seconds, and let stand at room temperature for 3 minutes. 3) Centrifuge at 12,000 × g for 15 min at 4°C and obtain the supernatant for later use. 4) Transfer 500 μL of supernatant to a 1.5 mL centrifuge tube, add 500 μL of isopropanol and 30 μL of MagPureParticles N, and invert 15-20 times. Incubate at room temperature for 10 minutes, inverting several times to mix thoroughly. Transfer to a magnetic rack and adsorb for 2 minutes. Aspirate and discard the supernatant. 5) Add 600 μL of Buffer MW1 and vortex for 15 seconds. Transfer to a magnetic rack and adsorb for 1 minute. Aspirate and discard the supernatant. 6) Add 600 μL of Buffer MW2, vortex for 15 seconds, transfer to a magnetic rack and adsorb for 1 minute, then discard the supernatant; 7) Add 600 μL of Buffer MW2 and vortex for 15 seconds. Transfer to a magnetic rack and adsorb for 1 minute. Aspirate and discard the solution. 8) Centrifuge for 5-10 seconds, collect the droplets on the tube wall, and discard all the solution; dry at room temperature for 10 minutes; 9) Add 30-100 μL RNase-free water to the sample and vortex to disperse the magnetic beads; let it stand at room temperature for 5 minutes. 10) Transfer to a magnetic rack and adsorb for 3 minutes. Transfer the DNA to a new centrifuge tube and store at -20°C until use.
[0014] The real-time fluorescence quantitative PCR detection method for the rice content in fresh wet rice noodles is applied to detect fresh wet rice noodles with a rice content ≥90%.
[0015] The method extracts sample DNA, performs real-time fluorescence PCR amplification using rice-specific primers and probes, and quantitatively analyzes the rice DNA content in combination with a standard curve method to obtain the rice mass fraction in the sample.
[0016] Beneficial effects or advantages of the present invention: The present invention provides a method for detecting the rice content in fresh wet rice noodles by real-time fluorescence quantitative PCR. The method can rapidly, accurately and specifically detect the rice content in rice noodles, in particular fresh wet rice noodles with a rice content greater than or equal to 90%, thereby evaluating various rice properties, providing constructive improvements to the production process of fresh wet rice noodles, and playing an important role in the production and market supervision of rice noodles. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 is the standard curve of rice DNA at different concentrations; Figure 2 This is the specific amplification curve of rice DNA fluorescence quantitative PCR; Figure 3 This is the specific amplification curve of corn DNA fluorescence quantitative PCR; Figure 4 This is the specific amplification curve of potato DNA fluorescence quantitative PCR; Figure 5 This is the specific amplification curve of pea DNA fluorescence quantitative PCR; Figure 6 The specific amplification curve of fluorescence quantitative PCR when the rice DNA concentration is 5 ng / μL; Figure 7 The specific amplification curve of fluorescence quantitative PCR when the rice DNA concentration is 0.5 ng / μL; Figure 8The specific amplification curve of fluorescence quantitative PCR when the rice DNA concentration is 0.05 ng / μL; Figure 9 This is the specific amplification curve of fluorescence quantitative PCR when the rice DNA concentration is 0.005 ng / μL. DETAILED DESCRIPTION
[0018] The present invention is further described below with reference to the embodiments and accompanying drawings. It is apparent that the embodiments described are only a portion of the embodiments of the present invention, not all of them. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort are intended to fall within the scope of protection of the present invention.
[0019] First, rice-specific primers and probes were determined: big data comparisons were performed, and the whole genomes of crops such as rice, corn, wheat, cassava, and sweet potato were compared to find the specific gene sequence groups that distinguish rice from corn, wheat, cassava, sweet potato, etc. Secondly, big data was used to screen the coverage of these specific genomes in the rice population, and specific genomes with a coverage of more than 90% were screened. Then, low-copy genes were screened in these genomes. After screening, the DNA fragment encoding SPS (GeneBank No. U33175) was finally selected.
[0020] The endogenous gene 18S rDNA in plant ribosomes was selected as the internal reference gene. Using bioinformatics analysis programs, the coverage and specificity of the common segments of this gene in rice, corn, wheat, cassava, and sweet potato were compared.
[0021] Primers and probes were designed on the SPS gene fragment and 18S rDNA gene fragment, respectively. The primer design met the following requirements: (1) Primer length range is 18-25 nt, and GC content is between 40%-60%; (2) Avoid more than three consecutive identical bases near the 3' end of the primer, the GC content of the forward and reverse primers should be similar, and the last five bases of the 3' end of the primer should be evenly distributed ATCG; (3) The probe design must meet the following requirements: the Tm value must be 5-10°C greater than the primer Tm value, and the first base at the 5' end of the probe must not be G or C.
[0022] (4) The amplicon length is controlled between 80-150 bp.
[0023] After screening and testing, the final selected sequences are as follows: Rice specific primers and probes, the primers are as follows: 1019GB18S-F:GAGAGGGAGCCTGAGAAACG; 1019GB18S-R: CACCAGACTTGCCCTCCAAT; QS-SPS-F1:agtttgtaaccccggatgac; QS-SPS-R1: gggagagattgtgtaagtcg; The probes are as follows: 1019GB18S-P: ACCACATCCAAGGAAGGCAGCA, the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group; QS-SPS-P1: tcgtgctcgcgccgcggttg; the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.
[0024] Furthermore, the 1019GB18S-P fluorescent reporter group is VIC, and the fluorescent quencher group is BHQ1; the QS-SPS-P1 fluorescent reporter group is 6-FAM, and the fluorescent quencher group is BHQ1.
[0025] Example 1: DNA extraction.
[0026] (1) Grind the rice flour sample into powder using liquid nitrogen grinding. Weigh 30-100 mg of the sample into a centrifuge tube, immediately add 1 ml of MagZol Reagent, and vortex for 1-3 min. Place the centrifuge tube in a 65°C water bath for 25-30 min, inverting and mixing 3-6 times. (2) Add 100 μl of Buffer BCP to the lysate per 1 mL of MagZol Reagent, shake vigorously by hand for 15 seconds, and let it stand at room temperature for 3 minutes. (3) Centrifuge at 12,000 × g for 15 min at 4°C and obtain the supernatant for later use; (4) Transfer 500 μL of supernatant to a 1.5 mL centrifuge tube, add 500 μL of isopropanol and 30 μL of MagPureParticles N, and invert 15 to 20 times; place at room temperature for 10 minutes, inverting 3 to 6 times to mix; transfer to a magnetic stand and adsorb for 2 minutes, then discard the supernatant; (5) Add 600 μL of Buffer MW1 and vortex for 15 seconds; transfer to a magnetic stand and adsorb for 1 minute, then discard the supernatant; (6) Add 600 μL of Buffer MW2 and vortex for 15 seconds; transfer to a magnetic stand and adsorb for 1 minute, then discard the supernatant; (7) Add 600 μL of Buffer MW2 and vortex for 15 seconds; transfer to a magnetic rack and adsorb for 1 minute, then discard the solution; (8) Centrifuge for 5-10 seconds, collect the droplets on the tube wall, and discard all the solution; dry at room temperature for 10 minutes; (9) Add 30-100 μL RNase-Free Water to the sample and vortex to break up the magnetic beads; let stand at room temperature for 5 min; (10) Transfer to a magnetic rack and adsorb for 3 minutes, then transfer the DNA to a new centrifuge tube; store at -20°C until use.
[0027] Example 2: Real-time fluorescence quantitative PCR detection.
[0028] Prepare the reaction system: ddH2O 4 μL, 2× BioZues ® HS Taq U+Multiple Master Mix 10 μL, primer mix 1 μL, template DNA 5 μL; The preparation of the probe mix includes the following components and amounts: QS-SPS-F1, concentration 100 μM, volume 5 μL; QS-SPS-R1, concentration 100 μM, volume 5 μL; QS-SPS-P1, concentration 100 μM, volume 2.5 μL; 1019GB18S-F, concentration 100 μM, volume 5 μL; 1019GB18S-R, concentration 100 μM, volume 5 μL; 1019GB18S-P, concentration 100 μM, volume 2.5 μL; TE, usage: 75 μL.
[0029] The primers and probes were synthesized by conventional methods in the art and were synthesized by Bio-Tech (Shanghai) Co., Ltd.
[0030] Reaction procedure: The entire reaction mixture was prepared on ice. The amplification procedure was 95°C pre-denaturation for 3 min, followed by 95°C denaturation for 15 s, and fluorescence collection at 60°C for 30 s, for a total of 45 cycles. Each reaction was performed in triplicate.
[0031] Example 3: Standard curve drawing.
[0032] Extract total rice DNA and plot the logarithmic values of rice content (100%, 80%, 60%, 40%, 20%, and 10%) on the horizontal axis and the corresponding Ct values on the vertical axis. A standard curve was drawn between the logarithmic values of rice mass percentage and the Ct values. The regression equation was y = -3.3905x + 28.585, with R² = 0.9648. Figure 1 shown.
[0033] Table 1 shows the amount of rice nucleic acid input, rice content, and Ct value.
[0034] Table 1. Rice nucleic acid input, rice content, and Ct value Rice nucleic acid input Rice content Ct value 50ng 100% 28.32 40ng 80% 28.75 30ng 60% 29.71 20ng 40% 30.09 10n 20% 31.05 5ng 10% 31.78 Result analysis and calculation: Quality Control: The test results of PCR blank and negative control should not have a typical amplification curve; The positive control should show a typical amplification curve with Ct ≥ 28.
[0035] The above requirements must be met simultaneously in the same experiment; otherwise, the experiment will be considered invalid and must be repeated.
[0036] Result judgment: If the test results of two parallel samples of the sample to be tested are Ct≥28 and the experimental control results are normal, the mass percentage of rice in the sample can be obtained from the standard curve based on the sample Ct value.
[0037] Example 4: Specificity verification.
[0038] The DNA of rice, corn, potato and pea was used for testing, as shown in Table 2 and Figure 2 As shown: Table 2 Sample types and FAM Ct values and VIC Ct values Sample type FAM Ct value VIC Ct value rice 27.6 24.6 corn / 19.8 potato / 21.7 pea / 25.5 like Figure 2-Figure 5 As shown, the horizontal axis represents the amplification cycle number (Cycle Number), that is, the number of cycles of the PCR reaction; the vertical axis represents the fluorescence signal intensity (Fluorescence Intensity); Figure 2-Figure 5 The blue curve shows that only Figure 2 A specific amplification curve for rice DNA indicated good primer-probe specificity. Following the designed primer-probe ratio, the gene was effectively detected in rice samples, but not in corn, potato, or pea.
[0039] Example 5: Sensitivity verification.
[0040] like Figure 6-Figure 9As shown in the blue curve, the results of quantitative fluorescence PCR at different rice DNA concentration gradients show that when the rice DNA concentration is 5ng / μL, 0.5ng / μL, and 0.05ng / μL, Figure 6-Figure 8 As shown in Figure 2, the fluorescence quantitative PCR showed a typical specific amplification curve. When the DNA template concentration was diluted to 0.005 ng / μL, Figure 9 As shown, no typical specific amplification curve was observed, and the results showed that the minimum detection limit was 0.05 ng / μL.
[0041] Example 6: Actual sample detection.
[0042] Fourteen batches of commercially available fresh wet rice noodle samples were tested, and all 14 batches of samples showed normal amplification curves with Ct values between 28 and 31. The results showed that the rice content was 28%-93%, which was consistent with the nominal value. For example, the sample batch XA25002 had a FAM Ct value of 31.07, and the actual rice noodle content was 28%; the sample batch LC25005 had a FAM Ct value of 29.87, and the actual rice noodle content was 63%; the sample batch GY25001 had a FAM Ct value of 28.82, and the actual rice noodle content was 93%, verifying the reliability of the method of the present invention and indicating that it can meet the requirements for quantitative detection of rice components in commercially available fresh wet rice noodle samples.
[0043] The method of the present invention can be widely applied to food production enterprises, testing institutions and the like, and provides technical support for quality control and market supervision of fresh wet rice noodles.
[0044] Although embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and variations may be made to these embodiments without departing from the principles and spirit of the present invention, and that the scope of protection of the present invention is defined by the appended claims and their equivalents.
Claims
1. A real-time fluorescence quantitative PCR detection primer and probe for rice content in fresh wet rice noodles, characterized in that: Rice-specific primers and probes are included, and the primers are as follows: 1019GB18S-F:GAGAGGGAGCCTGAGAAACG; 1019GB18S-R: CACCAGACTTGCCCTCCAAT; QS-SPS-F1:agtttgtaaccccggatgac; QS-SPS-R1: gggagagattgtgtaagtcg; The probes are as follows: 1019GB18S-P: ACCACATCCAAGGAAGGCAGCA, the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group; QS-SPS-P1: tcgtgctcgcgccgcggttg; the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end is labeled with a fluorescent quencher group.
2. A real-time fluorescence quantitative PCR detection method for rice content in fresh wet rice noodles, characterized in that: The following steps are involved: S1, extract DNA from samples; S2, real-time fluorescence quantitative PCR amplification using rice-specific primers and probes; S3, quantitatively analyze the rice DNA content using the standard curve method to obtain the mass percentage of rice in the sample.
3. The real-time fluorescence quantitative PCR detection method for rice content in fresh wet rice noodles according to claim 2, wherein The reaction system of the real-time fluorescence quantitative PCR comprises: ddH2O: 4 μL; 2×BioZues ® HS Taq U+Multiple Master Mix:10 μL; Primer mix: 1 μL; Template DNA: 5 μL.
4. The real-time fluorescence quantitative PCR detection method for rice content in fresh wet rice noodles according to claim 3, wherein The preparation of the probe mix includes the following components and amounts: QS-SPS-F1, concentration 100 μM, volume 5 μL; QS-SPS-R1, concentration 100 μM, volume 5 μL; QS-SPS-P1, concentration 100 μM, volume 2.5 μL; 1019GB18S-F, concentration 100 μM, volume 5 μL; 1019GB18S-R, concentration 100 μM, volume 5 μL; 1019GB18S-P, concentration 100 μM, volume 2.5 μL; TE, usage: 75 μL.
5. the real-time fluorescence quantitative PCR detection method of rice content in fresh wet rice flour according to claim 2, is characterized in that, The reaction procedure of the real-time fluorescence quantitative PCR is: Pre-denaturation at 95°C for 3 min; Denaturation at 95°C for 15 s and fluorescence collection at 60°C for 30 s were performed for a total of 45 cycles.
6. The real-time fluorescence quantitative PCR detection method for rice content in fresh wet rice noodles according to claim 2, wherein The method for drawing the standard curve is: Total rice DNA was extracted, and a standard curve was drawn between the logarithmic value of the rice mass percentage and the Ct value, with the logarithmic value of 100%, 80%, 60%, 40%, 20% and 10% of the rice mass percentage as the abscissa and the corresponding Ct value as the ordinate.
7. The real-time fluorescence quantitative PCR detection method for rice content in fresh wet rice noodles according to claim 2, wherein The DNA extraction method is a magnetic bead method, which specifically includes the following steps: 1) Grind the sample into a powder, weigh 30-100 mg of sample into a centrifuge tube, add 1 ml of MagZol Reagent, and vortex for 1-3 minutes. Place the centrifuge tube in a 65°C water bath for 25-30 minutes, inverting several times during mixing. 2) Add 100 μL of Buffer BCP to the lysate per 1 mL of MagZol Reagent, shake vigorously by hand for 15 seconds, and let stand at room temperature for 3 minutes. 3) Centrifuge at 12,000 × g for 15 min at 4°C and obtain the supernatant for later use. 4) Transfer 500 μL of supernatant to a 1.5 mL centrifuge tube, add 500 μL of isopropanol and 30 μL of MagPureParticles N, and invert 15-20 times. Incubate at room temperature for 10 minutes, inverting several times to mix thoroughly. Transfer to a magnetic rack and adsorb for 2 minutes. Aspirate and discard the supernatant. 5) Add 600 μL of Buffer MW1 and vortex for 15 seconds. Transfer to a magnetic rack and adsorb for 1 minute. Aspirate and discard the supernatant. 6) Add 600 μL of Buffer MW2, vortex for 15 seconds, transfer to a magnetic rack and adsorb for 1 minute, then discard the supernatant; 7) Add 600 μL of Buffer MW2 and vortex for 15 seconds. Transfer to a magnetic rack and adsorb for 1 minute. Aspirate and discard the solution. 8) Briefly centrifuge for 5-10 seconds to collect droplets on the tube wall and discard all the solution; then dry at room temperature for 10 minutes; 9) Add 30-100 μL RNase-free water to the sample and vortex to disperse the magnetic beads; let it stand at room temperature for 5 minutes. 10) Transfer to a magnetic rack and adsorb for 3 minutes. Transfer the DNA to a new centrifuge tube and store at -20°C until use.
8. The real-time fluorescence quantitative PCR detection method for rice content in the fresh wet rice noodles according to any one of claims 2 to 7 is applied to detect the rice content in the fresh wet rice noodles.
9. The real-time fluorescent quantitative PCR detection method for rice content in the fresh wet rice noodles according to any one of claims 2 to 7 is applied to detect fresh wet rice noodles with a rice content of ≥90%.