A method for preparing a compound enzymatic hydrolysate of hops and Schisandra chinensis with significant anti-wrinkle and firming skin care effects

Abstract

The application discloses a preparation method of hop and schisandra chinensis composite enzymolysis liquid with significant anti-wrinkle and skin tightening effects, and relates to the technical field of daily chemical skin care materials.The application discloses a preparation method of hop and schisandra chinensis composite enzymolysis liquid with significant anti-wrinkle and skin tightening effects, and comprises the following steps: blending hop powder, schisandra chinensis powder and a solvent to obtain a mixed liquid; adding a composite enzyme composition to the mixed liquid, adjusting the pH to 4-7, performing enzymolysis treatment, centrifugally collecting supernatant, performing enzyme inactivation treatment on the supernatant, and performing rotary evaporation concentration to obtain the hop and schisandra chinensis composite enzymolysis liquid; the application adds the enzymolysis liquid obtained by performing enzymolysis on hop powder and schisandra chinensis powder as an effective component in skin care products, and the skin care products have significant anti-wrinkle and skin tightening effects.

Description

Technical Field

[0001] This invention relates to the field of daily chemical skin care materials technology, specifically to a method for preparing a compound enzymatic hydrolysate of hops and Schisandra chinensis with significant anti-wrinkle and firming skin care effects. Background Technology

[0002] With an aging population and increasing consumer demand for youthful skin, the anti-wrinkle skincare market is growing rapidly. Wrinkle formation is mainly related to collagen loss, elastin degeneration, free radical damage, and weakened skin barrier function. Existing anti-wrinkle ingredients such as retinol, peptides, and vitamin C have problems such as irritation, poor stability, or high cost. For example, retinol may cause skin sensitivity, dryness, and peeling; vitamin C is easily oxidized and deactivated; and most ingredients only target one cause of wrinkles, failing to comprehensively improve skin aging. Therefore, developing safer and more effective natural anti-wrinkle ingredients has become a trend.

[0003] Hops, also known as hops, are perennial climbing herbaceous plants belonging to the genus *Humulus* in the family Moraceae. The stems, branches, and petioles of hops are densely covered with downy hairs and hooked thorns; the leaves are ovate or broadly ovate. Hops are not only a raw material for brewing beer but also a plant with a long history of use as both food and medicine. Hops are rich in nutrients, containing flavonoids, polyphenols, α-acids, and β-acids, and possess anti-inflammatory, antiviral, and endocrine-regulating effects. *Schisandra chinensis*, the mature fruit of *Schisandra chinensis* var. *chinensis*, differs from *Schisandra chinensis* var. *chinensis*. Plants in the genus *Schisandra chinensis* contain lignans such as schisandrin A, schisandrin A, B, C, and D, as well as volatile oils, organic acids, fats, and triterpenoids. Triterpenoids are among the main bioactive components of *Schisandra chinensis* plants.

[0004] Currently, methods such as hot water reflux, ultrasound, and microwave extraction are commonly used to extract active ingredients from hops and Schisandra chinensis. However, hot water reflux extraction involves high temperatures and low extraction rates; ultrasound and microwave extraction may cause bond breakage in the active ingredients. This application employs a combined enzymatic method using pectinase and cellulase to extract active ingredients from hops and Schisandra chinensis. Enzymatic extraction can decompose plant tissues under relatively mild conditions, accelerating the release of active ingredients and showing broad application prospects. Summary of the Invention

[0005] The purpose of this invention is to provide a method for preparing a compound enzymatic hydrolysate of hops and Schisandra chinensis with significant anti-wrinkle and firming skin care effects, thereby solving the following technical problems:

[0006] Existing anti-wrinkle ingredients such as retinol, peptides, and vitamin C have problems such as irritation, poor stability, or high cost.

[0007] The objective of this invention can be achieved through the following technical solutions:

[0008] A method for preparing a compound enzymatic hydrolysate of hops and Schisandra chinensis with significant anti-wrinkle and firming skin care effects includes the following steps:

[0009] S1: Mix hop powder, Schisandra chinensis powder, and solvent to obtain a mixture;

[0010] S2: Add the complex enzyme composition to the mixture, adjust the pH to 4-6, perform enzymatic hydrolysis, collect the supernatant by centrifugation, inactivate the enzyme in the supernatant, concentrate by rotary evaporation, and obtain the complex enzymatic hydrolysate of hops and Schisandra chinensis.

[0011] The preparation method of the complex enzyme composition includes the following steps:

[0012] A1: Add pectinase, sodium alginate solution, and glycerol to a reaction vessel and disperse evenly to obtain a pectinase dispersion; add the pectinase dispersion dropwise to CaCl2 solution, control the temperature at 10-25℃, let stand for 0.5-1h, wash with water, and dry to obtain pectinase microspheres;

[0013] A2: Add chitosan, acetic acid, and water to a reaction flask and disperse evenly. Adjust the pH to 5-6.5, add pectinase microspheres, control the temperature at 10-20℃, let stand for 10-20 minutes, wash with PBS, and obtain modified pectinase microspheres.

[0014] A3: Add cellulase and distilled water to the reaction vessel and disperse evenly. Adjust the pH to 5-6, add modified pectinase microspheres, control the temperature at 0-10℃, let stand for 10-20 minutes, add glutaraldehyde, keep warm for 1-2 hours, add glycine and disperse evenly, keep warm for 0.5-1 hours, wash with PBS, filter and dry to obtain the composite enzyme composition.

[0015] As a further embodiment of the present invention: the addition ratio of pectinase, sodium alginate solution and glycerol in A1 is 0.5-1g:100mL:3-6g.

[0016] As a further embodiment of the present invention: the addition ratio of chitosan, acetic acid, distilled water and pectinase microspheres in A2 is 1-2g: 0.8-1.2g: 100mL: 5-10g.

[0017] As a further aspect of the present invention: the addition ratio of distilled water, modified pectinase microspheres, glutaraldehyde, and glycine in A3 is 100mL: 1-2g: 0.4-0.8g: 0.5-1g.

[0018] As a further aspect of the present invention: the method for preparing CaCl2 solution includes the following steps: 1-5g CaCl2 and 100mL distilled water are mixed together, and PBS is added dropwise to adjust the pH to 5-6 to obtain CaCl2 solution;

[0019] The preparation method of sodium alginate solution includes the following steps: 1-3g of sodium alginate powder and 100mL of distilled water are mixed, the temperature is controlled at 50-60℃, and the mixture is magnetically stirred until completely dissolved to obtain sodium alginate solution.

[0020] As a further aspect of the present invention: hop powder is obtained by drying hops at low temperature, then pulverizing and sieving; Schisandra chinensis powder is obtained by drying Schisandra chinensis at low temperature, then pulverizing and sieving.

[0021] As a further aspect of the present invention: the mass ratio of hop powder to Schisandra chinensis powder in the mixture is 1:0.5-1.5; the solid-liquid ratio in the mixture is 2:50-150; and the solvent is distilled water.

[0022] As a further aspect of the present invention: the mass ratio of cellulase to pectinase in the composite enzyme composition is 2-1:1.

[0023] As a further aspect of the present invention: the complex enzyme composition accounts for 5-15% of the total mass of the complex enzyme composition and the mixture.

[0024] As a further aspect of the present invention, the specific steps of the enzymatic hydrolysis treatment are as follows: controlling the temperature at 45-55℃ and stirring for 30-60 minutes.

[0025] The specific steps for enzyme inactivation treatment are as follows: control the temperature at 100℃ and keep it warm while stirring for 10-15 minutes;

[0026] The specific steps for rotary evaporation concentration are: to concentrate to one-half to one-quarter of the original volume.

[0027] The beneficial effects of this invention are:

[0028] (1) This application employs a compound enzymatic hydrolysis technology to break down the structure of plant cell walls in hop powder and Schisandra chinensis powder using cellulase and pectinase, thereby more effectively releasing intracellular active substances. Compared to single enzymatic hydrolysis or traditional solvent extraction, compound enzymatic hydrolysis not only improves extraction efficiency but also retains more activity of heat-sensitive components, reduces the use of organic solvents, and avoids the risk of chemical solvent residues. Moreover, this application can break down macromolecules such as polysaccharides and proteins into small molecule active substances through enzymatic hydrolysis, making them easier to be absorbed by the skin, improving transdermal absorption rate and moisturizing and repairing effects.

[0029] (2) This application utilizes a compound enzyme to enzymatically hydrolyze hop powder and Schisandra chinensis powder to obtain a compound enzymatic hydrolysate. The flavonoids in hops, such as quercetin and rutin, as well as polyphenols and α-acids (humulone), can neutralize free radicals (ROS), reduce oxidative stress damage to skin cells (such as fibroblasts and keratinocytes), protect collagen and elastin fibers from oxidative degradation, and delay skin sagging and wrinkle formation. It also enhances the activity of the skin's own antioxidant enzymes (such as superoxide dismutase (SOD) and glutathione peroxidase), improving skin's defense capabilities. Hops not only delay skin aging but also indirectly stimulate collagen synthesis through antioxidant and anti-inflammatory effects, effectively improving skin texture and making the skin more delicate and smooth. Hops can synergistically improve skin aging problems through a multi-target mechanism, achieving anti-wrinkle and firming skincare effects. Schisandra chinensis is rich in active ingredients such as lignans, polysaccharides, volatile oils and vitamins. Among them, lignans and polyphenols can not only scavenge free radicals and reduce the damage of oxidative stress to the skin, but also stimulate fibroblasts, increase the production of collagen and elastin, and improve skin elasticity.

[0030] This application utilizes Schisandra chinensis, which focuses on anti-oxidation and collagen synthesis, and hops, which focuses on anti-inflammation and antibacterial properties. The combination of these two ingredients comprehensively addresses the causes of wrinkles. Both materials in the compound enzymatic hydrolysate used in this application are natural plant extracts with low irritation, making them suitable for long-term use. Furthermore, the active ingredients of Schisandra chinensis and hops exhibit good stability in skincare formulations and are not easily deactivated.

[0031] (3) This application utilizes a combination of cellulase and pectinase to decompose the cell walls of hop powder and Schisandra chinensis powder. Firstly, pectinase is encapsulated in sodium alginate to form pectinase microspheres via enzyme immobilization. Glycerol is added during the preparation of the pectinase microspheres to reduce thermal denaturation of the enzyme during recovery. Using pectinase microspheres as raw material, a chitosan coating is formed on the surface of the pectinase microspheres via electrostatic adsorption to obtain modified pectinase microspheres. Cellulase is then loaded onto the surface of the modified pectinase microspheres. Glutaraldehyde is added during the loading process to achieve cross-linking and immobilization, effectively improving the binding strength between the cellulase and the modified pectinase microspheres. Finally, glycine is added to block residual aldehyde groups, resulting in a composite enzyme composition.

[0032] This application loads cellulase and pectinase onto a carrier, achieving not only the recovery and reuse of both enzymes but also their layered immobilization, maintaining their activity and ensuring their stability and synergistic effect on the carrier, avoiding competitive inhibition between the enzymes. In the complex enzymatic hydrolysis process, this application recovers the composite enzyme preparation of cellulase and pectinase, achieving a key step in cost control and green production. Through reasonable recovery technology, the raw material consumption in the enzymatic hydrolysis process can be significantly reduced, while simultaneously reducing waste emissions. Attached Figure Description

[0033] The invention will now be further described with reference to the accompanying drawings.

[0034] Figure 1 This is a statistical graph showing the effect of different concentrations of the compound enzyme hydrolysate prepared in Example 5 of this application on the proliferation of HDF cells;

[0035] Figure 2 This is a statistical graph showing the promotion of collagen gene expression level in cells by the composite enzymatic hydrolysate prepared in Example 5 of this application;

[0036] Figure 3 This is an observation diagram of the reaction of the composite enzymatic hydrolysate prepared in Example 5 of this application on the chicken embryo chorioallantoic membrane (HET-CAM) within 5 minutes. Detailed Implementation

[0037] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0038] Example 1: The preparation method of the complex enzyme composition includes the following steps:

[0039] A1: Mix 2g CaCl2 and 100mL distilled water, then add PBS to adjust the pH to 6 to obtain a CaCl2 solution; mix 2g sodium alginate powder and 100mL distilled water, control the temperature at 55℃, and stir magnetically until completely dissolved to obtain a sodium alginate solution.

[0040] A2: Add 1g of pectinase (activity ≥5000U / g), 100mL of sodium alginate solution, and 3g of glycerol to a reaction vessel and disperse evenly to obtain a pectinase dispersion; add the pectinase dispersion dropwise into CaCl2 solution through a needle (22-26G), control the temperature at 10℃, let stand for 0.5h, wash with water, and dry to obtain pectinase microspheres with a particle size of 1mm;

[0041] A3: Add 1g chitosan, 0.8g acetic acid, and 100mL distilled water to a reaction flask and disperse evenly. Adjust the pH to 5, add 5g pectinase microspheres, control the temperature at 10℃, let stand for 10min, wash with PBS, and obtain modified pectinase microspheres.

[0042] A4: Cellulase (activity ≥ 5000 U / g) and 100 mL of distilled water were added to a reaction vessel and dispersed evenly. The pH was adjusted to 5, 1 g of modified pectinase microspheres were added, the temperature was controlled at 0℃, and the mixture was allowed to stand for 10 min. 0.4 g of glutaraldehyde was added, and the mixture was kept at this temperature for 1 h. 0.5 g of glycine was added and dispersed evenly. The mixture was kept at this temperature for 0.5 h, washed with PBS, filtered, and dried to obtain a composite enzyme composition. The mass ratio of cellulase to pectinase in the composite enzyme composition was 1:1.

[0043] Example 2: The preparation method of the complex enzyme composition includes the following steps:

[0044] A1: Mix 2g CaCl2 and 100mL distilled water, then add PBS to adjust the pH to 6 to obtain a CaCl2 solution; mix 2g sodium alginate powder and 100mL distilled water, control the temperature at 55℃, and stir magnetically until completely dissolved to obtain a sodium alginate solution.

[0045] A2: Add 1g of pectinase (activity ≥5000U / g), 100mL of sodium alginate solution, and 5g of glycerol to a reaction vessel and disperse evenly to obtain a pectinase dispersion; add the pectinase dispersion dropwise into CaCl2 solution through a needle (22-26G), control the temperature at 15℃, let stand for 0.5h, wash with water, and dry to obtain pectinase microspheres with a particle size of 1mm;

[0046] A3: Add 1.5g chitosan, 1g acetic acid, and 100mL distilled water to a reaction flask and disperse evenly. Adjust the pH to 5.5, add 7g pectinase microspheres, control the temperature at 15℃, let stand for 15min, wash with PBS, and obtain modified pectinase microspheres.

[0047] A4: Cellulase (activity ≥ 5000 U / g) and 100 mL of distilled water were added to a reaction vessel and dispersed evenly. The pH was adjusted to 5.5, 1 g of modified pectinase microspheres were added, the temperature was controlled at 5℃, and the mixture was allowed to stand for 10 min. 0.6 g of glutaraldehyde was added, and the mixture was kept at this temperature for 1.5 h. 0.7 g of glycine was added and dispersed evenly. The mixture was kept at this temperature for 0.5 h. The mixture was washed with PBS, filtered, and dried to obtain a composite enzyme composition. The mass ratio of cellulase to pectinase in the composite enzyme composition was 1:1.

[0048] Example 3: The preparation method of the complex enzyme composition includes the following steps:

[0049] A1: Mix 2g CaCl2 and 100mL distilled water, then add PBS to adjust the pH to 6 to obtain a CaCl2 solution; mix 2g sodium alginate powder and 100mL distilled water, control the temperature at 55℃, and stir magnetically until completely dissolved to obtain a sodium alginate solution.

[0050] A2: Add 0.5-1g of pectinase (activity ≥5000U / g), 100mL of sodium alginate solution, and 3-6g of glycerol to a reaction vessel and disperse evenly to obtain a pectinase dispersion; add the pectinase dispersion dropwise into CaCl2 solution through a needle (22-26G), control the temperature at 25℃, let stand for 0.5h, wash with water, and dry to obtain pectinase microspheres with a particle size of 1mm;

[0051] A3: Add 1g chitosan, 1.2g acetic acid, and 100mL distilled water to a reaction flask and disperse evenly. Adjust the pH to 6, add 10g pectinase microspheres, control the temperature at 20℃, let stand for 10min, wash with PBS, and obtain modified pectinase microspheres.

[0052] A4: Cellulase (activity ≥ 5000 U / g) and 100 mL of distilled water were added to the reaction vessel and dispersed evenly. The pH was adjusted to 6, 1 g of modified pectinase microspheres were added, the temperature was controlled at 10℃, and the mixture was allowed to stand for 10 min. 0.8 g of glutaraldehyde was added, and the mixture was kept at this temperature for 2 h. 1 g of glycine was added and dispersed evenly. The mixture was kept at this temperature for 1 h, washed with PBS, filtered, and dried to obtain the composite enzyme composition. The mass ratio of cellulase to pectinase in the composite enzyme composition was 1:1.

[0053] Example 4: A method for preparing a compound enzymatic hydrolysate of hops and Schisandra chinensis with significant anti-wrinkle and firming skin care effects, comprising the following steps:

[0054] S1: Hops are dried at low temperature and then pulverized through a 200-mesh sieve to obtain hop powder; Schisandra chinensis is dried at low temperature and then pulverized through a 200-mesh sieve to obtain Schisandra chinensis powder; 1g of hop powder, 1g of Schisandra chinensis powder and 100mL of distilled water are mixed to obtain a mixture;

[0055] S2: Add 12.5g of the complex enzyme composition prepared in Example 1 to 100mL of the mixture, adjust the pH to 6.5, control the temperature at 55℃ and stir for 30min, centrifuge to collect the supernatant, control the temperature of the supernatant at 100℃ and stir for 10min, and then concentrate it by rotary evaporation to one-third of the original volume to obtain the hop and Schisandra chinensis complex enzyme hydrolysate.

[0056] Example 5: A method for preparing a compound enzymatic hydrolysate of hops and Schisandra chinensis with significant anti-wrinkle and firming skin care effects, comprising the following steps:

[0057] S1: Hops are dried at low temperature and then pulverized through a 200-mesh sieve to obtain hop powder; Schisandra chinensis is dried at low temperature and then pulverized through a 200-mesh sieve to obtain Schisandra chinensis powder; 1g of hop powder, 1g of Schisandra chinensis powder and 100mL of distilled water are mixed to obtain a mixture;

[0058] S2: Add 12.5g of the complex enzyme composition prepared in Example 2 to 100mL of the mixture, adjust the pH to 6.5, control the temperature at 55℃ and stir for 30min, centrifuge to collect the supernatant, control the temperature of the supernatant at 100℃ and stir for 10min, and then concentrate it by rotary evaporation to one-third of the original volume to obtain the hop and Schisandra chinensis complex enzyme hydrolysate.

[0059] Example 6: A method for preparing a compound enzymatic hydrolysate of hops and Schisandra chinensis with significant anti-wrinkle and firming skin care effects, comprising the following steps:

[0060] S1: Hops are dried at low temperature and then pulverized through a 200-mesh sieve to obtain hop powder; Schisandra chinensis is dried at low temperature and then pulverized through a 200-mesh sieve to obtain Schisandra chinensis powder; 1g of hop powder, 1g of Schisandra chinensis powder and 100mL of distilled water are mixed to obtain a mixture;

[0061] S2: Add 12.5g of the complex enzyme composition prepared in Example 3 to 100mL of the mixture, adjust the pH to 6.5, control the temperature at 55℃ and stir for 30min, centrifuge to collect the supernatant, control the temperature of the supernatant at 100℃ and stir for 10min, and then concentrate it by rotary evaporation to one-third of the original volume to obtain the hop and Schisandra chinensis complex enzyme hydrolysate.

[0062] The preparation method of the complex enzyme composition in Comparative Example 1 includes the following steps:

[0063] 1g of pectinase (activity ≥ 5000 U / g) and cellulase (activity ≥ 5000 U / g) were mixed to obtain a composite enzyme composition.

[0064] The preparation method of the complex enzyme composition in Comparative Example 2 includes the following steps:

[0065] A1: Mix 2g CaCl2 and 100mL distilled water, then add PBS to adjust the pH to 6 to obtain a CaCl2 solution; mix 2g sodium alginate powder and 100mL distilled water, control the temperature at 55℃, and stir magnetically until completely dissolved to obtain a sodium alginate solution.

[0066] A2: 1g pectinase (activity ≥5000U / g), 1g cellulase (activity ≥5000U / g), 100mL sodium alginate solution, and 5g glycerol were added to a reaction vessel and dispersed evenly to obtain a pectinase dispersion. The pectinase dispersion was then added dropwise to a CaCl2 solution through a syringe (22-26G) while maintaining the temperature at 15℃. After standing for 0.5h, the mixture was washed with water and dried to obtain composite enzyme microspheres with a particle size of 1mm.

[0067] A3: Add 1.5g chitosan, 1g acetic acid, and 100mL distilled water to a reaction flask and disperse evenly. Adjust the pH to 5.5, add 7g of composite enzyme microspheres, control the temperature at 15℃, let stand for 15min, wash with PBS, and obtain modified composite enzyme microspheres.

[0068] A4: Add 1g of modified pectinase microspheres and 100mL of distilled water to the reaction vessel and disperse evenly. Adjust the pH to 5.5, control the temperature at 5℃, let stand for 10min, add 0.6g of glutaraldehyde, keep warm for 1.5h, add 0.7g of glycine and disperse evenly, keep warm for 0.5h, wash with PBS, filter and dry to obtain the composite enzyme composition.

[0069] The preparation method of the complex enzyme composition in Comparative Example 3 includes the following steps:

[0070] A1: Mix 2g CaCl2 and 100mL distilled water, then add PBS to adjust the pH to 6 to obtain a CaCl2 solution; mix 2g sodium alginate powder and 100mL distilled water, control the temperature at 55℃, and stir magnetically until completely dissolved to obtain a sodium alginate solution.

[0071] A2: Add 1g of pectinase (activity ≥5000U / g), 100mL of sodium alginate solution, and 5g of glycerol to a reaction vessel and disperse evenly to obtain a pectinase dispersion; add the pectinase dispersion dropwise into CaCl2 solution through a needle (22-26G), control the temperature at 15℃, let stand for 0.5h, wash with water, and dry to obtain pectinase microspheres with a particle size of 1mm;

[0072] A3: Add 1.5g chitosan, 1g acetic acid, and 100mL distilled water to a reaction flask and disperse evenly. Adjust the pH to 5.5, add 7g pectinase microspheres, control the temperature at 15℃, let stand for 15min, wash with PBS, and obtain modified pectinase microspheres.

[0073] A4: Cellulase (activity ≥ 5000 U / g) and 100 mL of distilled water were added to the reaction vessel and dispersed evenly. The pH was adjusted to 5.5, 1 g of modified pectinase microspheres were added, the temperature was controlled at 5℃, and the mixture was allowed to stand for 100 min. 0.7 g of glycine was added and dispersed evenly. The mixture was kept warm for 0.5 h, washed with PBS, filtered, and dried to obtain a composite enzyme composition. The mass ratio of cellulase to pectinase in the composite enzyme composition was 1:1.

[0074] Compared with Example 5, Comparative Example 4 only replaced the composite enzyme composition prepared in Example 2 with an equal amount of the composite enzyme composition prepared in Comparative Example 1. The other components and preparation methods were completely consistent.

[0075] Compared with Example 5, Comparative Example 5 only replaced the composite enzyme composition prepared in Example 2 with an equal amount of the composite enzyme composition prepared in Comparative Example 2. The other components and preparation methods were completely consistent.

[0076] Compared with Example 5, Comparative Example 6 only replaced the composite enzyme composition prepared in Example 2 with an equal amount of the composite enzyme composition prepared in Comparative Example 3. The remaining components and preparation methods were completely consistent.

[0077] Compared with Example 5, Comparative Example 7 replaced 1g of hop powder and 1g of Schisandra chinensis powder in Example 5 with 2g of hop powder, while the remaining components were completely consistent with the preparation method.

[0078] Compared with Example 5, Comparative Example 8 replaced 1g of hop powder and 1g of Schisandra chinensis powder in Example 5 with 2g of Schisandra chinensis powder, while the remaining components were completely consistent with the preparation method.

[0079] Performance testing

[0080] (1) Cell culture and grouping

[0081] HDF fibroblasts were cultured in RPMI 1640 medium (containing 1% penicillin-streptomycin and 1% fetal bovine serum) at 37°C and 5% CO2. When the cells reached 80% confluence, they were digested with 0.25% trypsin and counted using a handheld automatic cell counter. Finally, a cell suspension of a certain concentration was prepared for passage culture.

[0082] In the photoaging damage experiment, the HDF fibroblast experiment was divided into three groups: blank control group, photoaging damage model group (50 mJ / cm²), and others. 2 UVA irradiation), sample experimental group, both with 5X10 4 Cells were cultured at a density of 10 cells / mL in six-well plates; the blank control group received no treatment, while the aging and damage model group received 50 mJ / mL culture. 2 After UVA irradiation, the cells in the experimental group were first treated with a certain concentration of compound enzyme digestion solution for 24 hours, then discarded, and washed three times with sterile PBS. Finally, they were subjected to 50 mJ / cm² irradiation. 2 UVA irradiation.

[0083] (2) Determination of the effect of enzymatic hydrolysate on cell proliferation activity

[0084] The CCK8 assay for cell proliferation has advantages such as good reproducibility and low cytotoxicity. HDF cells in the logarithmic growth phase, passaged for 4-5 generations, are used at a cell density of 4 x 10⁻⁶ cells / year. 4Cells were seeded at a concentration of [number] cells / mL in 96-well plates and cultured at 37°C and 5% CO2 for approximately 12 hours. Then, 10% of the prepared enzyme digest was added. After 24 hours of interaction between the sample and cells, 10% of CCK8 reagent was added, and the cells were incubated for 2 hours. Finally, the absorbance at 450 nm was measured using a microplate reader. Each concentration was repeated five times. Cell proliferation rate was calculated using the following formula:

[0085] Cell viability % = [(Experimental group OD - Apoptosis pore OD) / (Control group OD - Apoptosis pore OD)] x 100%

[0086] HDF cells were treated with different concentrations of enzyme digest for 24 hours, and then the cell proliferation activity was tested using a CCK8 assay kit. The results are as follows: Figure 1 As shown in the figure, different concentrations of the enzymatic hydrolysate had no effect on the proliferation of HDF cells; based on the cell proliferation experiment data, it can be preliminarily judged that the enzymatic hydrolysate, as a natural skin care active ingredient, has a certain degree of safety.

[0087] (3) Detection of mRNA expression levels of Collagen type 1 and Collagen type 3 by real-time PCR

[0088] The initial cell culture for Collagen type 1 and Collagen type 3 mRNA expression levels was performed as described in (2) above. Total RNA was extracted from each well using RNAiso, and then PrimeScript was used. TM The RT reagent kit reverses total RNA into cDNA. After adding SYBR reagent, gene primers, and gene template, a real-time quantitative PCR reaction is performed. The reaction program is a two-step method, as follows: pre-denaturation at 95℃ for 30 s; PCR reaction at 95℃ for 5 s, followed by 60℃ for 30 s, repeated 40 times. Primer sequences are shown below:

[0089] Actin-F:GTTGGACCTGACAGACTACCTCA;

[0090] Actin-R:GTTGCCAATAGTGATGACCT;

[0091] Col lagen type1-F:TGGTCCACTTGCTTGAAGAC;

[0092] Col lagen type1-R:ACAGATTTGGGAAGGAGTGG;

[0093] Col lagen type3-F:ATGGTTGCACGAAACACACT;

[0094] Col lagen type3-R:CTTGATCAGGACCACCAATG;

[0095] Please see Figure 2 Among them, Collagen type 1 and Collagen type 3 represent collagen genes I and III, respectively. Figure 2 The data shows that,

[0096] The combined enzymatic hydrolysate obtained by combining hops only in Comparative Example 7 and Schisandra chinensis only in Comparative Example 8 promoted the expression level of Collagen type 1 gene in cells by 23.33% and 34.33%, respectively. In contrast, the combined enzymatic hydrolysate prepared by adding both hops and Schisandra chinensis in Example 5 promoted the expression level of Collagen type 1 gene by 65.33%.

[0097] The combined enzymatic hydrolysates obtained from the combined enzymatic hydrolysis of hops (Comparative Example 7) and Schisandra chinensis (Comparative Example 8) showed a 35% and 26.67% promotion of Collagen type 3 gene expression in cells, respectively. In contrast, the combined enzymatic hydrolysate prepared by adding both hops and Schisandra chinensis in Example 5 showed a 55% promotion of Collagen type 3 gene expression. In conclusion, the combined enzymatic hydrolysate prepared by combining hops and Schisandra chinensis exhibits a significant promoting and synergistic effect on collagen gene expression in cells. This indicates that the combined enzymatic hydrolysate prepared by combining hops and Schisandra chinensis has a more effective anti-wrinkle and firming skincare effect than the combined enzymatic hydrolysate prepared by combining either ingredient alone.

[0098] (4) Irritation test of the compound enzymatic hydrolysate prepared in Example 5

[0099] The in vitro test method using chicken embryo chorioallantoic membrane (HET-CAM) was used to replace the traditional animal test method. The test was conducted in accordance with the "Test of Chicken Embryo Chollioallantoic Membrane for Eye Irritation / Corrosion in Cosmetics" (SN / T2329-2009). The reaction time method was used, and negative (0.9% NaCl) and positive control groups (0.1 mol / L NaOH) were set up.

[0100] Please see Figure 3 , Figure 3Figure A shows the negative control group. Figure 3 Figure B shows the positive control group. Figure 3 Figure C shows the enzymatic hydrolysate experimental group. The reaction of the chicken embryo chorioallantoic membrane (HET-CAM) within 5 minutes was observed, and toxicity was graded and scored. The HET-CAM detection results of the enzymatic hydrolysate are shown below. Figure 3 As shown, the negative control group (0.9% NaCl) showed no vascular bleeding, coagulation, or hemolysis, and the blood vessels remained normal. In contrast, the positive control group (0.1 mol / L NaOH) exhibited severe bleeding reactions with HET-CAM, indicating that the two control groups were successfully set up and are meaningful for comparison. The eye irritation of the test sample was determined by observing and recording the degree of each type of bleeding, coagulation, and vascular dissolution from the start of the experiment. Figure 3 The results of the enzymatic hydrolysate experimental group were consistent with those of the negative control, with no vascular bleeding, coagulation, or hemolysis observed. Therefore, the compound enzymatic hydrolysate can be classified as non-irritating and can be added to cosmetic formulations for skin care.

[0101] (5) Enzyme activity detection

[0102] ① Pectinase activity detection method: The composite enzyme compositions prepared in Examples 1-3 and Comparative Examples 1-3 were reacted with PGA solution (pH 4.5, 50℃) for 10 min. After terminating the reaction, the supernatant was collected by centrifugation, DNS reagent was added, and the mixture was boiled for color development. The absorbance at 540 nm was measured, and the activity retention rate was calculated according to the following formula:

[0103] Activity retention rate = (Enzyme activity of the complex enzyme composition / Initial enzyme activity) × 100%

[0104] In the formula, the initial enzyme activity is the initial pectinase activity, and the test results are shown in Table 1;

[0105] ② Cellulase activity detection method: The composite enzyme compositions prepared in Examples 1-3 and Comparative Examples 1-3 were reacted with sodium carboxymethyl cellulose (CMC-Na) solution (pH 5.0, 50℃) for 10 min. After terminating the reaction, the supernatant was collected by centrifugation, and DNS reagent was added and boiled for color development. The amount of glucose produced was measured, and the immobilization efficiency was calculated according to the following formula:

[0106] Immobilization efficiency = (Enzyme activity of the composite enzyme composition / Initial enzyme activity) × 100%

[0107] In the formula, the initial enzyme activity is the initial cellulase activity, and the detection results are shown in Table 1;

[0108] ③ Catalytic efficiency: Using hop powder and Schisandra chinensis powder as composite substrates, the composite enzyme compositions prepared in Examples 1-3 and Comparative Examples 1-3 were used to degrade the composite substrates. The amount of reducing sugar released after degradation was detected. The results are shown in Table 1.

[0109] ④ Operational stability: Using hop powder and Schisandra chinensis powder as composite substrates, the composite substrates were degraded using the composite enzyme compositions prepared in Examples 1-3 and Comparative Examples 1-3. After the reaction, the composite enzyme composition was recovered by centrifugation, washed 3 times with PBS buffer, and reused 5 times. The enzyme activity retention rate of the composite enzyme composition after 5 times was measured. The test results are shown in Table 1.

[0110] Table 1: Statistical table of enzyme activity detection data for Examples 1-3 and Comparative Examples 1-3

[0111]

[0112] As shown in Table 1, although the activities of pectinase and cellulase in the composite enzyme composition prepared in this application decreased slightly after being loaded onto the carrier, the activity of pectinase remained above 85%, and the activity of cellulase remained above 75%. Furthermore, the layered solidification of pectinase and cellulase in this application effectively improves the degradation efficiency of the composite enzyme; and with repeated recycling and reuse of the composite enzyme composition, it still maintains high enzyme activity, which is beneficial for the recycling and reuse of the composite enzyme.

[0113] The foregoing has provided a detailed description of one embodiment of the present invention, but this description is merely a preferred embodiment and should not be construed as limiting the scope of the invention. All equivalent variations and modifications made within the scope of the claims of this invention should still fall within the patent coverage of this invention.

Claims

1. A preparation method of a hop and schisandra chinensis complex enzymatic hydrolysate having a significant anti-wrinkle firming skin care effect, characterized in that, The method comprises the following steps: S1: blending hop powder, schisandra chinensis powder and a solvent to obtain a mixed solution; S2: adding a complex enzyme composition to the mixed solution, adjusting pH to 4-6.5, performing enzymolysis treatment, centrifugally collecting supernatant, performing enzyme inactivation treatment on the supernatant, and performing rotary evaporation concentration to obtain a hop and schisandra chinensis complex enzymolysis solution; The preparation method of the complex enzyme composition comprises the following steps: A1: adding pectinase, sodium alginate solution and glycerol into a reaction kettle and uniformly dispersing to obtain a pectinase dispersion liquid; dropping the pectinase dispersion liquid into a solution, controlling the temperature at 10-25 DEG C, standing for 0.5-1 h, washing with water and drying to obtain pectinase microspheres; A2: adding chitosan, acetic acid and water into a reaction bottle, uniformly dispersing, adjusting pH to 5-6, adding pectinase microspheres, controlling temperature to 10-20 DEG C, standing for 10-20 min, PBS washing, and obtaining modified pectinase microspheres; A3: adding cellulase and distilled water into a reaction kettle, uniformly dispersing, adjusting pH to 5-6, adding modified pectinase microspheres, controlling temperature to 0-10 DEG C, standing for 10-20 min, adding glutaraldehyde, incubating for 1-2 h, uniformly dispersing glycine, incubating for 0.5-1 h, PBS washing, suction filtering, and drying to obtain a complex enzyme composition; The adding ratio of pectinase, sodium alginate solution and glycerol in A1 is 0.5-1 g:100 mL:3-6 g; The adding ratio of chitosan, acetic acid, distilled water and pectinase microspheres in A2 is 1-2 g:0.8-1.2 g:100 mL:5-10 g; The adding ratio of distilled water, modified pectinase microspheres, glutaraldehyde and glycine in A3 is 100 mL:1-2 g:0.4-0.8 g:0.5-1 g; The preparation method of the solution comprises the following steps: 1-5 g , 100 mL distilled water after blending, dropwise adding PBS to adjust the pH to 5-6, and obtaining the solution; The preparation method of the sodium alginate solution comprises the following steps: blending 1-3 g of sodium alginate powder and 100 mL of distilled water, controlling temperature to 50-60 DEG C, and magnetically stirring until completely dissolved to obtain a sodium alginate solution; The hop powder is obtained by low-temperature drying hop, crushing and sieving; and the schisandra chinensis powder is obtained by low-temperature drying schisandra chinensis, crushing and sieving; The mass ratio of hop powder to schisandra chinensis powder in the mixed solution is 1:0.5-1.5; the solid-liquid ratio in the mixture is 2:50-150; and the solvent is distilled water; The mass ratio of cellulase to pectinase in the complex enzyme composition is 2-1:1; The complex enzyme composition accounts for 5-15% of the total mass of the complex enzyme composition and the mixed solution; The specific steps of the enzyme inactivation treatment are as follows: controlling temperature to 100 DEG C and incubating and stirring for 10-15 min; The specific steps of the rotary evaporation concentration are as follows: concentrating to one-half to one-fourth of the original volume. ​

Images