Self-cyclization RNA (Ribonucleic Acid) based on human tRNAPh-GAA (Gene Acetic Acid)
The efficient preparation of circular RNA in cells through human tRNA autocyclization mechanism has solved the high cost and safety problems of circular RNA in the prior art, and provided a safe and efficient method of self-cyclization of long-sequence RNA, suitable for protein expression and gene editing.
Patent Information
- Application Number
- CN202510675099.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-16
- Publication Date
- 2025-08-12
AI Technical Summary
The prior art poses high cost, low efficiency and potential safety risks in the preparation of circular RNA, especially the low success rate of long-sequence circular RNA is difficult to isolate and purify, and the use of non-humanized sequences may trigger an immune response or interfere with cellular function.
Using the autocyclization mechanism of human tRNA, by designing precursor RNA containing human tRNA splicing elements, efficient autocyclization is achieved in cells, avoiding in vitro cyclization and purification steps, reducing costs and improving safety.
It has achieved efficient and safe self-circulation of RNA in cells, able to carry long-sequence gene fragments, and used for stable protein expression and gene editing applications, reducing potential immunogenic risks and production costs.
Smart Images

Figure CN120464618A_ABST
Abstract
Description
[0001] This application is a divisional application of Chinese patent application 202311532224.2, entitled “A self-circularizing RNA based on human tRNA”, filed on November 16, 2023. Technical Field
[0002] The present invention relates to the field of biotechnology, and in particular to automatic circulating RNA (acRNA), circular RNA and a preparation method thereof. Background Art
[0003] Circular RNA (circRNA) is a type of RNA molecule that does not have a 5' cap and a 3' poly A tail, and whose 5' and 3' ends are covalently bonded to form a circular structure. It has been reported that circRNA can participate in the regulation of gene transcription, neutralization of miRNA activity and binding of RNA binding proteins, and can also serve as a template for translation into proteins (Yang, Y., et al., “Extensive translation of circular RNAs driven by N(6)-methyladenosine,”, Cell Research, 27(5): 626-641(2017); Abe, N., et al., “Rolling Circle Translation of Circular RNA in Living Human Cells”, Scientific Reports, 5: 16435(2015); Gao, X., et al., “Circular RNA-encoded oncogenic E-cadherin variant promotes glioblastoma tumorigenicity through activation of EGFR-STAT3 signaling,” Nature Cell Biology, 23(3): 278-291(2021); Pamudurti, NR., et al., “Translation of CircRNAs,” Molecular Cell, 66(1):9-21(2017). Compared with linear RNA, circRNA is less easily recognized by RNA degradation systems due to its covalently closed circular head-to-tail structure and has greater stability. With the development of RNA vaccines, circRNA has become a research hotspot in the field of nucleic acid drugs due to its high stability and simple production process. In addition, circRNA has the function of regulating gene expression and can be used as a biosensor or as a biomarker for disease treatment or diagnosis, making it a popular target for the treatment of human diseases.
[0004] In recent years, people have become increasingly interested in developing circRNA synthesis technologies. Permuted introns and exons (PIE) is currently the most studied and widely used circRNA synthesis method. In 2018, Daneil Aderson et al. used a modified PIE method to demonstrate that exogenous circRNA can stably and efficiently express proteins in eukaryotic cells (Anderson, D., et al., "Engineering circular RNA for potent and stable translation in eukaryotic cells", Nat Commun. 2018 Jul 6; 9(1): 2629). However, since the PIE method generates circRNA through spontaneous intramolecular covalent ligation reactions, its reaction characteristics may also cause intermolecular ligation to produce byproducts, and the ligation efficiency is low and the cyclization efficiency is unstable. As the length of the target RNA increases, the cyclization success rate will drop significantly and the byproducts will increase significantly. In addition, in order to remove non-circularized RNA and enrich circRNA, it is generally necessary to remove the non-circularized RNA using RNase R. However, due to the similar properties of circular RNA and linear RNA, it is difficult to obtain baseline separation on the separation column. In addition, RNase R often has residual non-specific degradation activity against circular RNA, making the large-scale preparation of circular RNA in vitro very costly. In addition, due to the inevitable quality control byproducts, degradation products caused by the enrichment step, and additional RNase R enzyme residues, the commercial quality control of circular RNA also faces great challenges.
[0005] In addition, existing studies have synthesized short circular RNA aptamers (RNA aptamers) in vitro or in cells by utilizing the tRNA intron cyclization mechanism of metazoans, effectively improving the function of RNA aptamers in regulating proteins (Litke JL, Jaffrey SR. Highly efficient expression of circular RNA aptamers in cells using autocatalytic transcripts. Nat Biotechnol. 2019 Jun; 37 (6): 667-675.). This method can achieve the cyclization of short RNAs, but the method is currently only used for the cyclization of short RNA aptamers (Broccoli, only 49 nt in length). In addition, the method uses a partial sequence of Drosophila tRNA, especially the intron portion of the tRNA. These non-humanized sequences have certain potential safety risks, such as the possible introduction of additional immunogenic reactions, or interference with the normal functions of other endogenous RNAs in the cell. Therefore, how to design a circularized RNA that is lower in cost, higher in quality and safer for long sequence gene expression is still a problem to be solved in this field.
[0006] The above-mentioned documents are all incorporated herein in their entirety. Summary of the Invention
[0007] The present invention discovered that the effective sequence of human tRNA can self-circularize in cells, and constructed a universal self-circularizing RNA (Automatic Circulating RNA, acRNA) framework template, which can be conveniently used to prepare self-circularizing RNA of different sizes. The present invention utilizes the natural tRNA splicing mechanism in cells to efficiently self-circularize RNA in cells without the need for in vitro cyclization and enrichment, greatly reducing the high cost and purification difficulty of existing in vitro cyclization methods such as PIE. At the same time, since the present invention adopts a humanized tRNA sequence, potential safety risks are also reduced. The acRNA containing a partial sequence of human tRNA provided by the present invention can also carry a long sequence of target gene fragments, and can be successfully used in various applications such as stable protein expression, gene editing, and RNA editing.
[0008] As used herein, transfer ribonucleic acid (tRNA) is a relatively small RNA. Mature tRNA is generally composed of 74-93 nucleotides, and its secondary structure is a cloverleaf structure with four stems and three rings. The three rings are the D ring, the anticodon ring, and the TΨC ring. The four stems are the D stem (the stem connected to the D ring), the anticodon stem (connected to the anticodon ring), the TΨC stem (connected to the TΨC ring), and the amino acid acceptor stem.Figure 1A As shown. tRNA genes can be divided into two categories according to whether they contain introns. The tRNA genes containing introns first transcribe the tRNA precursor containing introns, which contains intron stems and intron loops (such as Figure 1B As shown in the figure, during the maturation process after the precursor tRNA is transcribed, the precursor tRNA (pre-tRNA) needs to undergo a series of post-transcriptional processing and modification to remove the intron part, form an anticodon loop, and complete the base modification before it can generate mature tRNA. In the maturation process of pre-tRNA, a crucial step is "tRNA splicing", which is used to remove introns and connect exons. After splicing, an anticodon loop will be formed on the exon side, and the free ends of the intron stem on the intron side will also be connected to form a small circular RNA, as shown in the figure. Figure 1B As shown. Among known organisms, some tRNA genes in both prokaryotes and eukaryotes contain introns. These intron sequences must be precisely removed by tRNA splicing. Among the human tRNA genes discovered so far, tRNAs containing introns can be divided into seven categories based on their anticodons and the amino acid residues they can carry: human tRNA Tyr -GTA (SEQ ID NO: 1~13), tRNA Tyr -ATA (SEQ ID NO: 14), tRNA Ile -TAT (SEQID NO: 15~19), tRNA Arg -TCT (SEQ ID NO: 20~23), tRNA Leu -CAA(SEQ ID NO: 24~28), tRNA Pro -AGG (SEQ ID NO: 29) or tRNA Phe -GAA (e.g., SEQ ID NO: 30). In eukaryotes, tRNA splicing is divided into two processes: "splicing" and "joining." The former is responsible for removing introns from pre-tRNA and is performed by the TSEN complex; the latter is responsible for connecting the two exons that have been cut, and is mediated by tRNA ligase (RtcB).
[0009] In one aspect, the present invention provides a precursor RNA (preRNA) capable of forming a self-circularized RNA (acRNA), wherein the precursor RNA is a linear RNA comprising the following domains in order from the 5' to the 3' direction:
[0010] a: 5' end ribozyme splicing element designed based on human tRNA;
[0011] x: RNA sequence with biological activity;
[0012] d: 3' end ribozyme splicing element designed based on human tRNA,
[0013] Among them, the ribozyme splicing element designed based on human tRNA at the 5' end and / or the ribozyme splicing element designed based on human tRNA at the 3' end both contain a ribozyme recognition sequence and a partial sequence of human tRNA, and the ribozyme splicing element designed based on human tRNA at the 5' end can be cut under the action of a self-cleaving ribozyme or a DNA ribozyme to generate a 5'-hydroxyl group; the ribozyme splicing element designed based on human tRNA at the 3' end can be cut under the action of a self-cleaving ribozyme or a DNA ribozyme to generate a 2',3'-cyclic phosphate. In particular, there is at least a partial sequence of human tRNA between the ribozyme recognition sequence and the RNA sequence with biological activity, for example, part of the 3' end human tRNA is located at the 3' end of the ribozyme splicing element designed based on human tRNA at the 5' end, or part of the 5' end human tRNA is located at the 5' end of the ribozyme splicing element designed based on human tRNA at the 3' end.
[0014] In some embodiments, the biologically active RNA sequence includes but is not limited to guide RNAs used in gene editing (such as gRNA, sgRNA, crRNA, omegaRNA and pegRNA, etc.), self-recruiting RNA (arRNA), antisense RNA, interfering RNA, microRNA (microRNA), long non-coding RNA (lncRNA) and self-amplifying RNA (saRNA) used in RNA editing, as well as one or more RNA sequences encoding desired proteins such as antigens.
[0015] In some embodiments, the total number of nucleotides in the X sequence between a and d, or the total number of nucleotides in the biologically active RNA sequence, is greater than 100 nt. In some embodiments, the total number of nucleotides in the X sequence between a and d, or the total number of nucleotides in the biologically active RNA sequence, is greater than 500 nt. In some embodiments, the total number of nucleotides in the X sequence between a and d, or the total number of nucleotides in the biologically active RNA sequence, is greater than 1000 nt. In some embodiments, the total number of nucleotides in the X sequence between a and d, or the total number of nucleotides in the biologically active RNA sequence, is greater than 2000 nt. In some embodiments, the total number of nucleotides in the X sequence between a and d, or the total number of nucleotides in the biologically active RNA sequence, is greater than 5000 nt. In some embodiments, the total number of nucleotides in the X sequence between a and d, or the total number of nucleotides in the biologically active RNA sequence, is greater than 6000 nt. In some embodiments, the total number of nucleotides in the X sequence between a and d, or the total number of nucleotides in the biologically active RNA sequence, is greater than 7000 nt. In some embodiments, the total number of nucleotides in the X sequence between a and d, or the total number of nucleotides in the biologically active RNA sequence, is greater than 8000 nt. In some embodiments, the total number of nucleotides in the x sequence between a and d or the total number of nucleotides in the biologically active RNA sequence is greater than 9000 nt. In some embodiments, the total number of nucleotides in the x sequence between a and d or the total number of nucleotides in the biologically active RNA sequence is greater than 10000 nt.
[0016] In some embodiments, the total number of nucleotides in the x sequence or the total number of nucleotides in the biologically active RNA sequence is A to B nt, wherein A is less than B and A is an integer from 1 to 2000 and B is an integer from 100 to 20000, for example, A and B are independently selected from 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, 500, 600, 700, , 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 16000, 17000, 18000, 19000 and 20000. For example, the total number of nucleotides in the x sequence or the total number of nucleotides in the biologically active RNA sequence is 10-20,000, 10-15,000, 10-10,000, 10-5,000, 10-2,000, 10-1500, 10-1400, 10-1300, 10-1200, 10-1100, 50-20,000, 50-15,000, 50-10000, 50-5000, 50-2000, 50-1500, 50-1400, 50-1300, 50-1200, 50-1100, 100-20000, 100-15000, 100-10000, 100-5000, 100-2000, 100-1500, 100-1400, 100-13 00, 100-1200, 100-1100, 500-20000, 500-15000, 500-10000, 500-5000, 500-2000, 500-1500, 500-1400, 500-1300, 500-1200, 1000-20000, 1000-15000, 1000-10000 , 1000-5000, 1000-2000, 1000-1500, 1000-1400, 1000-1300, 1000-1200, 2000-20000, 2000-15000, 2000-10000, 2000-5000, 2000-4000, 2000-3000 or 2000-2500 nt.
[0017] In some embodiments, the RNA sequence with biological activity comprises or is a protein coding sequence (CDS) and an internal ribosome entry site (IRES). Specifically, the precursor RNA comprises the following domains in order from 5' to 3':
[0018] a: The 5' end of the ribozyme splicing element is designed based on human tRNA;
[0019] b: internal ribosome entry site (IRES);
[0020] c: protein coding region (CDS);
[0021] d: The ribozyme splicing element designed at the 3' end is based on human tRNA.
[0022] The 5'-end ribozyme splicing element designed based on human tRNA can be cleaved under the action of self-cleaving ribozyme or DNA ribozyme to generate 5'-hydroxyl; the 3'-end ribozyme splicing element designed based on human tRNA can be cleaved under the action of self-cleaving ribozyme or DNA ribozyme to generate 2',3'-cyclic phosphate.
[0023] In some embodiments, spacers of different sequences may be included between the nucleotide sequences of the above-mentioned domains, or a spacer may be included between the nucleotide sequences of two domains, so as to further improve the stability or expression efficiency in the cell.
[0024] Furthermore, the precursor RNA has the following structure:
[0025] abcd
[0026] The a, b, c, and d domains are connected in sequence, and b and / or c of the above domains can also be replaced by other sequences with other biological functions.
[0027] In some embodiments, the partial sequence of the human tRNA of the ribozyme splicing element designed based on human tRNA at the 5' end and the partial sequence of the human tRNA of the ribozyme splicing element designed based on human tRNA at the 3' end are respectively selected from the full-length / truncated sequence of the exon of human tRNA, and the partial sequence of the human tRNA at the 5' end and the partial sequence of the human tRNA at the 3' end contain nucleotide sequences in the human tRNA that can be partially complementary and at least form an anticodon stem.
[0028] In some embodiments, the partial sequences of the human tRNA of the ribozyme splicing element designed based on human tRNA at the 5' end and the ribozyme splicing element designed based on human tRNA at the 3' end are respectively selected from the intron sequence of human tRNA, and the partial sequence of the human tRNA at the 5' end and the partial sequence of the human tRNA at the 3' end contain nucleotide sequences in the human tRNA that can partially complement each other and form an intron stem.
[0029] In some embodiments, the ribozyme splicing elements designed based on human tRNA at the 3' and 5' ends include a partial sequence of human tRNA and a ribozyme recognition sequence. Preferably, the partial sequence of human tRNA at least includes a terminal local double-stranded RNA (anticodon stem or intron stem) sequence that can be partially complementary after ribozyme cleavage and form a human tRNA splicing site containing an intron. In addition, the 3' end of the ribozyme splicing element designed based on human tRNA at the 5' end, and / or the 5' end of the ribozyme splicing element designed based on human tRNA at the 3' end, may also contain (or not contain) additional other stems or loop structures of the human tRNA. The anticodon stem or anticodon stem + other stems + loop or intron stem structure at the end of the tRNA splicing site formed are all effective substrates for RtcB ligase.
[0030] In some embodiments, the tRNA-based ribozyme splicing element is composed of a partial tRNA sequence containing the anticodon stem in the exon and a ribozyme recognition sequence. In some embodiments, the tRNA-based ribozyme splicing element is composed of all or part of the exon sequence of the tRNA (at least containing the anticodon stem) and a ribozyme recognition sequence. In some embodiments, the tRNA intron stem and ribozyme recognition sequence are used as the tRNA ribozyme splicing element. When preparing the template plasmid, the target sequence is inserted into the exon (at least containing the anticodon stem) on the side away from the anticodon loop or the side of the intron stem close to the intron loop. When the preRNA is generated by in vitro transcription and cleaved by a ribozyme (RNA ribozyme or additional DNA ribozyme), the cleavage site occurs on the other side of the anticodon stem or intron stem where the target sequence was inserted, thereby generating a terminal end suitable for ligation, i.e., forming an open end of the anticodon loop or a free end of the intron stem away from the intron loop. Next, under the action of RNA ligase (RtcB) in vitro or in vivo, the open end side of the anticodon loop of the exon (including at least the anticodon stem) or the free end side of the intron stem away from the intron loop is ligated into a loop.
[0031] As used herein, a ribozyme splicing element designed based on human tRNA comprises a "partial sequence of human tRNA" or a "human tRNA sequence", which means that at least part of the ribonucleic acid base sequence contained in the element is identical to part or all of the natural human tRNA sequence. It should be noted that the partial ribonucleic acid base sequence may not be 100% identical to part or all of the natural human tRNA sequence. In some embodiments, the partial ribonucleic acid base sequence may contain one or more modifications (such as modifications not contained in the human tRNA sequence), such as modifications for improving the stability of nucleic acid molecules, which are known to those skilled in the art or can be reasonably determined based on technical knowledge. In some embodiments, the partial ribonucleic acid base sequence may have partial mutations, such as for improving the activity of ribozyme cleavage, which are known to those skilled in the art or can be reasonably determined based on technical knowledge.
[0032] As used herein, "full-length exon" or "full-length exon sequence" refers to the exon sequence of a human tRNA that constitutes all exon stem / loop structures. "Truncate exon" or "truncated exon sequence" refers to the exon sequence of a human tRNA that at least constitutes the anticodon stem but may lack other tRNA stem / loop structures.
[0033] As used herein, the 5'-end ribozyme splicing element designed based on human tRNA and the 3'-end ribozyme splicing element designed based on human tRNA contain the exon sequence of human tRNA, which means that the 5'-end element contains a part or all of the sequence of one of the two sequences of the human tRNA exon, and the 3'-end element contains a part or all of the sequence of the other of the two sequences of the human tRNA exon, and together cover all or part of the sequence of the exon.
[0034] As used herein, the stem and loop in the "structure of the anticodon stem or anticodon stem + other stem + loop or intron stem at the end of the tRNA splice site formed" refers to the sequence that can theoretically form the stem and / or loop in human tRNA according to the principle of base complementary pairing, that is, one of the D stem, anticodon stem, TΨC stem, amino acid acceptor stem and intron stem, and one of the D loop, anticodon loop and TΨC loop. Among them, the stem should at least include the anticodon stem or the intron stem. While including the anticodon stem, part or all of the D stem, TΨC stem or amino acid acceptor stem can also be added. For example, the stem should generally contain at least 3 or more and less than 10 paired bases (such as 3, 4, 5, 6, 7, 8, 9 or 10 paired bases). A loop can also be added, preferably a complete D loop, anticodon loop or TΨC loop.
[0035] In some embodiments, the human tRNA sequence is derived from a human tRNA containing an intron. Tyr-GTA(SEQID NO: 1~13), tRNA Tyr -ATA (SEQ ID NO: 14), tRNA Ile -TAT (SEQ ID NO: 15~19), tRNA Arg -TCT (SEQ ID NO: 20~23), tRNA Leu -CAA(SEQ ID NO: 24~28), tRNA Pro -AGG (SEQ ID NO: 29) or tRNA Phe -GAA (such as SEQ ID NO: 30).
[0036] In some embodiments, the ribozyme recognition sequence of the ribozyme splicing element designed based on human tRNA comprises a self-cleaving RNA ribozyme sequence or a sequence complementary to a DNA ribozyme.
[0037] In some embodiments, the partial sequence of human tRNA is human tRNA Tyr -GTA full-length exon, the ribozyme recognition sequence is a self-cleaving RNA ribozyme sequence, and the ribozyme splicing elements designed based on human tRNA at the 5' and 3' ends can be partially complementary after self-cleavage and form an anticodon stem, D stem, TΨC stem, amino acid acceptor stem, D loop, anticodon loop and TΨC loop. Preferably, the sequence of the ribozyme splicing element designed based on human tRNA at the 5' end is as follows (the underlined italics are tRNA sequences):
[0038] and / or
[0039] The sequence of the ribozyme splicing element designed based on human tRNA at the 3' end is as follows (the underlined italics are tRNA sequences):
[0040]
[0041] In some embodiments, the partial sequence of human tRNA is human tRNA Tyr -GTA full-length exon, the ribozyme recognition sequence is a DNAzyme complementary sequence. Preferably, the 5'-end ribozyme splicing element comprises the sequence shown in SEQ ID NO:33, the 3'-end DNAzyme sequence comprises the sequence shown in SEQ ID NO:34, the DNAzyme corresponding to the 5'-end DNAzyme complementary sequence comprises the sequence shown in SEQ ID NO:35, and the DNAzyme corresponding to the 3'-end DNAzyme complementary sequence comprises the sequence shown in SEQ ID NO:36.
[0042] The present invention also provides a self-circularizing RNA, which is an RNA formed after cleavage of any of the above-mentioned precursor RNAs, wherein the 5' end of the self-circularizing RNA is cleaved to form a hydroxyl group, and the 3' end is cleaved to form a 2',3'-cyclic phosphate.
[0043] In some embodiments, the self-circularizing RNA comprises the following domains in order from 5' to 3' direction:
[0044] a': the sequence of human tRNA with a hydroxyl group at the 5' end;
[0045] b: internal ribosome entry site (IRES);
[0046] c: protein coding region (CDS);
[0047] d': Sequence of human tRNA that forms a 2',3'-cyclic phosphate at the 3' end.
[0048] In some embodiments, domain b and / or c of the above-mentioned domains may also be replaced by other sequences having biological functions.
[0049] Furthermore, the self-circularized RNA is a linear RNA, as shown below,
[0050]
[0051] In some embodiments, the four domains a', b, c, and d' are connected in sequence, that is, the structure of the precursor RNA is 5' hydroxyl-5' end human tRNA partial sequence-internal ribosome entry site (IRES)-protein coding region (CDS)-3' end human tRNA partial sequence-2', 3' cyclic phosphate.
[0052] In some embodiments, the human tRNA sequence is a human tRNA Tyr The full-length exon of -GTA and the human tRNA sequence with a hydroxyl group at the 5' end are shown below;
[0053] 5'-OH-AACCTTAGGTCGCTGGTTCAATTCCGGCTCGAAGG...-3'(SEQ ID NO: 37)
[0054] The sequence of human tRNA that forms a 2',3'-cyclic phosphate at the 3' end is as follows:
[0055] 5'-...CCTTCGATAGCTCAGCTGGTAGAGCGGAGGTCTGTAG-2',3'-cyclic phosphate (SEQ ID NO: 38).
[0056] In some embodiments, the human tRNA sequence is a human tRNATyr -The truncated exon of GTA with a hydroxyl group at the 5' end is shown below;
[0057] 5'-OH-AACCTT......-3'(SEQ ID NO: 39)
[0058] The sequence of human tRNA that forms a 2',3'-cyclic phosphate at the 3' end is as follows:
[0059] 5'-...TAGCTCAGCTGGTAGAGCGGAGGTCTGTAG-2',3'-cyclic phosphate (SEQ ID NO: 40).
[0060] The acRNA provided by the present invention uses the effective sequence inside human tRNA as the human tRNA sequence of the human tRNA splicing element. It not only has low immunogenicity and can automatically form a circle directly in the cell, which is safe and efficient, but also can carry long-sequence target gene fragments and can be successfully used in various applications such as stable protein expression, gene editing, and RNA editing.
[0061] In a further embodiment, the 5' end human tRNA sequence and the 3' end human tRNA sequence are both partial sequences of the same human tRNA, and the 5' end human tRNA sequence and the 3' end human tRNA sequence at least contain a terminal local double-stranded RNA (anticodon stem or intron stem) sequence that can be partially complementary after ribozyme cleavage and form a human tRNA splicing site containing an intron. In addition, the 3' end of the ribozyme splicing element designed based on human tRNA at the 5' end, and / or the 5' end of the ribozyme splicing element designed based on human tRNA at the 3' end, may also contain (or not contain) additional other stems or loop structures of the human tRNA. The anticodon stem or anticodon stem + other stem + loop or intron stem structure at the end of the tRNA splicing site formed are all effective substrates for RtcB ligase.
[0062] In some further embodiments, the 5'-end and 3'-end human tRNA sequences are partial sequences of the same human tRNA, and the 5'-end human tRNA sequence and the 3'-end human tRNA sequence at least contain a terminal local double-stranded RNA (anticodon stem or intron stem) sequence that can be partially complementary after ribozyme cleavage and form a human tRNA splicing site containing an intron. In addition, the 5'-end is based on the 3'-end of the ribozyme splicing element designed for human tRNA, and / or the 3'-end is based on the 5'-end of the ribozyme splicing element designed for human tRNA, and may also contain (or not contain) additional other stem or loop structures of the human tRNA. The anticodon stem or anticodon stem + other stem + loop or intron stem structure at the end of the tRNA splicing site formed is an effective substrate for RtcB ligase. Specifically, it may contain a sequence that can form one or more stem loops of human tRNA.
[0063] The 5'-end human tRNA sequence and the 3'-end human tRNA sequence mentioned in the present invention can be partially complementary, which means that the 5' human tRNA sequence and the 3' human tRNA sequence can partially base complementarily pair to form a complete or incomplete anticodon stem or intron stem. While including the anticodon stem, part or all of the D stem, TΨC stem or amino acid acceptor stem can also be added. For example, the stem should generally contain at least 3 or more and less than 10 paired bases (such as 3, 4, 5, 6, 7, 8, 9 or 10 paired bases), and a loop can also be added, preferably a complete D loop, anticodon loop or TΨC loop.
[0064] The human tRNA provided in this application is a tRNA containing an intron. Figure 1B 、 1C , the present invention splits tRNA into an exon portion and an intron portion. In some embodiments, the two exons remaining after tRNA removes the introns are used as the tRNA sequences at the 5' and 3' ends, respectively. Target sequences such as the internal ribosome entry site (IRES) and the protein coding region (CDS) are connected to the two ends of the exon open on the side of the original tRNA away from the anticodon loop. The opening left after the original intron is cleaved can be cleaved to form a 5'-hydroxyl group and 2', 3'-cyclic phosphates, which are then connected by a ligase to form an anticodon loop, thereby forming a circular RNA. In some embodiments, after tRNA removes the exons, an intron sequence remains. Target sequences such as the internal ribosome entry site (IRES) and the protein coding region (CDS) are inserted into the intron loop side of the intron sequence. The two chains of the inserted intron stem are used as the tRNA sequences at the 5' and 3' ends, respectively. After cleavage, the 5'-hydroxyl group and 2', 3'-cyclic phosphates are obtained and then connected by a ligase to form a circular RNA.
[0065] The splicing element designed based on ribozymes provided by the present invention includes a 5' end human tRNA sequence or a 3' end human tRNA sequence and a ribozyme recognition sequence, wherein the 5' human tRNA sequence and the 3' human tRNA sequence at least contain a terminal local double-stranded RNA (anticodon stem or intron stem) sequence that can be partially complementary after ribozyme cutting and form a human tRNA splicing site containing an intron. In addition, the 3' end of the ribozyme splicing element designed based on human tRNA at the 5' end, and / or the 5' end of the ribozyme splicing element designed based on human tRNA at the 3' end, may also contain (or not contain) additional other stems or loop structures of the human tRNA. The anticodon stem or anticodon stem + other stem + loop or intron stem structure at the end of the tRNA splicing site formed are all effective substrates for RtcB ligase.
[0066] In some further embodiments, the human tRNA is a human tRNA Tyr -GTA (SEQ ID NO: 1~13), tRNA Tyr -ATA (SEQ ID NO: 14), tRNA Ile -TAT (SEQ ID NO: 15~19), tRNA Arg -TCT (SEQ ID NO: 20~23), tRNA Leu -CAA(SEQ ID NO: 24~28), tRNA Pro -AGG (SEQ ID NO: 29) or tRNA Phe -GAA (such as SEQ ID NO: 30).
[0067] In some further embodiments, human tRNA Tyr The exon or intron sequence portion of -GTA (SEQ ID NOs: 1 to 13, uppercase portions are exons, lowercase portions are introns) was used to design ribozyme splicing elements at the 5' and 3' ends.
[0068] In some further embodiments, human tRNA Tyr The exon or intron sequence portion of -ATA (SEQ ID NO: 14, the uppercase portion is the exon, the lowercase portion is the intron) was used to design the ribozyme splicing elements at the 5' end and the 3' end.
[0069] In some further embodiments, human tRNA Ile The exon or intron sequence portion of -TAT (SEQ ID NO: 15-19, the uppercase portion is the exon, and the lowercase portion is the intron) was used to design the ribozyme splicing elements at the 5' end and the 3' end.
[0070] In some further embodiments, human tRNA Arg The exon or intron sequence portion of -TCT (SEQ ID NOs: 20-23, uppercase portions are exons, lowercase portions are introns) was used to design ribozyme splicing elements at the 5' and 3' ends.
[0071] In some further embodiments, human tRNA Leu The exon or intron sequence portion of -CAA (SEQ ID NOs: 24-28, uppercase portions are exons, lowercase portions are introns) was used to design ribozyme splicing elements at the 5' and 3' ends.
[0072] In some further embodiments, human tRNA Pro The exon or intron sequence portion of -AGG (SEQ ID NO: 29, the uppercase portion is the exon, the lowercase portion is the intron) was used to design the ribozyme splicing elements at the 5' end and the 3' end.
[0073] In some further embodiments, human tRNA Phe The exon or intron sequence portion of -GAA (SEQ ID NO: 30, the uppercase portion is the exon, the lowercase portion is the intron) was used to design the ribozyme splicing elements at the 5' end and the 3' end.
[0074] In some further embodiments, the human tRNA is a human tRNA Tyr -GTA, the full-length exon sequence of the human tRNA with 5' end ribozyme splicing element is shown below:
[0075] 5'-AACCTTAGGTCGCTGGTTCAATTCCGGCTCGAAGG-3' (SEQ ID NO: 41), and / or
[0076] The full-length exon sequence of the human tRNA with 3' end ribozyme splicing element is shown below:
[0077] 5'-CCTTCGATAGCTCAGCTGGTAGAGCGGAGGTCTGTAG-3' (SEQ ID NO: 42).
[0078] In some embodiments, the human tRNA sequence of the 5'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 41. In some embodiments, the human tRNA sequence of the 3'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 42. In some embodiments, the human tRNA sequence of the 5'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 41, and the human tRNA sequence of the 3'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 42. The 5'-end human tRNA sequence and the 3'-end human tRNA sequence at least contain a terminal local double-stranded RNA (anticodon stem) sequence that is partially complementary after ribozyme cleavage and forms a unique terminal local double-stranded RNA (anticodon stem) sequence at the human tRNA splicing site containing an intron. In addition, the 3' end of the ribozyme splicing element designed based on the human tRNA at the 5' end, and / or the 5' end of the ribozyme splicing element designed based on the human tRNA at the 3' end, may also contain (or not contain) additional stem or loop structures of the human tRNA. The anticodon stem or anticodon stem + other stem + loop structure at the end of the tRNA splice site is an effective substrate for RtcB ligase.
[0079] In some further embodiments, the human tRNA is a human tRNA Tyr -GTA, the sequence of the human tRNA truncated exon with the 5' end ribozyme splicing element is shown below:
[0080] 5'-AACCTT-3' (SEQ ID NO: 43), and / or
[0081] The sequence of the human tRNA truncated exon with the 3' end ribozyme splicing element is shown below:
[0082] 5'-TAGCTCAGCTGGTAGAGCGGAGGTCTGTAG-3' (SEQ ID NO: 44).
[0083] In some further embodiments, the human tRNA is a human tRNA Tyr -GTA, the tRNA intron sequence of the 5' end human ribozyme splicing element is as follows:
[0084] 5'-AATGCGGA-3' (SEQ ID NO: 45), and / or
[0085] The human tRNA intron sequence of the 3' end ribozyme splicing element is shown below:
[0086] 5'-AACGTTTTTGGAC-3' (SEQ ID NO: 46).
[0087] In some further embodiments, the human tRNA is a human tRNA Tyr -ATA, the full-length exon sequence of human tRNA with 5' end ribozyme splicing element is shown below:
[0088] 5'-GTCCTTAGGTTGCTGGTTCGATTCCAGCTTGAAGG-3' (SEQ ID NO: 47), and / or
[0089] The full-length exon sequence of the human tRNA with 3' end ribozyme splicing element is shown below:
[0090] 5'-CCTTCAATAGTTCAGCTGGTAGAGCAGAGGACTATAG-3' (SEQ ID NO: 48).
[0091] In some embodiments, the human tRNA sequence of the 5'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 47. In some embodiments, the human tRNA sequence of the 3'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 48. In some embodiments, the human tRNA sequence of the 5'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 47, and the human tRNA sequence of the 3'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 48. The 5'-end human tRNA sequence and the 3'-end human tRNA sequence at least comprise a terminal local double-stranded RNA (anticodon stem) sequence that is partially complementary to each other after ribozyme cleavage and forms a unique terminal local double-stranded RNA (anticodon stem) sequence at the human tRNA splicing site containing an intron. In addition, the 3'-end of the ribozyme splicing element designed based on the human tRNA at the 5'-end, and / or the 5'-end of the ribozyme splicing element designed based on the human tRNA at the 3'-end, may also contain (or not contain) additional stem or loop structures of the human tRNA. The anticodon stem or anticodon stem + other stem + loop structure at the end of the tRNA splice site is an effective substrate for RtcB ligase.
[0092] In some further embodiments, the human tRNA is a human tRNA Ile -TAT, the full-length exon sequence of the human full-length tRNA with 5' end ribozyme splicing element is shown below:
[0093] 5'-AAGCCGAGGTTGTGAGTTCAAGCCTCACCTGGAGCA-3' (SEQ ID NO: 49), and / or
[0094] The full-length exon sequence of the human tRNA with 3' end ribozyme splicing element is shown below:
[0095] 5'-GCTCCAGTGGCGCAATCGGTTAGCGCGGTTCTTATA-3' (SEQ ID NO: 50).
[0096] In some embodiments, the human tRNA sequence of the 5'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 49. In some embodiments, the human tRNA sequence of the 3'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 50. In some embodiments, the human tRNA sequence of the 5'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 49, and the human tRNA sequence of the 3'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 50. The 5'-end human tRNA sequence and the 3'-end human tRNA sequence at least contain a terminal local double-stranded RNA (anticodon stem) sequence that is partially complementary after ribozyme cleavage and forms a unique terminal local double-stranded RNA (anticodon stem) sequence at the human tRNA splicing site containing an intron. In addition, the 3' end of the ribozyme splicing element designed based on the human tRNA at the 5' end, and / or the 5' end of the ribozyme splicing element designed based on the human tRNA at the 3' end, may also contain (or not contain) additional stem or loop structures of the human tRNA. The anticodon stem or anticodon stem + other stem + loop structure at the end of the tRNA splice site is an effective substrate for RtcB ligase.
[0097] In some further embodiments, the human tRNA is a human tRNA pro -AGG, the full-length exon sequence of the human tRNA with the 5' end ribozyme splicing element is shown below:
[0098] 5'-AAGGAGACCCAAGAGGTCCCGGGTTCAAATCCCGGACGAGCC-3' (SEQ ID NO: 51), and / or
[0099] The full-length exon sequence of the human tRNA with 3' end ribozyme splicing element is shown below:
[0100] 5'-GGCTCGTTGGTCTAGGGGTGTGGTTCTCGTTTAGGG-3' (SEQ ID NO: 52).
[0101] In some embodiments, the human tRNA sequence of the 5'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 51. In some embodiments, the human tRNA sequence of the 3'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 52. In some embodiments, the human tRNA sequence of the 5'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 51, and the human tRNA sequence of the 3'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 52. The 5'-end human tRNA sequence and the 3'-end human tRNA sequence at least contain a terminal local double-stranded RNA (anticodon stem) sequence that can be partially complementary after ribozyme cleavage and form a human tRNA splicing site containing an intron. In addition, the 3' end of the ribozyme splicing element designed based on the human tRNA at the 5' end, and / or the 5' end of the ribozyme splicing element designed based on the human tRNA at the 3' end, may also contain (or not contain) additional stem or loop structures of the human tRNA. The anticodon stem or anticodon stem + other stem + loop structure at the end of the tRNA splice site is an effective substrate for RtcB ligase.
[0102] In some further embodiments, the human tRNA is a human tRNA Phe -GAA, the full-length exon sequence of the human tRNA with the 5' end ribozyme splicing element is shown below:
[0103] 5'-AACTGCAGGTCTCTGGTTCAATTCCGGGTTTCGAC-3' (SEQ ID NO: 53), and / or
[0104] The sequence of the full-length human tRNA exon containing the 3' ribozyme splicing element is shown below:
[0105] 5'-GCCGAAATAGCTCAATTGGGAGAGTGTTAGTCTGAAG-3' (SEQ ID NO: 54).
[0106] In some embodiments, the human tRNA sequence of the 5'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 53. In some embodiments, the human tRNA sequence of the 3'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 54. In some embodiments, the human tRNA sequence of the 5'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 53, and the human tRNA sequence of the 3'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 54. The human tRNA sequence of the 5'-end ribozyme splicing element and the human tRNA sequence of the 3'-end ribozyme splicing element at least contain a terminal local double-stranded RNA (anticodon stem) sequence that can be partially complementary after ribozyme cleavage and form a human tRNA splicing site containing an intron. In addition, the 3' end of the ribozyme splicing element designed based on the human tRNA at the 5' end, and / or the 5' end of the ribozyme splicing element designed based on the human tRNA at the 3' end, may also contain (or not contain) additional stem or loop structures of the human tRNA. The anticodon stem or anticodon stem + other stem + loop structure at the end of the tRNA splice site is an effective substrate for RtcB ligase.
[0107] In some further embodiments, the human tRNA is a human tRNA Leu -CAA, the full-length exon sequence of human tRNA with 5' end ribozyme splicing element is shown below:
[0108] 5'-AACTGGTCTCCGTATGGAGGGCGTGGGTTCGAATCCCACTTCTGACA-3' (SEQ ID NO: 55), and / or
[0109] The full-length exon sequence of the human tRNA with 3' end ribozyme splicing element is shown below:
[0110] 5'-GTCAGGATGGCCGAGTGGTCTAAGGCGCCAGTCTCAAG-3' (SEQ ID NO: 56).
[0111] In some embodiments, the human tRNA sequence of the 5'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 55. In some embodiments, the human tRNA sequence of the 3'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 56. In some embodiments, the human tRNA sequence of the 5'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 55, and the human tRNA sequence of the 3'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 56. The 5' human tRNA sequence and the 3' human tRNA sequence at least contain a terminal local double-stranded RNA (anticodon stem) sequence that is partially complementary to each other after ribozyme cleavage and forms a unique terminal double-stranded RNA (anticodon stem) sequence at the human tRNA splicing site containing an intron. In addition, the 3' end of the ribozyme splicing element designed based on the human tRNA at the 5' end, and / or the 5' end of the ribozyme splicing element designed based on the human tRNA at the 3' end, may also contain (or not contain) additional stem or loop structures of the human tRNA. The anticodon stem or anticodon stem + other stem + loop structure at the end of the tRNA splice site is an effective substrate for RtcB ligase.
[0112] In some further embodiments, the human tRNA is a human tRNA Arg -TCT, the full-length exon sequence of the human tRNA with the 5' end ribozyme splicing element is shown below:
[0113] 5'-AATCAAAGGTTGTGGGTTCGAGTCCCACCAGAGTCG-3' (SEQ ID NO: 57), and / or
[0114] The full-length exon sequence of the human tRNA with 3' end ribozyme splicing element is shown below:
[0115] 5'-GGCTCTGTGGCGCAATGGATAGCGCATTGGTCTTCTA-3' (SEQ ID NO: 58).
[0116] In some embodiments, the human tRNA sequence of the 5'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 57. In some embodiments, the human tRNA sequence of the 3'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 58. In some embodiments, the human tRNA sequence of the 5'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 57, and the human tRNA sequence of the 3'-end ribozyme splicing element is all or part of the sequence of SEQ ID NO: 58. The 5' human tRNA sequence and the 3' human tRNA sequence at least contain a terminal local double-stranded RNA (anticodon stem) sequence that is partially complementary to each other after ribozyme cleavage and forms a unique terminal double-stranded RNA (anticodon stem) sequence at the human tRNA splicing site containing an intron. In addition, the 3' end of the ribozyme splicing element designed based on the human tRNA at the 5' end, and / or the 5' end of the ribozyme splicing element designed based on the human tRNA at the 3' end, may also contain (or not contain) additional stem or loop structures of the human tRNA. The anticodon stem or anticodon stem + other stem + loop structure at the end of the tRNA splice site is an effective substrate for RtcB ligase.
[0117] The present invention also provides a nucleic acid vector for producing precursor RNA, wherein the vector comprises the coding sequence of any of the circular RNA precursors described above.
[0118] The present invention also provides a nucleic acid vector for producing a precursor RNA of a circular RNA, wherein the sequence of the vector includes the coding sequences of the following elements in order:
[0119] T7 promoter-5' end ribozyme splicing element designed based on human tRNA-internal ribosome entry site (IRES)-protein coding region (CDS)-3' end ribozyme splicing element designed based on human tRNA-linearized enzyme cutting site sequence.
[0120] In some further embodiments, the ribozyme splicing element designed based on human tRNA at the 5' end and the ribozyme splicing element designed based on human tRNA at the 3' end both include a human tRNA sequence and a ribozyme recognition sequence, the 5' human tRNA sequence and the 3' human tRNA sequence are both partial sequences of the same human tRNA, and the 5' human tRNA sequence and the 3' human tRNA sequence are partially complementary and can form at least one stem-loop of the human tRNA.
[0121] In some further embodiments, the human tRNA is a human tRNA Tyr -GTA (SEQ ID NO: 1~13), tRNA Tyr -ATA (SEQ ID NO: 14), tRNAIle -TAT (SEQ ID NO: 15~19), tRNA Arg -TCT (SEQ ID NO: 20~23), tRNA Leu -CAA(SEQ ID NO: 24~28), tRNA Pro -AGG (SEQ ID NO: 29) or tRNA Phe -GAA (such as SEQ ID NO: 30).
[0122] In some further embodiments, the ribozyme recognition sequence is a sequence encoding a self-cleaving ribozyme. The self-cleaving ribozyme described herein is a ribozyme that can self-cleave and generate a 5' terminal hydroxyl group and a 3' end 2', 3'-cyclic phosphate structure. In some embodiments, the self-cleaving ribozyme can include one or two of RNase P, rRNA, lead enzyme, group I intron ribozyme, group II intron ribozyme, GIR1 branch ribozyme, glmS ribozyme, hairpin ribozyme, hammerhead ribozyme, HDV ribozyme, twister ribozyme, twister sister ribozyme, VS ribozyme, pistol ribozyme, hatchet ribozyme, and viroid.
[0123] In some embodiments, the ribozyme recognition sequence is a sequence complementary to a DNA ribozyme and can be targeted for recognition and site-specific cleavage by the DNA ribozyme. The DNA ribozyme described herein is a DNA ribozyme that can recognize a specific RNA sequence and cleave RNA to form a 5' terminal hydroxyl group and a 3' terminal 2',3'-cyclic phosphate structure. In some embodiments, the DNA ribozyme is one or two of the following: 10-23 DNA ribozyme, 8-17 DNA ribozyme, 17E DNA ribozyme, AC07 DNA ribozyme, AC14 DNA ribozyme, and AC17 DNA ribozyme.
[0124] In some further embodiments, the DNAzyme is a 10-23 DNAzyme.
[0125] On the other hand, the present invention also provides a circular RNA, wherein the circular RNA is a circular RNA formed by self-circularization of any of the self-circularizing RNAs described above in the presence of RNA ligase.
[0126] In some further embodiments, the circular RNA comprises the following domains:
[0127] a”: 5’ end human tRNA sequence;
[0128] b: internal ribosome entry site (IRES);
[0129] c: protein coding region (CDS); and
[0130] d”: 3’ end human tRNA sequence;
[0131] The 5' end human tRNA sequence is covalently linked to the 3' end human tRNA sequence.
[0132] In some further embodiments, the 5'-end human tRNA sequence and the 3'-end human tRNA sequence are both partial sequences of the same human tRNA, and the 5'-end human tRNA sequence and the 3'-end human tRNA sequence contain or are nucleotide sequences that are partially complementary and can form an anticodon stem or intron stem of at least one human tRNA.
[0133] In some further embodiments, the sequence of the human tRNA is selected from tRNA containing introns Tyr -GTA(SEQID NO: 1~13), tRNA Tyr -ATA (SEQ ID NO: 14), tRNA Ile -TAT (SEQ ID NO: 15~19), tRNA Arg -TCT (SEQ ID NO: 20~23), tRNA Leu -CAA(SEQ ID NO: 24~28), tRNA Pro -AGG (SEQ ID NO: 29) or tRNA Phe -GAA (such as SEQ ID NO: 30).
[0134] On the other hand, the present invention also provides a method for preparing circular RNA, the method comprising:
[0135] (1) Providing any of the above nucleic acid vectors, linearizing and then in vitro transcribed to obtain a linear precursor RNA;
[0136] (2) obtaining the self-cyclized RNA containing a 5' terminal hydroxyl group and a 3' terminal 2', 3'-cyclic phosphate structure through ribozyme self-cleavage or DNA ribozyme cleavage during in vitro transcription;
[0137] (3) Self-circularized RNA undergoes covalent binding under the action of RNA ligase to form circular RNA.
[0138] In some embodiments, the ribozyme recognition sequence is set to the sequence of a self-cleaving ribozyme, such as Twisterribozyme, which undergoes self-cleavage during the transtranscription process of the nucleic acid vector, directly forming a precursor RNA containing a 5' terminal hydroxyl group and a 3' terminal 2', 3'-cyclic phosphate. In some embodiments, the ribozyme recognition sequence is set to a sequence complementary to a DNA ribozyme, and after in vitro transcription into the initial RNA, the DNA ribozyme is used for targeted cleavage, with the cleavage sites placed at the beginning of the 5' end human tRNA splicing element and the end of the 3' end human tRNA splicing element, to obtain a self-circularized RNA containing a 5' terminal hydroxyl group and a 3' terminal 2', 3'-cyclic phosphate.
[0139] In some embodiments, a ligase is provided that can bind the 5'-terminal hydroxyl group to the 3'-terminal 2',3'-cyclic phosphate. Specifically, the ligase can be RtcB. In some embodiments, acRNA is transfected into cells using a variety of transfection methods, such as lipofectamine transfection, calcium transfection, PEI transfection, or electroporation. PEI transfection is preferred in this embodiment. Natural RNA ligase exists within cells, and acRNA automatically generates circular RNA within the cells.
[0140] In another aspect, the present invention further provides a method for recombinantly producing a target protein, comprising:
[0141] preparing the self-circularizing RNA or circular RNA of the present invention, wherein the protein coding region in the self-circularizing RNA or circular RNA is a nucleic acid sequence encoding the target protein;
[0142] The self-circularizing RNA or circular RNA is introduced into the host cell, for example by transfection, in particular by a transfection method using PEI,
[0143] Expressing the protein of interest in a host cell; and
[0144] Optionally, the expressed protein of interest is isolated and / or purified.
[0145] In some embodiments, the host cell can be a primary cell or cell line of a human or non-human mammal (eg, mouse, rat, rabbit, sheep, cow, horse), such as but not limited to CHO, Hela, 293 cells.
[0146] In some embodiments, the circular RNA is prepared as follows: providing the nucleic acid vector of the present invention, linearizing it, and then transcribing it in vitro to obtain a linear precursor RNA; obtaining a self-circularized RNA containing a 5'-hydroxyl group and a 2', 3'-cyclic phosphate group by self-cleavage of an RNA ribozyme during in vitro transcription or by cleavage of a DNA ribozyme after in vitro transcription; and covalently binding the two ends of the self-circularized RNA in vitro under the action of an RNA ligase to form the circular RNA, or introducing the self-circularized RNA into a host cell (for example, by transfection, in particular by using a PEI transfection method), and automatically circularizing in the cell to generate a circular RNA under the action of a natural RNA ligase present in the host cell.
[0147] On the other hand, the present invention also provides a method for preparing an RNA vaccine, comprising: preparing the circular RNA of the present invention, wherein the protein coding region in the circular RNA is a nucleic acid sequence encoding a target immunogen.
[0148] In some embodiments, the circular RNA is prepared as follows: providing the nucleic acid vector of the present invention, linearizing it, and then transcribing it in vitro to obtain a linear precursor RNA; obtaining a self-circularized RNA containing a 5'-hydroxyl group and a 2', 3'-cyclic phosphate group by self-cleavage of an RNA ribozyme during in vitro transcription or by cleavage of a DNA ribozyme after in vitro transcription; and covalently binding the two ends of the self-circularized RNA under the action of an RNA ligase to form the circular RNA.
[0149] On the other hand, the present invention also provides the use of the circular RNA of the present invention for preparing an RNA vaccine, wherein the protein coding region in the circular RNA is a nucleic acid sequence encoding an immunogen of interest.
[0150] On the other hand, the present invention also provides a method for treating a disease or immunizing a subject, comprising: preparing the self-circularizing RNA or circular RNA of the present invention, wherein the protein coding region in the self-circularizing RNA or circular RNA is a nucleic acid sequence encoding a target therapeutic protein or immunogen, and administering the self-circularizing RNA or circular RNA to a subject in need, thereby expressing the therapeutic protein or immunogen in the subject.
[0151] In some embodiments, the subject is a human or non-human mammal, such as a mouse, rat, rabbit, sheep, cow, horse, preferably a human.
[0152] The present invention uses the effective sequence of human tRNA as part of the splicing element, which can self-circularize in the cell and construct a universal self-circularizing RNA (acRNA) framework template, which can be conveniently used to prepare self-circularized RNA of different sizes. By utilizing the natural tRNA splicing mechanism in the cell, the present invention can not only perform efficient self-circularization of RNA in the cell through endogenous RNA ligase, but also eliminate the need for in vitro cyclization and enrichment, greatly reducing the high cost and purification difficulty of the existing PIE method, but also reducing potential safety risks. It can also carry long-sequence target gene fragments and can be successfully used in various applications such as stable protein expression, gene editing, and RNA editing. BRIEF DESCRIPTION OF THE DRAWINGS
[0153] In order to better understand the present invention and to more clearly show how to implement the present invention, the features of an embodiment according to the present invention will now be described by way of example with reference to the accompanying drawings, in which:
[0154] Figure 1A : Schematic diagram of the mature tRNA four-stem three-ring; Figure 1B : tRNA containing introns Tyr -GTA schematic diagram, where the part above the right arrow is tRNA Tyr -GTA exon, the part below the left arrow is tRNA Tyr -Intron of GTA; Figure 1C : Schematic diagram of tRNA splicing elements.
[0155] Figure 2 : Schematic diagram of the core elements of the plasmid DNA template, mainly including T7 promoter-5' end ribozyme splicing element designed based on human tRNA-IRES-coding region (CDS)-3' end ribozyme splicing element designed based on human tRNA-linearization enzyme cutting site sequence.
[0156] Figure 3A Schematic diagram of in vitro transcription. During in vitro transcription, ribozyme self-cleavage occurs, yielding two small ribozyme fragments and an acRNA containing the coding fragment. Figure 3B : Capillary electrophoresis results.
[0157] Figure 4A : Schematic diagram of circular RNA formation in cells. Under the action of endogenous RNA ligase, the 5' and 3' ends of acRNA react to form a closed loop; Figure 4B : Fluorescence expression detection of 293T cells 48 hours after transfection of acRNA and negative control. The left is the fluorescence field image, and the right is the corresponding bright field image. The negative control is a linear RNA without human tRNA splicing elements. Figure 4C: Luciferase assay in 293T cells 24 and 48 hours after acRNA transfection.
[0158] Figure 5A Circularization detection strategy diagram. Upstream and downstream primers are designed at the 3' and 5' ends of the acRNA, respectively. Since both ends of the acRNA are open, specific bands cannot be amplified. However, specific bands can be amplified after self-circularization to form circular RNA. Figure 5B :Gel electrophoresis of cDNA PCR amplification; Figure 5C : Sequencing peak diagram of PCR amplification products.
[0159] Figure 6 : (A) Fluorescence expression detection of CHO cells 48 hours after acRNA transfection, the upper part is the fluorescence field image, and the lower part is the corresponding bright field image; (B) Fluorescence expression detection of Hela cells 48 hours after acRNA transfection, the upper part is the fluorescence field image, and the lower part is the corresponding bright field image.
[0160] Figure 7 ; Based on human tRNA Tyr -GTA full-length exon, truncated exon designed circular RNA, corresponding linear RNA (mRNA), transfected in vitro circular RNA (PIE) and untreated cells (CK) were used to detect the immunogenicity of different cytokines.
[0161] Figure 8A and Figure 8B : 293T cells were transfected with acRNA whose ribozyme recognition sequence was the DNA ribozyme target cleavage region for 24 hours ( Figure 8A ) and 48 hours ( Figure 8B ), the left is the fluorescence field image, the right is the corresponding bright field image, and the negative control is a linear RNA without human tRNA splicing elements.
[0162] Figure 9 : Luciferase assay results after 293T cells were transfected with acRNA containing different human tRNA splicing elements for 48 hours. The acRNA negative control was a linear RNA without human tRNA splicing elements. DETAILED DESCRIPTION
[0163] definition
[0164] In order to provide a clear and consistent understanding of the terms used in the specification of the present invention, some definitions are provided below. In addition, unless otherwise specified, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention belongs.
[0165] When used in conjunction with the term "comprising" in the claims and / or the specification, the use of the word "a" can mean "one", but it is also known in the sense of "one or more", "at least one" and "one or more than one". Similarly, the word "another" can mean at least a second or many.
[0166] As used in this specification and claims, the words "comprising" (and any form of comprising, such as "including" and "comprising"), "having" (and any form of having, "having", "including" and "containing") are inclusive and open-ended and do not exclude additional, unrecited elements or processing steps.
[0167] "Polynucleotide," "nucleic acid sequence," "nucleotide sequence," or "nucleic acid fragment" are used interchangeably to refer to a single-stranded or double-stranded RNA or DNA polymer, optionally containing synthetic, non-natural, or altered nucleotide bases. Nucleotides (usually in their 5'-monophosphate form) are designated by their single letters as follows: "A" for adenylic acid or deoxyadenylic acid (representing RNA or DNA, respectively), "C" for cytidylic acid or deoxycytidylic acid, "G" for guanylic acid or deoxyguanylic acid, "U" for uridylic acid, "T" for deoxythymidylic acid, "R" for purine (A or G), "Y" for pyrimidine (C or T), "K" for G or T, "H" for A or C or T, "I" for inosine, and "N" for any nucleotide. Although nucleotide sequences herein may be expressed as DNA sequences (including T(s)), when referring to RNA, one skilled in the art can readily determine the corresponding RNA sequence (i.e., replacing T with U). Herein, unless otherwise indicated, references to nucleic acid sequences are from left to right in the 5' to 3' direction, and references to amino acid sequences are from left to right in the amino terminus (N) to the carboxyl terminus (C) direction.
[0168] "Precursor RNA" or "circular RNA precursor" in this article refers to a linear RNA molecule with tRNA sequences at both ends that has not been cut. The precursor RNA of circular RNA contains a ribozyme recognition sequence and can be transcribed from a nucleic acid vector containing the coding sequence of the circular RNA precursor, or the circular RNA precursor can also be obtained by chemical synthesis. Since the self-cleaving ribozyme of the "precursor RNA" can effectively cut to form a 5' terminal hydroxyl group and a 3' end 2,3-cyclic phosphate during the transcription process, and then self-circulate under the action of a ligase, in some cases the self-circularizing RNA (Automatic Cyclization RNA, acRNA) involved in the present invention refers to the precursor RNA that is directly cut into a 5' terminal hydroxyl group and a 3' end 2,3-cyclic phosphate during the transcription process, and the RNA generated after self-circularization is a circular RNA (Circular RNA, circRNA).
[0169] "Circular RNA precursor" or "precursor RNA" can be (e.g., chemically) unmodified, partially modified, or fully modified. In some embodiments, the circular RNA precursor comprises at least one nucleotide modification. In some embodiments, up to 100% of the nucleotides of the circular RNA precursor are modified. In some embodiments, at least one nucleotide modification is a cytidine modification, a uridine modification, or an adenosine modification. In some embodiments, at least one nucleoside modification is selected from the group consisting of 5-methylcytosine (m5C), N6-methyladenosine (m6A), pseudouridine (ψ), N1-methylpseudouridine (m1ψ), and 5-methoxyuridine (5moU). In some instances, the circular RNA precursor comprises less than 100%, less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 15%, less than 10%, less than 5%, or less than 1% of a specific nucleotide modification. As used herein, the percentage of a particular nucleotide modification refers to the ratio of nucleotides in a sequence that have undergone that particular modification to the nucleotides that can undergo that particular modification.
[0170] "Reduced immunogenicity" may refer to a circular RNA that elicits a reduced immune response upon contact with a cell, i.e., an immune response that is lower than the level of a control circular RNA or a control linear RNA. For example, a reduced immune response refers to a reduction in cytokine expression. Cytokines include, but are not limited to, CCL2, TNF, EIF2AK2, and / or RIG-I. In some embodiments, the immunogenicity of the circular RNA is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or more. Reduced immunogenicity can be determined by methods well known in the art.
[0171] As used herein, the term "domain" refers to a specific region of a larger construct such that the domain is contained within or is a part of a larger construct. With respect to nucleic acids, a domain may refer to a coding sequence found within a larger construct containing multiple coding sequences.
[0172] When applied to a polynucleotide, the term "encoding" can refer to a polynucleotide that, when in its native state or when manipulated by methods well known to those skilled in the art, can be transcribed and / or translated to produce mRNA for a polypeptide and / or fragment thereof, which is said to "encode" the polypeptide. The antisense strand is the complementary sequence of such a nucleic acid, and the coding sequence can be inferred from the antisense strand.
[0173] As used herein, "expression" may refer to the process by which a polynucleotide is transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. If the polynucleotide is derived from genomic DNA, expression in eukaryotic cells may include splicing of the mRNA.
[0174] "Homology" or "identity" or "similarity" can refer to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing positions in each sequence that can be aligned for comparison purposes. For example, when a position in the compared sequences is occupied by the same base or amino acid, then the molecules are homologous at that position. The degree of homology between sequences is a function of the number of matching or homologous positions that the sequences have. "Unrelated" or "non-homologous" sequences have less than 40% identity or alternatively less than 25% identity with a sequence of the present disclosure.
[0175] Homology can refer to the percentage (%) identity of a sequence to a reference sequence. In fact, any particular sequence can be at least 50%, 60%, 70%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to any sequence described herein, and such a particular peptide, polypeptide or nucleic acid sequence can be routinely determined using known computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Unix version 8, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wisconsin 53711). When using Bestfit or any other sequence alignment program to determine whether a particular sequence is, for example, 95% identical to a reference sequence, parameters can be set so that the identity percentage is calculated over the full length of the reference sequence and homology gaps are allowed to account for up to 5% of the total reference sequence.
[0176] As used herein, "5'-end ribozyme splicing element designed based on human tRNA" means a nucleotide sequence at the 5' side of the circular RNA precursor or precursor RNA, which is designed to contain a ribozyme recognition sequence according to the sequence of human tRNA.
[0177] As used herein, "3'-end ribozyme splicing element designed based on human tRNA" means a nucleotide sequence at the 3' side of the circular RNA precursor or precursor RNA, which is designed to contain a ribozyme recognition sequence according to the sequence of human tRNA.
[0178] As used herein, "designed to include a ribozyme recognition sequence based on the sequence of human tRNA" refers to a naturally occurring sequence in the human tRNA sequence, or a sequence produced by modifying one or more nucleotide positions thereof (such as insertion, deletion, substitution or a combination thereof, etc.) and / or adding a suitable sequence to the end of the human tRNA, so that it can be recognized by the desired ribozyme and cleave the precursor RNA to form the 5'-terminal hydroxyl group or the 3'-terminal 2,3-cyclic phosphate.
[0179] As used herein, a ribozyme recognition sequence refers to a sequence capable of causing enzymatic cleavage, including, for example, a self-cleaving ribozyme sequence and a DNA ribozyme complementary sequence that can be targeted for recognition and site-directed cleavage by a DNA ribozyme.
[0180] As used herein, "human tRNA sequence" refers to a sequence having a nucleotide sequence identical to that of human tRNA, which can be derived from human tRNA itself or obtained by other means, such as artificial synthesis or transcription from a recombinant vector.
[0181] As used herein, "biologically active RNA sequence" means an RNA sequence that can achieve a desired biological effect, including but not limited to functional RNA for regulation or other purposes, coding sequences for protein expression, etc. In some embodiments, the biologically active RNA sequence includes but is not limited to one or more RNA sequences such as guide RNAs (such as gRNA, sgRNA, crRNA, omegaRNA, and pegRNA, etc.) used in gene editing, self-recruiting RNA (arRNA), antisense RNA, interfering RNA, microRNA (microRNA), long non-coding RNA (lncRNA), and self-amplifying RNA (saRNA) used in RNA editing.
[0182] As used herein, "comprising a nucleotide sequence that forms a stem / loop of human tRNA" means that the nucleotide sequence contained in the 5' / 3' ribozyme splicing element designed based on human tRNA is identical in sequence to the nucleotide sequence that is complementary to the human RNA and forms the stem / loop.
[0183] As used herein, "spacer" refers to any continuous nucleotide sequence that at least does not negatively interfere with the function of the element to which it is connected. Generally, if you want to avoid the interaction of two close or adjacent elements, you can insert a spacer between the two elements. The spacer sequences described herein can play two functions: (1) promote cyclization and (2) promote function by allowing the correct folding of human tRNA splicing elements and protein coding region nucleotide sequences. In some instances, the length of the spacer is no more than 150, no more than 100, no more than 50, no more than 30, no more than 10, no more than 5 or no more than 3 nucleotides. In some instances, the length of the spacer is 5 nucleotides. In some instances, the length of the spacer is 4 nucleotides. In some instances, the length of the spacer is 3 nucleotides. In some instances, there is only one spacer. In some instances, there are two spacers. In some instances, there may be no spacer.
[0184] The protein coding sequence of the protein coding region (CDS) can encode a protein of eukaryotic, prokaryotic or viral origin. In certain embodiments, the protein can be any protein for therapeutic or diagnostic purposes. For example, the protein coding region can encode human proteins, antigens, antibodies, gene editing enzymes such as CRISPR nucleases, etc. For example, the encoded protein can be a chimeric antigen receptor, an immunomodulatory protein and / or a transcription factor, etc. Some specific examples include, but are not limited to, EGF, FGF1, RBD, G6PC, PAH, HGF, etc. In some embodiments, the protein coding region is used to encode a protein required for treating a disease.
[0185] The IRES sequence can be selected from, but is not limited to, the following IRES sequences: Taura syndrome virus, blood-sucking worm virus, Theiler encephalomyelitis virus, simian virus 40, fire ant virus 1, grain shrinkage virus, reticulovirus, endotheliosis virus, Forman poliovirus type 1, soybean looper virus, Kashmir honey bee virus, human rhinovirus type 2, glass leafhopper virus type 1, human immunodeficiency virus type 1, glass leafhopper virus type 1, lice P virus, hepatitis C virus, hepatitis A virus, GB hepatitis virus, foot-and-mouth disease virus, human enterovirus 71, equine rhinovirus, tea looper-like virus, encephalomyocarditis virus (EMCV), fruit fly C virus, crucifer tobacco virus, cricket paralysis virus, bovine viral diarrhea virus 1, black queen cell virus, aphid lethal paralysis virus, avian encephalomyelitis virus, acute bee paralysis virus, hibiscus yellow ringspot virus, swine fever virus, human FGF2 , human SFTPA1, human AML1 / RUNX1, Drosophila antennae, human AQP4, human AT1R, human BAG-1, human BCL2, human BiP, human c-IAP1, human c-myc, human eIF4G, mouse NDST4L, human LEF1, mouse HIF1α, human Myc, mouse Gtx, human p27kipl, human PDGF2 / c-sis, human p53, human Pim-1, mouse Rbm3, Drosophila Reaper, canine Scamper, Drosophila Ubx, human UNR, mouse UtrA, human VEGF-A, human XIAP, Drosophila Hairless, Saccharomyces cerevisiae TFIID, Saccharomyces cerevisiae YAP1, human c-src, human FGF-1, simian picornavirus, turnip crinkle virus, eIF4G aptamer, coxsackievirus B3 (CVB3), or coxsackievirus A (CVA1 / 2). Wild-type IRES sequences can also be modified and used in the present invention. Preferably, the IRES is CVB3, BRAV-1_L, PV1_L, CAV2_L, BRAV-1, PV1 or CAV2.
[0186] As used herein, the term "vector" may refer to a nucleic acid construct designed for transfer between different hosts, including but not limited to plasmids, viruses, cosmids, phages, BACs, YACs, etc. In some embodiments, a "viral vector" is defined as a recombinantly produced virus or viral particle comprising a polynucleotide to be delivered to a host cell in vivo, in vitro, or in vitro. In some embodiments, a plasmid vector can be prepared by a commercially available vector. In other embodiments, according to techniques known in the art, a viral vector can be produced by a baculovirus, a retrovirus, adenovirus, AAV, etc. In one embodiment, the viral vector is a lentiviral vector. Examples of viral vectors include retroviral vectors, adenoviral vectors, adeno-associated viral vectors, alphaviral vectors, etc. In aspects where gene transfer is mediated by a retroviral vector, a vector construct may refer to a polynucleotide comprising a retroviral genome or a portion thereof and a gene of interest.
[0187] Some vectors can be autonomously replicated (for example, bacterial vectors and additional mammalian vectors with bacterial origins of replication) in the host cell they are introduced into. Other vectors (for example, non-additional mammalian vectors) are integrated into the genome of the host cell after being introduced into the host cell, thereby replicating together with the host genome. In addition, some vectors can instruct the expression of the gene operably connected thereto. Such vectors are referred to as "expression vectors" in this article. In general, the expression vectors used in recombinant DNA technology are usually in plasmid form. In this manual, "plasmid" and "vector" can be used interchangeably. However, this disclosure is intended to include expression vectors of this type of other forms that play an equivalent function, such as viral vectors (for example, replication-defective retroviruses, adenoviruses and adeno-associated viruses). Generally, vectors or plasmids contain sequences for instructing the transcription and translation of one or more related genes, selective markers and sequences that allow autonomous replication or chromosomal integration. Suitable vectors include the region with transcription initiation control of gene 5' and the region where the control transcription terminates of DNA fragment 3'. Both control regions may be derived from genes homologous to the transformed host cell, but it will be understood that such control regions may also be derived from genes non-native to the species chosen as the production host.
[0188] Single-stranded RNA has a shorter half-life in mammalian cells, which may be due to their sensitivity to exonucleases that can degrade single-stranded RNA from 5' or 3' ends. As described herein, forming circular RNA can be a type of modification that enhances RNA stability. Cyclization can prevent the exposed ends of RNA from being degraded, and can significantly increase the half-life of RNA, such as in vivo or in vitro. In some cases, circular RNA can prevent one or more exposed ends from being hydrolyzed and degraded. In some cases, compared with non-circular RNA, circular RNA can significantly increase the half-life of RNA. In some cases, compared with non-circular RNA, forming circular RNA can significantly increase the half-life of RNA when delivered in vivo (such as delivered to a subject). In some cases, compared with non-circular RNA, forming circular RNA can significantly reduce the amount (such as therapeutically effective amount) of RNA administered to a subject. In some cases, compared with non-circular RNA, forming circular RNA can significantly enhance editing efficiency, can significantly reduce off-target editing, or its combination.
[0189] Example
[0190] The present invention will be more readily understood by reference to the following examples, which are provided to illustrate the invention and are not to be construed as limiting the scope of the invention in any way.
[0191] Unless otherwise defined or the context clearly dictates otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. It should be understood that any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention.
[0192] Although the present invention has been described in detail with reference to the embodiments of the present invention, these embodiments are provided to illustrate rather than limit the present invention. Other embodiments that can be obtained according to the principles of the present invention all fall within the scope defined by the claims of the present invention.
[0193] Experimental methods not specifically described herein were performed according to the methods in J. Sambrook's Molecular Cloning: A Laboratory Manual (4th edition) or in accordance with the instructions for the relevant products. Unless otherwise specified, all terms used herein are to be understood according to their ordinary meanings in the art. Biological reagents used in this invention, unless otherwise specified, can be obtained from commercial sources.
[0194] The main materials involved in the present invention include a universal T7 in vitro transcription kit (Nanjing Novozymes Technology Co., Ltd.), 50X TAE buffer (Sangon Biotechnology Co., Ltd.), Gel Green nucleic acid dye (Sangon Biotechnology Co., Ltd.), agarose (Sangon Biotechnology Co., Ltd.), RNA ladder (NEB), 293T cells, CHO cells, HeLa cells, PEI, etc. Unless otherwise defined or the context clearly indicates otherwise, all materials and instruments used in the present invention were purchased from commercial sources.
[0195] The present invention relates to a method for preparing intracellular auto-circle RNA (acRNA) based on the human tRNA splicing mechanism, and provides an RNA molecule containing a human tRNA splicing element and a construct plasmid thereof. Specifically, the construct plasmid containing the human tRNA splicing element can self-cleave during in vitro transcription or undergo post-transcriptional enzymatic cleavage to obtain a linear RNA containing a 5'-hydroxyl group and a 2',3'-cyclic phosphate. This linear RNA is based on the ligation linker of the human tRNA and is self-circularized by the action of RNA ligase in the endogenous tRNA splicing system to form a circRNA.
[0196] Therefore, the present invention provides an RNA molecule containing a human tRNA splicing element and its construct plasmid, which can rapidly and stably self-circularize to produce circRNA in cells and express protein. Compared with previously reported circRNA synthesis methods, the described method is simpler and can significantly reduce production cycle and costs. More importantly, the humanized tRNA sequence makes it safer for disease treatment applications.
[0197] Example 1: Based on human tRNA Tyr -acRNA generation and self-circularization by the GTA splicing element
[0198] 1) Obtaining plasmid DNA template
[0199] Set up human tRNA exon full-length group a (full-length exon sequence is SEQ ID NO: 41 / 42), human tRNA exon truncated group b (truncated exon sequence is SEQ ID NO: 43 / 44), human tRNA intron group c (intron sequence is SEQ ID NO: 45 / 46) and the negative control group d which does not have the ribozyme recognition sequence and cannot form the 5'-terminal hydroxyl group and the 3'-terminal 2', 3'-cyclic phosphate compared to the full-length group a of human tRNA exons. The template plasmids of the full-length group a, truncated group b, intron group c, and negative control group d were obtained by gene synthesis and subcloning by Anhui General Biotechnology Co., Ltd. The positive group (full-length group a, truncated group b, intron group c) plasmids contain the nucleotide sequence encoding T7 promoter-5' ribozyme splicing element designed based on human tRNA-internal ribosome entry site (IRES)-protein coding region (CDS)-3' ribozyme splicing element designed based on human tRNA splicing element-linearized restriction endonuclease single enzyme cutting site from 5' to 3'. The template plasmid DNA map is shown in. Figure 2 .
[0200] The T7 promoter sequence of the full-length group a is shown in SEQ ID NO: 59; the 5' ribozyme recognition element sequence designed based on the human tRNA splicing element is shown in SEQ ID NO: 31 (the underlined italic sequence represents the human tRNA sequence portion); the internal ribosome entry site (IRES) sequence is shown in SEQ ID NO: 60; the protein coding region (CDS) nucleotide sequence is shown in SEQ ID NO: 61 (the encoded protein selected in this example is NeonGreen-teLuc); the 3' ribozyme splicing element sequence designed based on human tRNA of the full-length group a is shown in SEQ ID NO: 32 (the underlined italic sequence represents the human tRNA sequence portion).
[0201] The partial sequence of human tRNA in the 5' ribozyme splicing element designed based on human tRNA of truncation group b is shown in SEQ ID NO: 43; the partial sequence of human tRNA in the 3' ribozyme splicing element designed based on human tRNA of truncation group b is shown in SEQ ID NO: 44, and the rest is consistent with group a.
[0202] The partial sequence of human tRNA in the ribozyme splicing element designed based on human tRNA at the 5' end of intron group c is shown in SEQ ID NO: 45; the partial sequence of human tRNA in the ribozyme splicing element designed based on human tRNA at the 3' end of intron group c is shown in SEQ ID NO: 46, and the rest is consistent with group a.
[0203] The plasmid corresponding to the negative control group (d) contained, from 5' to 3', a nucleotide sequence encoding a T7 promoter, a partial sequence of a 5' human tRNA, an internal ribosome entry site (IRES), a protein coding region (CDS), a partial sequence of a 3' human tRNA, and a linearized restriction endonuclease single-strand site. The partial sequence of the 5' human tRNA is shown in SEQ ID NO: 41, and the partial sequence of the 3' human tRNA is shown in SEQ ID NO: 42. Compared to group a, the plasmid did not contain a ribozyme recognition sequence, and the rest of the sequence remained consistent with group a.
[0204] 2) In vitro transcription to obtain linear RNA containing human tRNA splicing elements
[0205] The present invention uses a restriction endonuclease to digest the vector obtained in step 1) to obtain a linearized plasmid DNA template. In this embodiment, the XbaI restriction endonuclease is preferred. A T7 high-yield RNA synthesis kit (Nanjing Novozymes Technology Co., Ltd.) is used to synthesize linear ribozyme uncut RNA (precursor RNA) by in vitro transcription from a linear plasmid DNA template. In this embodiment, since the plasmid DNA template contains a Twister ribozyme sequence, self-cleavage occurs during the in vitro transcription process. Therefore, after transcription, a linear cleaved, uncirculated RNA containing a coding gene containing 5'-hydroxyl and 2', 3'-cyclic phosphate, i.e., acRNA ( Figure 3A After in vitro transcription, the reaction product was treated with DNase I (Nanjing Novozyme Technology Co., Ltd.) for 30 minutes to remove the DNA template. After DNase I treatment, the acRNA was purified by column using a MicroElute Clean-up Kit (OMEGA). The present invention uses capillary electrophoresis to detect the product after in vitro transcription, and the results are shown in FIG. Figure 3B The results showed that two small fragments and one large fragment were obtained after in vitro transcription. The sizes of the two small fragments were consistent with the theoretical fragments after ribozyme self-cleavage, indicating that both ends of the ribozyme played a role in self-cleavage.
[0206] 3) acRNA introduction into cells and expression of encoded proteins
[0207] The purified acRNA containing human tRNA splicing elements was transfected into 293T cells, and the expression of green fluorescent protein was observed under a fluorescence microscope. After acRNA enters the cell, the open 5' end and 3' end are connected into a closed structure under the action of RNA ligase in the endogenous tRNA splicing processing system, forming a circular circRNA ( Figure 4A). acRNA that is not circularized has low stability due to the lack of a 5' cap and a 3' tail. It will be quickly degraded in the cell and cannot express green fluorescent protein. Compared with acRNA, circRNA is more stable and can encode proteins in cells and express green fluorescence. Therefore, when green fluorescence is observed, it can be considered that acRNA self-circularizes to form circRNA in the cell. The specific implementation process is as follows:
[0208] The day before transfection, 293T cells were passaged and seeded. Cell culture and passaging methods were performed according to the methods in Lan Rong's book "Cell Culture Techniques." All reagents involved were commercially available. In this example, the preferred cell culture medium was DMEM supplemented with 10% fetal bovine serum. When the cells reached 70-80% confluence, the acRNA obtained in step 2) was introduced into the cells via PEI transfection. Green fluorescent protein expression was observed 48 hours after transfection.
[0209] The fluorescence results of the full-length group a (TyrGTA-fullexon), truncated group b (TyrGTA-truncated), intron group c (TyrGTA-intron) and control group d (negative control) are shown in Figure 4B After acRNA transfection, green fluorescent protein was expressed normally, while the negative control could not express green fluorescent protein in the cells. This result indicates that the RNA molecules containing human tRNA splicing element sequences produced in the present invention can self-circularize to form circRNA and express green fluorescent protein in 293T cells.
[0210] The luminescence of luciferase in the cells was then detected. Cells were harvested 48 hours after transfection and resuspended in DPBS to obtain a cell suspension. 100 μl of the cell suspension was transferred to a flat-bottomed white-walled plate (Corning), with three replicate wells set up for each group. The prepared flat-bottomed white-walled plate containing the sample to be tested was placed in a microplate reader and the program was set to automatically add 100 μl of luciferase reagent to each well and automatically read the reading.
[0211] Luminescence detection results are shown in Figure 4C Compared with the negative control group, the fluorescence intensity of luciferase in cells transfected with acRNA containing human tRNA splicing elements was significantly increased, and the exons of human tRNA were more effective as splicing elements than the introns of human tRNA. This result indicates that the acRNA molecules containing human tRNA splicing element sequences produced in this invention can self-circularize to form circRNA and express luciferase in 293T cells.
[0212] In this example, the results of green fluorescent protein expression and luciferase luminescence detection demonstrate that the acRNA molecules containing human tRNA splicing element sequences produced in the present invention can self-circularize in cells to obtain circRNA.
[0213] 4) Identification of intracellular self-circularization
[0214] To further confirm that circRNA is produced in transfected cells, the present invention obtains total RNA from transfected cells and reverse transcribes it with specific primers to obtain cDNA containing the coding gene. Subsequently, primers are designed at the 5' end and 3' end respectively to amplify the cDNA and perform self-circularization qualitative analysis. Figure 5A As shown in the figure, if the 5' and 3' ends of linear RNA can be connected to form closed ends through covalent bonds, circRNA can be formed in the cell, and PCR can amplify specific bands. However, due to the open structure of acRNA, specific bands cannot be amplified. The specific implementation process is as follows:
[0215] 48 hours after transfection, cells were lysed with Trizol reagent, and total RNA was extracted from the cells according to the Trizol reagent manufacturer's instructions. RNA was then reverse transcribed into cDNA according to the cDNA synthesis kit instructions from Nanjing Novozymes Technology Co., Ltd., using primers specific for the target RNA molecule, the sequences of which are shown in SEQ ID NO: 62. PCR amplification was performed using the resulting cDNA as a template, using primer sequences shown in SEQ ID NOs: 63 and 64.
[0216] The amplified product was subjected to agarose gel electrophoresis, and the target band was about 1.2Kb. Figure 5B The amplified product was purified and recovered according to the DNA purification and recovery kit operating instructions of Tiangen Biochemical Technology (Beijing) Co., Ltd. The sequencing primers were designed, and the primer sequence was shown in SEQ ID NO: 65. The purified product was sequenced by General Bio (Anhui) Co., Ltd. The sequencing results are shown in Figure 5C , the sequencing was correct, indicating that the 5' and 3' ends of linear RNA can be connected into closed ends by covalent bonds, forming circRNA in cells.
[0217] 5) Formation of circRNA and expression of encoded proteins in different cells
[0218] The present invention was tested in different cells, further illustrating that the formation of circRNA by acRNA containing human tRNA splicing elements in cells is not limited by cell type. The cells selected in this example are CHO cells and Hela cells, and the specific method is consistent with the cell transfection method in step 3). The cell fluorescence image 48 hours after transfection is shown in FIG. Figure 6Figures A and B show that after transfection with acRNA containing human tRNA splicing elements, green fluorescent protein can be expressed normally. This result indicates that the acRNA molecules containing human tRNA splicing element sequences produced in the present invention can form circRNA and express green fluorescent protein in CHO cells or Hela cells, that is, acRNA can form circRNA in different cells.
[0219] 6) Immunogenicity detection test
[0220] Cell culture and treatment:
[0221] Aspirate the culture medium of 293T cells in T75 flask, add 4 ml DPBS, aspirate and discard the suspended dead cells, add 1 ml trypsin, incubate in 37 ° C incubator for 4 minutes, fully digest the cell suspension, add 4 ml culture medium, transfer all to 15 ml centrifuge tube, centrifuge at 1000 r for 3 minutes, discard the supernatant, and according to the cell amount, 5 × 10 cells per well of 12-well plate were added. 5 After the cells are fully dispersed, they are placed in an incubator for culture and wait for subsequent experiments.
[0222] The cell groups tested in this study are: untreated cells (CK), cells transfected with full-length Tyr-GTA, cells transfected with truncated Tyr-GTA, cells transfected with linear mRNA, and cells transfected with in vitro circular RNA (PIE). The mRNA is a common linear mRNA containing the target protein sequence, and the in vitro circular RNA is a circular RNA containing the target protein sequence obtained by the PIE method.
[0223] Total RNA was extracted after 24 h of culture in 12-well plates, with three replicates for each treatment.
[0224] Total RNA extraction:
[0225] Total RNA was extracted using the Novozymes RNA-easy Isolation Reagent kit from 293T cells cultured in 12-well plates, with 250,000 cells seeded per well. Cells were seeded in the morning, treated in the afternoon, and total RNA was extracted 24 hours later.
[0226] Reverse transcription:
[0227] Reverse transcription was performed using the HiScript II 1st Strand cDNA Synthesis Kit.
[0228] The RT-PCR system is shown in Table 6, and the reaction conditions are shown in Table 7.
[0229] Table 6
[0230]
[0231]
[0232] Table 7
[0233]
[0234] qPCR
[0235] The qPCR test was performed using the Novozymes AceQ qPCR SYBR Green Master Mix reagent. The amount of cDNA in the qPCR system was 100 ng and the concentration was 50 ng / μl. The specific system is shown in Table 8, and the primer sequences corresponding to each cytokine are shown in Table 9.
[0236] Table 8
[0237] Components volume 2×AceQ qPCR SYBR Green Master Mix 10 μl Upstream primer (10 μM) 0.4 μl Downstream primer (10 μM) 0.4 μl <![CDATA[H2O]]> 7.2 μl cDNA (50 ng / μl) 2 μl
[0238] Table 9
[0239]
[0240] Figure 7 The expression of some cytokines in cells after untreated (CK), transfection with full-length Tyr-GTA, transfection with truncated Tyr-GTA, transfection with linear RNA, and transfection with in vitro circular RNA (PIE) is shown. Figure 7 It can be seen that the circular RNA provided in this application has good immunogenicity and good safety performance.
[0241] Example 2: DNAzyme cleavage to generate acRNA
[0242] The present invention also provides another DNA vector plasmid, the ribozyme recognition sequence of the vector plasmid is a targeted cleavage site for the DNA ribozyme. Since the ribozyme recognition sequence is no longer a self-cleaving ribozyme, the vector plasmid needs to generate a precursor RNA first during the transcription process, and cannot directly self-cleave to generate acRNA. Therefore, the vector plasmid needs to add a step of conversion of the precursor RNA to acRNA. The sequence of the DNA ribozyme is shown in SEQ ID NO: 35 / 36. Both ends of the precursor RNA contain cleavage elements (SEQ ID NO: 33 / 34) that can be recognized and cut by the DNA ribozyme to generate human tRNA ends for self-circularization connection. The cleavage element contains IRES (SEQ ID NO: 60) and the coding sequence of the reporter gene (SEQ ID NO: 61) in sequence, with a total length of 2123nt. The reaction system is shown in Table 10 below:
[0243] Table 10
[0244] Fragment molar amount 30 pmol Clip quality 20.52 μg Fragment concentration 876.775ng / μl Fragment volume 23.40μl Ribozyme amount 75 pmol Ribozyme concentration 20 μM Ribozyme volume 3.75 × 2 μl 10× reaction buffer 4 μl <![CDATA[H2O]]> 5.1 μl
[0245] The reaction system was incubated at 85°C for 1 minute and at 37°C for 3 hours. The reaction was then continued at 70°C for 5 minutes and at 4°C for 1 minute. The remaining steps were similar to those in Example 1. The luminescence detection results of the resulting acRNA 24 and 48 hours after transfection into 293T cells are shown in Figure 8 . As shown in Figure 8 , the present invention provides a method for preparing circular RNA, wherein the ribozyme recognition sequence of the nucleic acid vector can not only produce acRNA by providing a self-cleaving ribozyme, but can also convert the initial linear precursor RNA into cleaved acRNA by providing a DNA ribozyme recognition sequence.
[0246] Example 3: Based on human tRNA Tyr -ATA splicing elements generate acRNA
[0247] Contains human tRNA Tyr The method for constructing the plasmid DNA template of the -ATA splicing element is the same as that in Example 1 (the following human tRNA sequence is used to replace the corresponding human tRNA sequence in Example 1). The tRNA used in this example is human tRNA Tyr The full-length exon of -ATA, the human tRNA sequence of the 5' end ribozyme splicing element is shown in SEQ ID NO: 47, and the human tRNA sequence of the 3' end ribozyme splicing element is shown in SEQ ID NO: 48.
[0248] Contains human tRNA Tyr The method for obtaining RNA molecules containing the -ATA splicing element is the same as in Example 1, and the restriction endonuclease used for linearization of the plasmid template is XbaI. Tyr The RNA of the -ATA splicing element is introduced into cells by transfection. The transfection method can be selected, such as lipofectamine transfection, calcium transfection, PEI transfection or electroporation. In this embodiment, PEI transfection is preferred. The transfected cells are 293T cells.
[0249] 48 hours after transfection, the fluorescence intensity in the cells was Figure 9 (Figure TyrATA) shows that it contains human tRNA Tyr After transfection of RNA containing the -ATA splicing element, the fluorescence intensity of luciferase was significantly increased, while the negative control could not express luciferase, and the negative control was a linear RNA lacking human tRNA and ribozyme sequences. This result shows that the production of human tRNA containing Tyr RNA molecules containing -ATA splicing elements can form circRNAs and express luciferase in 293T cells.
[0250] Example 4: Based on human tRNA Ile -TAT splicing element generates acRNA
[0251] Contains human tRNA Ile The method for constructing the plasmid DNA template of the -TAT splicing element is the same as that in Example 1 (the following human tRNA sequence is used to replace the corresponding human tRNA sequence in Example 1). The tRNA used in this example is human tRNA Ile -TAT full-length exon, the human tRNA sequence of the 5' end ribozyme splicing element is shown in SEQ ID NO: 49, and the human tRNA sequence of the 3' end ribozyme splicing element is shown in SEQ ID NO: 50.
[0252] Contains human tRNA Ile The method for obtaining RNA molecules containing the -TAT splicing element is the same as in Example 1, and the restriction endonuclease used for linearization of the plasmid template is XbaI. Ile -TAT splicing element RNA is introduced into cells by transfection. The transfection method can be selected, such as lipofectamine transfection, calcium transfection, PEI transfection or electroporation. In this embodiment, PEI transfection is preferred. The transfected cells are 293T cells.
[0253] 48 hours after transfection, the fluorescence intensity in the cells was Figure 9 As shown in Figure 1leTAT, it contains human tRNA Ile After transfection of RNA containing the -TAT splicing element, the fluorescence intensity of luciferase was significantly increased, while the negative control could not express luciferase, and the negative control was a linear RNA lacking human tRNA and ribozyme sequences. This result shows that the present invention can produce a luciferase containing human tRNA. Ile RNA molecules containing the -TAT splicing element can form circRNA and express luciferase in 293T cells.
[0254] Example 5: Based on human tRNA pro (AGG) splicing element generates acRNA
[0255] Contains human tRNA pro The method for constructing the plasmid DNA template of the -AGG splicing element is the same as that in Example 1 (the following human tRNA sequence is used to replace the corresponding human tRNA sequence in Example 1). The tRNA used in this example is human tRNA pro The full-length exon of -AGG, the human tRNA sequence of the 5' end ribozyme splicing element is shown in SEQ ID NO: 51, and the human tRNA sequence of the 3' end ribozyme splicing element is shown in SEQ ID NO: 52.
[0256] Contains human tRNA pro The method for obtaining RNA molecules containing the -AGG splicing element is the same as in Example 1, and the restriction endonuclease used for linearization of the plasmid template is XbaI.pro The RNA of the -AGG splicing element is introduced into cells by transfection. The transfection method can be selected, such as lipofectamine transfection, calcium transfection, PEI transfection or electroporation. In this embodiment, PEI transfection is preferred. The transfected cells are 293T cells.
[0257] 48 hours after transfection, the fluorescence intensity in the cells was Figure 9 (Figure ProAGG) shows that it contains human tRNA pro After transfection of RNA containing the -AGG splicing element, the fluorescence intensity of luciferase was significantly increased, while the negative control could not express luciferase, and the negative control was a linear RNA lacking human tRNA and ribozyme sequences. This result shows that the present invention can produce human tRNA containing pro RNA molecules with -AGG splicing elements can form circRNA and express luciferase in 293T cells.
[0258] Example 6: Based on human tRNA Phe -GAA splicing elements generate acRNA
[0259] Contains human tRNA Phe The method for constructing the plasmid DNA template of the -GAA splicing element is the same as that in Example 1 (the following human tRNA sequence is used to replace the corresponding human tRNA sequence in Example 1). The tRNA used in this example is human tRNA Phe The full-length exon of -GAA, the human tRNA sequence of the 5' end ribozyme splicing element is shown in SEQ ID NO: 53, and the human tRNA sequence of the 3' end ribozyme splicing element is shown in SEQ ID NO: 54.
[0260] Contains human tRNA Phe The method for obtaining RNA molecules containing the -GAA splicing element is the same as in Example 1, and the restriction endonuclease used for linearization of the plasmid template is XbaI. Phe The RNA of the -GAA splicing element is introduced into cells by transfection. The transfection method can be selected, such as lipofectamine transfection, calcium transfection, PEI transfection or electroporation. In this embodiment, PEI transfection is preferred. The transfected cells are 293T cells.
[0261] 48 hours after transfection, the fluorescence intensity in the cells was Figure 9 (Figure PheGAA) shows that it contains human tRNA Phe After transfection of RNA containing the -GAA splicing element, the fluorescence intensity of green luciferase was significantly increased, while the negative control could not express green fluorescent protein and luciferase. The negative control was a linear RNA lacking human tRNA and ribozyme sequences. This result shows that the production of human tRNA containing PheRNA molecules containing the -GAA splicing element can form circRNA and express luciferase in 293T cells.
[0262] Example 7: Based on human tRNA Leu -CAA splicing elements generate acRNA
[0263] Contains human tRNA Leu The method for constructing the plasmid DNA template of the CAA splicing element is the same as that in Example 1 (the following human tRNA sequence is used to replace the corresponding human tRNA sequence in Example 1). The tRNA used in this example is human tRNA Leu The full-length exon of -CAA, the human tRNA sequence of the 5' end ribozyme splicing element is shown in SEQ ID NO: 55, and the human tRNA sequence of the 3' end ribozyme splicing element is shown in SEQ ID NO: 56.
[0264] Contains human tRNA Leu The method for obtaining RNA molecules containing the -CAA splicing element is the same as in Example 1, and the restriction endonuclease used for linearization of the plasmid template is XbaI. Leu The RNA of the -CAA splicing element is introduced into cells by transfection. The transfection method can be selected, such as lipofectamine transfection, calcium transfection, PEI transfection or electroporation. In this embodiment, PEI transfection is preferred. The transfected cells are 293T cells.
[0265] 48 hours after transfection, the fluorescence intensity in the cells was Figure 9 (Figure LeuCAA) shows that it contains human tRNA Leu After transfection of RNA containing the -CAA splicing element, the fluorescence intensity of luciferase was significantly increased, while the negative control could not express luciferase. The negative control was a linear RNA lacking human tRNA and ribozyme sequences. This result shows that the present invention can produce human tRNA containing Leu RNA molecules containing the -CAA splicing element can form circRNA and express luciferase in 293T cells.
[0266] Example 8: Based on human tRNA Arg -TCT splicing elements generate acRNA
[0267] Contains human tRNA Arg The method for constructing the plasmid DNA template of the -TCT splicing element is the same as that in Example 1 (the following human tRNA sequence is used to replace the corresponding human tRNA sequence in Example 1). The human tRNA used in this example is tRNA Arg-TCT full-length exon, the human tRNA sequence of the 5' end ribozyme splicing element is shown in SEQ ID NO: 57, and the human tRNA sequence of the 3' end ribozyme splicing element is shown in SEQ ID NO: 58.
[0268] Contains human tRNA Arg The method for obtaining RNA molecules containing the -TCT splicing element is the same as in Example 1, and the restriction endonuclease used for linearization of the plasmid template is XbaI. Arg -TCT splicing element RNA is introduced into cells by transfection. The transfection method can be selected, such as lipofectamine transfection, calcium transfection, PEI transfection or electroporation. In this embodiment, PEI transfection is preferred. The transfected cells are 293T cells.
[0269] 48 hours after transfection, the fluorescence intensity in the cells was Figure 9 As shown in (Figure ArgTCT), containing human tRNA Arg After transfection of RNA containing the -TCT splicing element, the fluorescence intensity of luciferase was significantly increased, while the negative control could not express luciferase, and the negative control was a linear RNA lacking human tRNA and ribozyme sequences. This result shows that the production of human tRNA containing Arg -TCT splicing element RNA molecules can form acRNA and express luciferase in 293T cells.
[0270] The above-described embodiments merely represent several embodiments of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art may make various changes, modifications, and substitutions without departing from the spirit of the present invention, and all of these variations, modifications, and substitutions fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims.
[0271] Although the present invention has been described in detail with reference to the embodiments of the present invention, these embodiments are provided to illustrate rather than limit the present invention. Other embodiments that can be obtained according to the principles of the present invention all fall within the scope defined by the claims of the present invention.
[0272] sequence:
[0273] Homo_sapiens tRNA Tyr -GTA-1-1 genomic sequence (SEQ ID NO: 1), capital letters represent exon parts, lowercase letters represent intron parts: 5'-CCTTCGATAGCTCAGTTGGTAGAGCGGAGGACTGTAGttggctgtgtccttagacATCCTTAGGT CGCTGGTTCGAATCCGGCTCGAAGGA-3'
[0274] Homo_sapiens tRNA Tyr -GTA-2-1 genomic sequence (SEQ ID NO: 2), capital letters represent exons, lowercase letters represent introns: 5'-CCTTCGATAGCTCAGTTGGTAGAGCGGAGGACTGTAGtggatagggcgtggcaATCCTTAGGT CGCTGGTTCGATTCCGGCTCGAAGGA-3'
[0275] Homo_sapiens tRNA Tyr -GTA-3-1 genomic sequence (SEQ ID NO: 3), capital letters represent exon parts, lowercase letters represent intron parts: 5'-CCTTCGATAGCTCAGTTGGTAGAGCGGAGGACTGTAGgctcattaagcaaggtATCCTTAGGT CGCTGGTTCGAATCCGGCTCGGAGGA-3'
[0276] Homo_sapiens tRNA Tyr -GTA-4-1 genomic sequence (SEQ ID NO: 4), capital letters represent exon parts, lowercase letters represent intron parts: 5'-CCTTCGATAGCTCAGCTGGTAGAGCGGAGGACTGTAGattgtatagacatttgcggacATCCTTA GGTCGCTGGTTCGATTCCAGCTCGAAGGA-3'
[0277] Homo_sapiens tRNA Tyr -GTA-5-1 genomic sequence (SEQ ID NO: 5), capital letters represent exon parts, lowercase letters represent intron parts: 5'-CCTTCGATAGCTCAGCTGGTAGAGCGGAGGACTGTAGctacttcctcagcaggagacATCCTTAG GTCGCTGGTTCGATTCCGGCTCGAAGGA-3'
[0278] Homo_sapiens tRNA Tyr-GTA-5-2 genomic sequence (SEQ ID NO: 6), capital letters represent exon parts, lowercase letters represent intron parts: 5'-CCTTCGATAGCTCAGCTGGTAGAGCGGAGGACTGTAGgcgcgcgcccgtggccATCCTTAGG TCGCTGGTTCGATTCCGGCTCGAAGGA-3'
[0279] Homo_sapiens tRNA Tyr -GTA-5-3 genomic sequence (SEQ ID NO: 7), capital letters represent the exon part, lowercase letters represent the intron part: 5'-CCTTCGATAGCTCAGCTGGTAGAGCGGAGGACTGTAGcctgtagaaacatttgtggacATCCTTA GGTCGCTGGTTCGATTCCGGCTCGAAGGA-3'
[0280] Homo_sapiens tRNA Tyr -GTA-5-4 genomic sequence (SEQ ID NO: 8), capital letters represent exon parts, lowercase letters represent intron parts: 5'-CCTTCGATAGCTCAGCTGGTAGAGCGGAGGACTGTAGattgtacagacatttgcggacATCCTTA GGTCGCTGGTTCGATTCCGGCTCGAAGGA-3'
[0281] Homo_sapiens tRNA Tyr -GTA-5-5 genomic sequence (SEQ ID NO: 9), capital letters represent exons, lowercase letters represent introns: 5'-CCTTCGATAGCTCAGCTGGTAGAGCGGAGGACTGTAGtacttaatgtgtggtcATCCTTAGGTC GCTGGTTCGATTCCGGCTCGAAGGA-3'
[0282] Homo_sapiens tRNA Tyr -GTA-6-1 genomic sequence (SEQ ID NO: 10), capital letters represent exons, lowercase letters represent introns: 5'-CCTTCGATAGCTCAGCTGGTAGAGCGGAGGACTGTAGgggtttgaatgtggtcATCCTTAGGT CGCTGGTTCGAATCCGGCTCGGAGGA-3'
[0283] Homo_sapiens tRNA Tyr -GTA-7-1 genomic sequence (SEQ ID NO: 11), capital letters represent exon parts, lowercase letters represent intron parts: 5'-CCTTCGATAGCTCAGCTGGTAGAGCGGAGGACTGTAGactgcggaaacgtttgtggacATCCTTA GGTCGCTGGTTCAATTCCGGCTCGAAGGA-3'
[0284] Homo_sapiens tRNA Tyr -GTA-8-1 genomic sequence (SEQ ID NO: 12), capital letters represent exon parts, lowercase letters represent intron parts: 5'-CTTTCGATAGCTCAGTTGGTAGAGCGGAGGACTGTAGgttcattaaactaaggcATCCTTAGGT CGCTGGTTCGAATCCGGCTCGAAGGA-3'
[0285] Homo_sapiens tRNA Tyr -GTA-9-1 genomic sequence (SEQ ID NO: 13), capital letters represent exons, lowercase letters represent introns: 5'-TCTTCAATAGCTCAGCTGGTAGAGCGGAGGACTGTAGgtgcacgcccgtggccATTCTTAGGT GCTGGTTTGATTCCGACTTGGAGAG-3'
[0286] Homo_sapiens tRNA Tyr -ATA-1-1 genomic sequence (SEQ ID NO: 14), capital letters represent exon parts, lowercase letters represent intron parts: 5'-CCTTCAATAGTTCAGCTGGTAGAGCAGAGGACTATAGctacttcctcagtaggagacGTCCTTAG GTTGCTGGTTCGATTCCAGCTTGAAGGA-3'
[0287] Homo_sapiens tRNA Ile -TAT-1-1 genomic sequence (SEQ ID NO: 15), uppercase letters represent the exon part, lowercase letters represent the intron part: 5'-GCTCCAGTGGCGCAATCGGTTAGCGCGCGGTACTTATAtgacagtgcgagcggagcaATGCCG AGGTTGTGAGTTCGATCCTCACCTGGAGCA-3'
[0288] Homo_sapiens tRNA Ile -TAT-2-1 genomic sequence (SEQ ID NO: 16), capital letters represent exon parts, lowercase letters represent intron parts: 5'-GCTCCAGTGGCGCAATCGGTTAGCGCGCGGTACTTATAcagcagtacatgcagagcaATGCCGA GGTTGTGAGTTCGAGCCTCACCTGGAGCA-3'
[0289] Homo_sapiens tRNA Ile -TAT-2-2 genomic sequence (SEQ ID NO: 17), capital letters represent the exon part, lowercase letters represent the intron part: 5'-GCTCCAGTGGCGCAATCGGTTAGCGCGCGGTACTTATAtggcagtatgtgtgcgagtgATGCCGA GGTTGTGAGTTCGAGCCTCACCTGGAGCA-3'
[0290] Homo_sapiens tRNA Ile -TAT-2-3 genomic sequence (SEQ ID NO: 18), capital letters represent the exon part, lowercase letters represent the intron part: 5'-GCTCCAGTGGCGCAATCGGTTAGCGCGCGGTACTTATAcaacagtatatgtgcgggtgATGCCGA GGTTGTGAGTTCGAGCCTCACCTGGAGCA-3'
[0291] Homo_sapiens tRNA Ile -TAT-3-1 genomic sequence (SEQ ID NO: 19), capital letters represent exons, lowercase letters represent introns: 5'-GCTCCAGTGGCGCAATCGGTTAGCGCGCGGTACTTATAagacagtgcacctgtgagcaATGCCG AGGTTGTGAGTTCAAGCCTCACCTGGAGCA-3'
[0292] Homo_sapiens tRNA Arg-TCT-1-1 genomic sequence (SEQ ID NO: 20), capital letters represent exons, lowercase letters represent introns: 5'-GGCTCCGTGGCGCAATGGATAGCGCATTGGACTTCTAgaggctgaaggcATTCAAAGGTTC CGGGTTCGAGTCCCGGCGGAGTCG-3'
[0293] Homo_sapiens tRNA Arg -TCT-2-1 genomic sequence (SEQ ID NO: 21), capital letters represent exon parts, lowercase letters represent intron parts: 5'-GGCTCTGTGGCGCAATGGATAGCGCATTGGACTTCTAgtgacgaatagagcaATTCAAAGGTT GTGGGTTCGAATCCCACCAGAGTCG-3'
[0294] Homo_sapiens tRNA Arg -TCT-3-1 genomic sequence (SEQ ID NO: 22), capital letters represent exon parts, lowercase letters represent intron parts: 5'-GGCTCTGTGGCGCAATGGATAGCGCATTGGACTTCTAgctgagcctagtgtggtcATTCAAAGG TTGTGGGTTCGAGTCCCACCAGAGTCG-3'
[0295] Homo_sapiens tRNA Arg -TCT-3-2 genomic sequence (SEQ ID NO: 23), capital letters represent exons, lowercase letters represent introns: 5'-GGCTCTGTGGCGCAATGGATAGCGCATTGGACTTCTAgatagttagagaaATTCAAAGGTTG TGGGTTCGAGTCCCACCAGAGTCG-3'
[0296] Homo_sapiens tRNA Leu -CAA-1-1 genomic sequence (SEQ ID NO: 24), capital letters represent exon parts, lowercase letters represent intron parts: 5'-GTCAGGATGGCCGAGTGGTCTAAGGCGCCAGACTCAAGctaagcttcctccgcggtggggaTTCT GGTCTCCAATGGAGGCGTGGGTTCGAATCCCACTTCTGACA-3'
[0297] Homo_sapiens tRNA Leu -CAA-1-2 genomic sequence (SEQ ID NO: 25), capital letters represent the exon part, lowercase letters represent the intron part: 5'-GTCAGGATGGCCGAGTGGTCTAAGGCGCCAGACTCAAGcttggcttcctcgtgttgaggaTTCTG GTCTCCAATGGAGGCGTGGGTTCGAATCCCACTTCTGACA-3'
[0298] Homo_sapiens tRNA Leu -CAA-2-1 genomic sequence (SEQ ID NO: 26), capital letters represent exon parts, lowercase letters represent intron parts: 5'-GTCAGGATGGCCGAGTGGTCTAAGGCGCCAGACTCAAGcttactgcttcctgtgttcgggtcTTCT GGTCTCCGTATGGAGGCGTGGGTTCGAATCCCACTTCTGACA-3'
[0299] Homo_sapiens tRNA Leu -CAA-3-1 genomic sequence (SEQ ID NO: 27), capital letters represent exon parts, lowercase letters represent intron parts: 5'-GTCAGGATGGCCGAGTGGTCTAAGGCGCCAGACTCAAGttgctacttcccaggtttggggcTTCTG GTCTCCGCATGGAGGCGTGGGTTCGAATCCCACTTCTGACA-3'
[0300] Homo_sapiens tRNA Leu -CAA-4-1 genomic sequence (SEQ ID NO: 28), capital letters represent exon parts, lowercase letters represent intron parts: 5'-GTCAGGATGGCCGAGTGGTCTAAGGCGCCAGACTCAAGgtaagcaccttgcctgcgggctTTCT GGTCTCCGGATGGAGGCGTGGGTTCGAATCCCACTTCTGACA-3'
[0301] Homo_sapiens tRNA Pro-AGG-3-1 genomic sequence (SEQ ID NO: 29), capital letters represent the exon part, lowercase letters represent the intron part: 5'-GGCTCGTTGGTCTAGGGGTGTGGTTCTCGCTTAGGGaccacagggacaagccCGGGAGACCC AAGAGGTCCCGGGTTCAAATCCCGGACGAGCCC-3'
[0302] Homo_sapiens tRNA Phe -GAA-7-1 genomic sequence (SEQ ID NO: 30), capital letters represent exon parts, lowercase letters represent intron parts: 5'-GCCGAAATAGCTCAATTGGGAGAGTGTTAGACTGAAGatcTTCTGCAGGTCTCTGGTT CAATTCCGGGTTTCGACA-3'
[0303] The 5' end is based on human tRNA Tyr - Sequence of RNA ribozyme splicing element designed from the 3' end sequence of GTA exon (underlined italics) (SEQ ID NO: 31)
[0304]
[0305] The 3' end is based on human tRNA Tyr - Sequence of RNA ribozyme splicing element designed from the 5' end sequence of GTA exon (underlined italics) (SEQ ID NO: 32)
[0306]
[0307] The 5' end is based on human tRNA Tyr - Sequence of the DNAzyme splicing element designed from the 3' end sequence of the GTA exon (in italics, the underlined portion is the sequence complementary to the DNAzyme) (SEQ ID NO: 33)
[0308]
[0309] The 3' end is based on human tRNA Tyr - Sequence of the DNAzyme splicing element designed from the 5' end sequence of the GTA exon (in italics, the underlined portion is the sequence complementary to the DNAzyme) (SEQ ID NO: 34)
[0310]
[0311] The 5' end is based on human tRNA Tyr-GTA exon 3' end sequence (the italic underlined sequence is complementary to the human tRNA exon 3' end sequence) designed 5' end DNA ribozyme sequence (SEQ ID NO: 35)
[0312] 5'- ACCAGCGACCTAAGGAA GGCTAGCTACAACGACAGAAGAATACTAG-3'
[0313] The 3' end is based on human tRNA Tyr -DNA ribozyme sequence at the 3' end designed based on the 5' end sequence of the GTA exon (the sequence in italics is complementary to the 5' end sequence of the human tRNA exon) (SEQ ID NO: 36)
[0314]
[0315] The 5' end is based on human tRNA Tyr - The RNA ribozyme splicing element designed at the 3' end of the GTA exon is cleaved to form a human tRNA sequence (SEQ ID NO: 37) with a 5' end hydroxyl group
[0316] 5'-OH-AACCTTAGGTCGCTGGTTCAATTCCGGCTCGAAGG……-3'
[0317] The 3' end is based on human tRNA Tyr - The RNA ribozyme splicing element designed at the 5' end of the GTA exon is cleaved to form a 2',3'-cyclic phosphate human tRNA sequence (SEQ ID NO: 38)
[0318] 5'-CCTTCGATAGCTCAGCTGGTAGAGCGGAGGTCTGTAG-2',3'-cyclic phosphate 5' end based on human tRNA Tyr -GTA truncated exon 3' end sequence designed RNA ribozyme splicing element is cleaved to form a human tRNA sequence (SEQ ID NO: 39) with 5' end hydroxyl group
[0319] 5'-OH-AACCTT……-3'
[0320] The 3' end is based on human tRNA Tyr -GTA truncated exon 5' end sequence designed RNA ribozyme splicing element is cut after
[0321] Human tRNA sequence for 2',3'-cyclic phosphate (SEQ ID NO: 40)
[0322] 5'-TAGCTCAGCTGGTAGAGCGGAGGTCTGTAG-2',3'-cyclic phosphate
[0323] Human tRNA with 5' end ribozyme splicing element Tyr -GTA full-length exon nucleotide sequence (SEQ ID NO: 41)
[0324] 5'-AACCTTAGGTCGCTGGTTCAATTCCGGCTCGAAGG-3'
[0325] Human tRNA with 3' end ribozyme splicing element Tyr -GTA full-length exon nucleotide sequence (SEQ ID NO: 42)
[0326] 5'-CCTTCGATAGCTCAGCTGGTAGAGCGGAGGTCTGTAG-3'
[0327] Human tRNA with 5' end ribozyme splicing element Tyr -GTA truncated exon nucleotide sequence (SEQ ID NO: 43)
[0328] 5'-AACCTT-3'
[0329] Human tRNA with 3' end ribozyme splicing element Tyr -GTA truncated exon nucleotide sequence (SEQ ID NO: 44)
[0330] 5'-TAGCTCAGCTGGTAGAGCGGAGGTCTGTAG-3'
[0331] Human tRNA with 5' end ribozyme splicing element Tyr -GTA intron nucleotide sequence (SEQ ID NO: 45)
[0332] 5'-AATGCGGA-3'
[0333] Human tRNA with 3' end ribozyme splicing element Tyr -GTA intron nucleotide sequence (SEQ ID NO: 46)
[0334] 5'-AACGTTTTTGGAC-3'
[0335] Human tRNA with 5' end ribozyme splicing element Tyr - ATA full-length exon nucleotide sequence (SEQ ID NO: 47)
[0336] 5'-GTCCTTAGGTTGCTGGTTCGATTCCAGCTTGAAGG-3'
[0337] Human tRNA with 3' end ribozyme splicing element Tyr - ATA full-length exon nucleotide sequence (SEQ ID NO: 48)
[0338] 5'-CCTTCAATAGTTCAGCTGGTAGAGCAGAGGACTATAG-3'
[0339] Nucleotide sequence of the full-length exon of human tRNAIle-TAT containing the 5'-terminal ribozyme splicing element (SEQ ID NO: 49)
[0340] 5'-AAGCCGAGGTTGTGAGTTCAAGCCTCACCTGGAGCA-3'
[0341] Nucleotide sequence of the full-length exon of human tRNAIle-TAT containing the 3'-terminal ribozyme splicing element (SEQ ID NO: 50)
[0342] 5'-GCTCCAGTGGCGCAATCGGTTAGCGCGGTTCTTATA-3'
[0343] Human tRNA with 5' end ribozyme splicing element pro -AGG full-length exon nucleotide sequence (SEQ ID NO: 51)
[0344] 5'-AAGGAGACCCAAGAGGTCCCGGGTTCAAATCCCGGACGAGCC-3'
[0345] Human tRNA with 3' end ribozyme splicing element pro -AGG full-length exon nucleotide sequence (SEQ ID NO: 52)
[0346] 5'-GGCTCGTTGGTCTAGGGGTGTGGTTCTCGTTTAGGG-3'
[0347] Human tRNA with 5' end ribozyme splicing element Phe - GAA full-length exon nucleotide sequence (SEQ ID NO: 53)
[0348] 5'-AACTGCAGGTCTCTGGTTCAATTCCGGGTTTCGAC-3'
[0349] Human tRNA with 3' end ribozyme splicing element Phe- GAA full-length exon nucleotide sequence (SEQ ID NO: 54)
[0350] 5'-GCCGAAATAGCTCAATTGGGAGAGTGTTAGTCTGAAG-3'
[0351] Human tRNA with 5' end ribozyme splicing element Leu - CAA full-length exon nucleotide sequence (SEQ ID NO: 55)
[0352] 5'-AACTGGTCTCCGTATGGAGGGCGTGGGTTCGAATCCCACTTCTGACA-3'
[0353] Human tRNA with 3' end ribozyme splicing element Leu - CAA full-length exon nucleotide sequence (SEQ ID NO: 56)
[0354] 5'-GTCAGGATGGCCGAGTGGTCTAAGGCGCCAGTCTCAAG-3'
[0355] Human tRNA with 5' end ribozyme splicing element Arg -TCT full-length exon nucleotide sequence (SEQ ID NO: 57)
[0356] 5'-AATCAAAGGTTGTGGGTTCGAGTCCCACCAGAGTCG-3'
[0357] Human tRNA with 3' end ribozyme splicing element Arg -TCT full-length exon nucleotide sequence (SEQ ID NO: 58)
[0358] 5'-GGCTCTGTGGCGCAATGGATAGCGCATTGGTCTTCTA-3'
[0359] T7 promoter sequence (SEQ ID NO: 59)
[0360] 5'-TTAATACGACTCACTATAGGGATAAT-3'
[0361] IRES sequence (SEQ ID NO: 60)
[0362] 5'-TTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGCGCTAGCACTCTGG TATCACGGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAACAGTCAGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCCAGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTATTCCTATACTGGCTGCTTATGGTGACAATTGAGAGATCGTTACCATATAGCTATTGGATTGGCCATCCGGTGACTAATAGAGCTATTATATATCCCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTGTTAAGTTGAATACAGCAAA-3'
[0363] Nucleotide sequence (SEQ ID NO: 61) of the coding region (CDS) of the reporter gene
[0364]
[0365] Reverse transcription primer sequence (SEQ ID NO: 62)
[0366] 5'-CGGACACCCAAAGTAGTCGG-3'
[0367] cDNA amplification upstream primer sequence (SEQ ID NO: 63)
[0368] 5'-TGGAGGCAGACCGCCGGCTAC-3'
[0369] cDNA amplification downstream primer sequence (SEQ ID NO: 64)
[0370] 5'-AGGATTAGCCGCATTCAGGG-3'
[0371] Sequencing primer sequence (SEQ ID NO: 65)
[0372] 5'-TTCAGGGTGACCATCAACGG-3'
[0373] GAPDH upstream primer sequence (SEQ ID NO: 66)
[0374] 5'-TGGCACCGTCAAGGCTGAGAA-3'
[0375] GAPDH downstream primer sequence (SEQ ID NO: 67)
[0376] 5'-TGGTGAAGACGCCAGTGGACTC-3'
[0377] RIGI upstream primer sequence (SEQ ID NO: 68)
[0378] 5'-GCATGGTGTTCCAGATGCCAGA-3'
[0379] RIGI downstream primer sequence (SEQ ID NO: 69)
[0380] 5'-TGCTGCTCGGACATTGCTGAAG-3'
[0381] EIF2AK2 upstream primer sequence (SEQ ID NO: 70)
[0382] 5'-GGCACCCAGATTTGACCTTCCT-3'
[0383] EIF2AK2 downstream primer sequence (SEQ ID NO: 71)
[0384] 5'-TTACTTCACGCTCCGCCTTCTC-3'
[0385] CCL2 upstream primer sequence (SEQ ID NO: 72)
[0386] 5'-CCTTCTGTGCCTGCTGCTCAT-3'
[0387] CCL2 downstream primer sequence (SEQ ID NO: 73) 5'-CTTTGGGACACTTGCTGCTGGT-3' TNF upstream primer sequence (SEQ ID NO: 74) 5'-TCCAGGCGGTGCTTGTTCCT-3'
[0388] TNF downstream primer sequence (SEQ ID NO: 75) 5'-TGGGCTACAGGCTTGTCACTCG-3'.
Claims
1. A self-circularizing RNA precursor RNA, wherein The precursor RNA comprises the following domains in order from 5' to 3': a: The 5' end of the ribozyme splicing element is designed based on human tRNA; x: RNA sequence with biological activity; d: 3' end ribozyme splicing element designed based on human tRNA, Among them, the ribozyme splicing element designed based on human tRNA at the 5' end and / or the ribozyme splicing element designed based on human tRNA at the 3' end both contain a ribozyme recognition sequence and a human tRNA sequence, and the ribozyme splicing element designed based on human tRNA at the 5' end can be cleaved under the action of a self-cleaving ribozyme or a DNA ribozyme to generate a 5'-hydroxyl group, and the ribozyme splicing element designed based on human tRNA at the 3' end can be cleaved under the action of a self-cleaving ribozyme or a DNA ribozyme to generate a 2',3'-cyclic phosphate, and the sequences of the human tRNA of the ribozyme splicing element designed based on human tRNA at the 5' end and the ribozyme splicing element designed based on human tRNA at the 3' end are at least partially complementary and can at least form the anticodon stem of the human tRNA.
2. The precursor RNA according to claim 1, wherein The human tRNA is human tRNA Phe -GAA.
3. The precursor RNA according to claim 2, wherein The sequence of the human tRNA with the ribozyme splicing element designed based on human tRNA at the 5' end is shown in SEQ ID NO: 53, and the sequence of the human tRNA with the ribozyme splicing element designed based on human tRNA at the 3' end is shown in SEQ ID NO:
54.
4. The precursor RNA according to claim 1, wherein The human tRNA is human tRNA Tyr -GTA, tRNA Tyr -ATA, human tRNA Ile -TAT, tRNA Phe -GAA, human tRNA pro -AGG, human tRNA Leu -CAA or human tRNA Arg -One of the TCTs.
5. A self-circularizing RNA, wherein The self-circularizing RNA is a self-circularizing RNA formed by cleaving the precursor RNA according to any one of claims 1 to 4 by a self-cleaving RNA ribozyme or a DNA ribozyme, wherein the 5' end of the self-circularizing RNA forms a hydroxyl group after cleavage, and the 3' end forms a 2',3'-cyclic phosphate after cleavage.
6. The self-circularizing RNA according to claim 5, wherein The self-circularizing RNA comprises the following domains in order from 5' to 3' direction: a': the sequence of human tRNA with a hydroxyl group at the 5' end; x: RNA sequence with biological activity; d': Sequence of human tRNA that forms a 2',3'-cyclic phosphate at the 3' end.
7. A circular RNA, wherein The circular RNA is a circular RNA formed by self-circularization of the self-circularizing RNA according to any one of claims 4 to 6 in the presence of RNA ligase.
8. A circular RNA, wherein The circular RNA sequence comprises the following domains: a”: 5’ end human tRNA sequence; x: biologically active RNA sequences, such as b: internal ribosome entry site and c: protein coding region; and d”: 3’ end human tRNA sequence; The 5' end human tRNA sequence is covalently linked to the 3' end human tRNA sequence; and the 5' end human tRNA sequence and the 3' end human tRNA sequence contain partial complementarity and can form at least one human tRNA Phe -Anticodon stem of GAA.
9. A nucleic acid vector for producing a precursor RNA, wherein The nucleic acid vector comprises a sequence encoding the precursor RNA according to any one of claims 1 to 3.
10. A method for preparing circular RNA, the method comprising: (1) Providing the nucleic acid vector according to claim 9, which is linearized and then transcribed in vitro to obtain a linear precursor RNA; (2) Self-cyclized RNA containing 5'-hydroxyl group and 2',3'-cyclic phosphate is obtained by RNA ribozyme self-cleavage during in vitro transcription or by DNA ribozyme cleavage after in vitro transcription; (3) Under the action of RNA ligase, the two ends of the self-circularized RNA are covalently bound to form the circular RNA.