Application of DGAT1 gene and its dsRNA in the preparation of related drugs for controlling brown planthopper

By using the brown planthopper DGAT1 gene as a target, preparing dsRNA drugs, and using RNA interference technology to inhibit DGAT1 gene expression, the problem of lack of effective target genes and control measures in the existing technology was solved, and significant control effects on brown planthoppers were achieved.

CN120464650BActive Publication Date: 2025-10-03CHINA JILIANG UNIV

Patent Information

Application Number
CN202510948972.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-10
Publication Date
2025-10-03
Estimated Expiration
2045-07-10

AI Technical Summary

Technical Problem

The existing technology lacks effective target genes and biological control methods to control the population of brown planthoppers. The application of RNAi technology in the control of brown planthoppers is limited, and new target genes are urgently needed to reduce its harm.

Method used

Using the brown planthopper's DGAT1 gene as a target, dsRNA drugs were prepared through RNA interference technology to inhibit the expression of the DGAT1 gene to reduce the survival rate of brown planthoppers. The specific steps include PCR amplification, vector ligation, plasmid extraction, dsRNA synthesis and injection into nymphs.

Benefits of technology

It significantly reduced the survival rate of brown planthoppers and caused molting and death by inhibiting DGAT1 gene expression, providing an effective biological control strategy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120464650B_ABST
    Figure CN120464650B_ABST
Patent Text Reader

Abstract

This invention discloses the use of a DGAT1 gene and its dsRNA in the preparation of drugs for controlling brown planthoppers. This invention demonstrates that inhibiting the expression of the DGAT1 gene in brown planthoppers can significantly reduce the survival rate of brown planthoppers, thereby effectively controlling the brown planthopper population. This invention utilizes RNA interference (RNAi) technology to inhibit the expression of the DGAT1 gene in brown planthoppers. This invention provides a new strategy and target site for controlling brown planthoppers, making RNAi technology for inhibiting the expression of the DGAT1 gene in brown planthoppers broadly applicable in this field.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biological control, and specifically relates to an application of DGAT1 in controlling brown planthoppers, in particular an application of a brown planthopper DGAT1 gene and its dsRNA in preparing relevant drugs for controlling brown planthoppers. Background Art

[0002] The brown planthopper, Nilaparvata lugens (Stal), is a typical monophagous piercing-sucking insect that feeds on rice. It is characterized by its explosiveness, destructiveness, and long-distance migratory nature. It is prone to outbreaks and disasters, and is one of the most serious insect damage to rice.

[0003] RNA interference (RNAi) primarily refers to the highly evolutionarily conserved phenomenon of efficient and specific degradation of homologous mRNAs induced by double-stranded RNA (dsRNA). RNAi technology plays a crucial role in studying insect growth and development and related gene functions. By introducing exogenous double-stranded RNA targeting a specific gene into insects, it can cause degradation of endogenous target mRNAs, leading to silencing or downregulation of target gene expression.

[0004] At present, RNAi technology has been widely used in the field of agricultural science and technology, including but not limited to crop improvement, biological control, and insect resistance functional gene research.

[0005] In the prior art, RNAi has been used to interfere with insects in Hemiptera, Hymenoptera, Lepidoptera, Orthoptera, and Coleoptera. RNAi technology has also been used to control brown planthoppers. For example, Chinese patent application number CN116947998A discloses the use of the brown planthopper PEX16 gene as a target for controlling brown planthoppers. By inhibiting the PEX16 gene, the survival time of female brown planthoppers and the number of eggs laid can be reduced, thereby achieving the purpose of controlling brown planthoppers.

[0006] In order to reduce the harm caused by brown planthoppers, it is urgent to find a target gene that can effectively prevent and control brown planthoppers, and to further develop biological control methods that can effectively control brown planthopper populations based on the target gene. Summary of the Invention

[0007] To develop a biological control method that effectively reduces the damage caused by brown planthoppers (NLP), this study investigated the effect of the NLP gene DGAT1 on survival and molting. The results indicate that DGAT1 has potential for controlling NLP. Using the NLP gene DGAT1 as a target and RNAi technology, this study provides a dsRNA-based biocontrol application targeting NLP.

[0008] In one aspect, the present invention provides an application of the DGAT1 gene in controlling brown planthoppers. The nucleotide sequence of the DGAT1 gene is shown in SEQ ID NO. 1. The method for controlling brown planthoppers is RNA interference technology.

[0009] Preferably, the DGAT1 gene may be a partial fragment selected from the DGAT1 gene, and the nucleotide sequence is shown in SEQ ID NO.2.

[0010] RNA interference technology (RNAi) specifically includes the following steps:

[0011] 1) Using the DGAT1 gene as a template, a fragment with the nucleotide sequence shown in SEQ ID NO. 2 was selected for PCR amplification;

[0012] 2) The DGAT1 gene amplified in step 1) was ligated into the pMD19-T vector and transformed into DH5α competent cells; the transformed DH5α Escherichia coli was cultured;

[0013] 3) extracting the plasmid from the DH5α E. coli culture obtained in step 2), and amplifying it with amplification primers containing a T7 promoter sequence to obtain T7-DGAT1; then synthesizing dsDGAT1 using T7-DGAT1 as a template;

[0014] 4) Injecting dsRNA into brown planthopper nymphs.

[0015] Preferably, the primers used for PCR amplification in step 1) are the front primer DGAT1-1-F and the rear primer DGAT1-1-R;

[0016] The sequence of DGAT1-1-F is shown in SEQ ID NO. 3;

[0017] The sequence of DGAT1-1-R is shown in SEQ ID NO.4.

[0018] Preferably, the amplification primers containing the T7 promoter sequence in step 3) are T7-DGAT1-1-F and T7-DGAT1-1-R;

[0019] The sequence of T7-DGAT1-1-F is shown in SEQ ID NO. 5;

[0020] The sequence of T7-DGAT1-1-R is shown in SEQ ID NO. 6;

[0021] The sequence of the T7-DGAT1 is shown in SEQ ID NO.7.

[0022] Preferably, the dsDGAT1 sequence synthesized in step 3) is shown as SEQ ID NO.8.

[0023] Another aspect of the present invention provides a use of a brown planthopper gene DGAT1 as a target in the preparation of a brown planthopper control drug. The nucleotide sequence of the DGAT1 is shown in SEQ ID NO.1.

[0024] Preferably, the drug is a drug prepared using the dsRNA positive strand of the brown planthopper DGAT1 gene.

[0025] Preferably, the nucleotide sequence of the positive strand of the dsRNA of the DGAT1 gene is shown as SEQ ID NO.8.

[0026] Another aspect of the present invention provides a dsRNA for controlling brown planthopper, the nucleotide sequence of which is shown in SEQ ID NO.8.

[0027] Compared with the prior art, the present invention has the following technical effects:

[0028] The present invention extracts the DGAT1 gene from the genome of the brown planthopper (Nilaparvata lugens). The nucleotide sequence of the DGAT1 gene is shown in SEQ ID NO. 1. Prior research targeting the DGAT1 gene for pest control is lacking, and the biological phenotypes caused by defects in this gene are unclear. The present invention designed multiple sets of primers corresponding to different DGAT1 gene fragments. Results showed that only SEQ ID NO. 2 showed good amplification performance, meeting the requirements.

[0029] The present invention utilizes RNAi technology to significantly reduce the survival rate of brown planthoppers by inhibiting the expression level of the DGAT1 gene, thereby achieving control of brown planthoppers. Studies have found that the brown planthopper DGAT1 gene can be used as a target to prepare drugs that inhibit the survival of brown planthoppers.

[0030] The present invention provides an effective target site and control strategy for the control of brown planthoppers and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The figure shows the screening of primers for DGAT1 gene fragment, where 1 represents primer group DGAT1-1, 2 represents primer group DGAT1-2, and 3 represents primer group DGAT1-3;

[0032] Figure 2 This is a graph showing the interference efficiency of DGAT1 in Example 4;

[0033] Figure 3 The survival rate statistics of brown planthopper after RNAi in Example 3 of the present invention are as follows;

[0034] Figure 4 、 Figure 5 The phenomenon of death during molting occurs after the DGAT1 gene of the brown planthopper is interfered with in Example 4 of the present invention; wherein Figure 4 This is a side view of a brown planthopper that died without molting successfully. Figure 5 This is a front view of a brown planthopper that died successfully without molting. DETAILED DESCRIPTION

[0035] In order to further understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments.

[0036] In the examples of the present invention, the nucleotide sequence of the DGAT1 gene of brown planthopper is shown in SEQ ID NO.1; the nucleotide sequence of the dsRNA targeting the DGAT1 gene of brown planthopper, i.e., the positive strand of the dsDGAT1 gene, is shown in SEQ ID NO.8.

[0037] Example 1. Screening of DGAT1 gene fragments from brown planthopper

[0038] The nucleotide sequence of the DGAT1 gene of the brown planthopper is shown in SEQ ID NO. 1. Primers were designed using Primer Premier 6.0. The designed primers and their corresponding DGAT1 gene fragments are shown in Table 1.

[0039] Table 1

[0040]

[0041] PCR amplification was performed using the above primers and brown planthopper cDNA as a template: the PCR amplification system (50 μL) was: EX taq 25 μL, ddH2O 19 μL, DGAT1-1-F (10 μM) 2 μL, DGAT1-1-R (10 μM) 2 μL, and brown planthopper cDNA (200 ng / μL) 2 μL.

[0042] Add all PCR reaction reagents to a 1.5 ml centrifuge tube, place it in a PCR instrument, and set the conditions as follows: pre-denaturation: 95°C, 3 min, one cycle; denaturation: 95°C, 30 s; annealing: temperature is the TM value of the primer -5°C, 30 s, number of cycles is 30-35 times; extension: 72°C, 30 s, one cycle.

[0043] After amplification, electrophoresis verification was performed, and the electrophoresis results were as follows: Figure 1As shown, only the DGAT1 gene fragment shown in SEQ ID NO. 2 was successfully amplified using primers DGAT1-1-F and DGAT1-1-R. Therefore, the fragment with the nucleotide sequence shown in SEQ ID NO. 2 was selected for cloning using primers DGAT1-1-F and DGAT1-1-R.

[0044] The amplified product of the fragment shown in SEQ ID NO. 2 was recovered by gel extraction using a SanPrep column-based DNA gel extraction kit (Sangon Biotech) to obtain 25 μL of the amplified product with a concentration of 194.6 ng / μL.

[0045] Example 2. Cloning of the DGAT1 gene fragment of the brown planthopper

[0046] (1) Connect the amplified product to the vector

[0047] The amplified product obtained in Example 1 was ligated with pMD-19T (vector) to obtain a ligation product.

[0048] The reaction system (pMD19-T Vector Cloning Kit (TaKaRa), 10 μL) included 1 μL of pMDTM19-T, 3 μL of amplified product (concentration 194.6 ng / μL), 1 μL of ddH2O, and 5 μL of Solution I. The reaction was incubated at 16°C overnight. The final yield was 10 μL of ligation product with a concentration of 46.27 ng / μL.

[0049] (2) Conversion

[0050] Remove DH5α cells (E. coli DH5α Competent Cells, Solarbio) from a -80°C freezer and freeze-thaw on ice. Add 10 μL of the ligation product to 50 μL of competent cells (Solarbio, C1100). Flick gently 10 times. After incubating on ice for 30 minutes, heat shock at 42°C for 2 minutes, then incubate on ice for another 3 minutes. Transfer the cells to a clean bench. Add 800 μL of LB medium without ampicillin and shake at 37°C for 45 minutes to 1 hour. Aspirate the supernatant, leaving about 200 μL, pipette to mix thoroughly, and add it to a plate containing ampicillin. Use a triangular glass rod to spread evenly until dry. Incubate upright for 30 minutes. Place the plate upside down in a 37°C incubator and incubate overnight for 12-14 hours before checking. If plaques develop, single colonies are picked with a pipette under a clean bench and transferred to a 1.5 ml centrifuge tube containing 1 ml of LB liquid medium (containing 1 μL of ampicillin) for propagation overnight. A 100 μL aliquot of the propagated culture is removed from the clean bench for PCR verification. If the PCR results are correct, a 500 μL aliquot is prepared in the clean bench for sequencing. Sequencing results indicate that the ligation product contains the DGAT1 gene fragment, indicating successful preparation of the ligation product, which is named pMD19T-DGAT1.

[0051] Example 3. Synthesis of dsRNA

[0052] The T7 promoter sequence TAATACGACTCACTATAGGGAGA was added to the front end of the 5' end of the sequences of the forward primer DGAT1-1-F and the rear primer DGAT1-1-R designed in Example 1 to obtain two pairs of primers T7-DGAT1-1-F and T7-DGAT1-1-R, respectively.

[0053] The sequence of T7-DGAT1-1-F is shown in SEQ ID NO. 5;

[0054] The sequence of T7-DGAT1-1-R is shown in SEQ ID NO.6.

[0055] (1) Extraction and concentration determination of bacterial plasmids

[0056] (a) Place the required materials (1000 μL pipette and pipette tip, sterilized 1.5 mL centrifuge tube) in a clean bench and irradiate with UV light for 30-45 minutes. Place the expanded bacterial solution prepared in step (2) of Example 2 in a shaker at 37°C for approximately 1 hour. Aliquot the bacterial solution in the clean bench, dispensing 1 mL of the solution into three 1.5 mL centrifuge tubes. Remove the aliquoted bacterial solution and place on ice.

[0057] (b) Plasmid extraction was performed using the SanPrep Column-Based Plasmid DNA Miniprep Kit (Sangon Biotech). The bacterial suspension was centrifuged at 8000 rpm for 2 min. The supernatant was discarded, leaving only the pellet. 250 μL of Buffer P1 was added to the pellet, dissolving all three tubes of pellet in 250 μL of Buffer P1. Then, 250 μL of Buffer P2 was added and the tubes were gently inverted 10 times to mix. The tubes were allowed to stand at room temperature for 4 min. Then, 350 μL of Buffer P3 was added and the tubes were gently inverted 10 times to mix. The tubes were centrifuged at 11000 rpm for 10 min to transfer the supernatant to the adsorption column. The supernatant was then centrifuged at 9000 rpm for 30 s and the filtrate was discarded. Next, add 500 μL of Buffer DW1 to the column, centrifuge at 9000 rpm for 30 seconds, and discard the filtrate. Then add 500 μL of Wash Solution and centrifuge at 9000 rpm for 30 seconds, discarding the filtrate. Repeat the Wash Solution process, centrifuge the empty column at 9000 rpm for 1 minute, add 75 μL of 60°C RNA-free water to the center of the adsorption membrane, and centrifuge at 9000 rpm for 1 minute to obtain 75 μL of a solution containing the plasmid. The plasmid concentration was measured and found to be 197.6 ng / μL.

[0058] (2) Gene cloning containing T7 promoter sequence

[0059] PCR reaction system: 25.0 μL LA taq, 19.0 μL ddH₂O, 2.0 μL T7-DGAT1-1-F (10 μM), 2.0 μL T7-DGAT1-1-R (10 μM), 2.0 μL plasmid extracted in Example 2 (b) (197.6 ng / μL). Prepare the premix and aliquot the mixture. Place the mixture in a PCR instrument and perform a pre-annealing cycle at 95°C for 3 minutes. Anneal at the same temperature for 30 seconds, followed by 34 cycles of annealing at TM-5°C for 30 seconds. Extensions are performed at 72°C for 1 minute and 5 minutes. After PCR, perform electrophoresis verification on a 1% agarose gel and recover the fragment. Cut the desired band into a centrifuge tube and weigh the gel. Add 300 μL of Buffer B2 per 100 mg of gel. Heat the centrifuge tube in a 50°C water bath until the gel is completely melted. Pipette the entire solution into the adsorption column, centrifuge at 8000 rpm for 30 seconds, and discard the filtrate. Add 300 μL of Buffer B2, centrifuge at 9000 rpm for 30 seconds, and discard the filtrate. Add 500 μL of Wash Solution, centrifuge at 9000 rpm for 30 seconds, and discard the filtrate. Add 25 μL of 60°C RNA-free water to the center of the adsorption membrane. Centrifuge at 9000 rpm for 1 minute to recover the DGAT1 gene containing the T7 promoter, designated T7-DGAT1. The sequence is shown in SEQ ID NO. 7. A total of 25 μL of product was recovered, with a concentration of 166.8 ng / μL.

[0060] (3) Synthetic dsRNA

[0061] dsRNA synthesis was performed according to the MEGA script® Kit instructions, using the reaction system shown in Table 2. After the reaction solution was prepared according to the system, it was incubated at 37°C for 16 hours on a PCR instrument. After incubation, 1 μL of Turb DNase solution was added to remove incompletely reacted cDNA template. The dsRNA, dsDGAT1, was obtained by incubating the reaction at 37°C for 15 minutes under the same conditions. A total of 20 μL of the reaction solution was obtained. The sequence of the reaction solution is shown in SEQ ID NO. 8.

[0062] Table 2 dsRNA synthesis system

[0063]

[0064] Example 4. dsRNA microinjection and interference efficiency detection

[0065] Fourth-instar (4-day-old) brown planthopper nymphs were injected with dsRNA. The dsDGAT1 gene served as the experimental group, while the GFP gene (GFP = green fluorescent protein) served as the control group. Three replicates were set up within each group, with 100 brown planthoppers injected in each replicate (i.e., 300 for each gene). After injection, the brown planthoppers were placed in transparent plastic jars containing rice seedlings and reared in an artificial climate chamber. Survival rates were measured daily, and phenotypic changes were observed.

[0066] Fluorescence quantitative PCR detection of interference efficiency: 72 hours after the injection of dsRNA, surviving brown planthoppers were collected. 6-8 insects were collected for each group, and 3 replicates were performed for each gene. RNA was extracted from the collected insects and cDNA was synthesized. This cDNA was used as a template for RT-qPCR experiments. The interference efficiency was measured by comparing with the control group GFP group. The test results are shown below. Figure 2 Fluorescence quantitative PCR primers were designed, the sequence of the upper primer q-DGAT1-1-F is shown in SEQ ID NO.9, and the sequence of the lower primer q-DGAT1-1-R is shown in SEQ ID NO.10.

[0067] Statistics of the survival rate of brown planthoppers after interference: Within 10 days after injection, the dead brown planthoppers were removed for phenotypic observation, and the number of deaths was recorded every day, and the survival rate of brown planthoppers was counted every day.

[0068] from Figure 3 The survival rate of the dsDGAT1 treatment group was 47%, while the survival rate of the dsGFP control group was 89.33%. The survival rate of the dsDGAT1 treatment group was significantly lower than that of the dsGFP control group. The experimental results show that when the expression level of the DGAT1 gene is significantly reduced after interference, the survival rate of brown planthoppers is significantly reduced, further demonstrating that the purpose of controlling brown planthoppers can be achieved by inhibiting the expression level of the DGAT1 gene.

[0069] Observation of phenotypic changes of brown planthopper after disturbance: Figure 4 、 Figure 5 It can be seen that after the DGAT1 gene is interfered with, the brown planthopper has a phenotype of molting and death after RNAi. Figure 4 This is a side view of a brown planthopper that died due to failure to molt. Figure 5 This is a front view of a brown planthopper that dies during molting.

[0070] Unless otherwise specified, the raw materials and equipment used in the present invention are commonly used in the art; the methods used in the present invention are conventional methods in the art unless otherwise specified.

[0071] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still falls within the scope of protection of the technical solution of the present invention.

[0072] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Various modifications and variations are possible within the skill of the art. Any modifications, equivalent substitutions, or improvements to the present invention are intended to fall within the scope of protection of the present invention.

Claims

1. A use of the DGAT1 gene as an RNA interference target in controlling brown planthoppers, characterized in that: The nucleotide sequence of the DGAT1 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The target sequence of RNA interference is shown in SEQ ID NO.

2.

3. The use according to claim 2, characterized in that RNA interference involves the following steps: 1) Using the DGAT1 gene as a template, a target sequence with the nucleotide sequence shown in SEQ ID NO. 2 was selected for PCR amplification; 2) Ligating the target sequence amplified in step 1) into the pMD19-T vector and transforming into DH5α competent cells; culturing the transformed DH5α Escherichia coli; 3) extracting the plasmid from the DH5α E. coli culture obtained in step 2), and amplifying it with amplification primers containing a T7 promoter sequence to obtain T7-DGAT1; then synthesizing dsRNA using T7-DGAT1 as a template; 4) Injecting dsRNA into brown planthopper nymphs.

4. The use according to claim 3, characterized in that The primers used for PCR amplification in step 1) are the front primer DGAT1-1-F and the rear primer DGAT1-1-R; The sequence of DGAT1-1-F is shown in SEQ ID NO. 3; The sequence of DGAT1-1-R is shown in SEQ ID NO.

4.

5. The use according to claim 3, characterized in that The amplification primers containing the T7 promoter sequence in step 3) are T7-DGAT1-1-F and T7-DGAT1-1-R; The sequence of T7-DGAT1-1-F is shown in SEQ ID NO. 5; The sequence of T7-DGAT1-1-R is shown in SEQ ID NO. 6; The sequence of the T7-DGAT1 is shown in SEQ ID NO.

7.

6. The use according to claim 3, characterized in that The sequence of the dsRNA synthesized in step 3) is shown as SEQ ID NO.

8.

7. A method for using the brown planthopper DGAT1 gene as an RNAi target in the preparation of a drug for controlling brown planthoppers, characterized in that: The nucleotide sequence of DGAT1 is shown in SEQ ID NO.

1.

8. The use of the brown planthopper DGAT1 gene as an RNAi target in the preparation of a drug for controlling brown planthopper according to claim 7, characterized in that: The drug is prepared from the dsRNA shown in SEQ ID NO.

8.

9. A dsRNA for controlling brown planthopper, characterized in that: The nucleotide sequence is shown in SEQ ID NO.8.

Citation Information

Patent Citations

  • Brown planthopper PEX16 gene and application of protein coded by brown planthopper PEX16 gene in prevention and treatment of brown planthopper

    CN116947998A

  • Methods, systems, and apparatus for identifying target sequences for CAS enzymes or crispr-CAS systems for target sequences and conveying results thereof

    WO2014093718A1

  • KR20200044677A

Cited By

  • DsRNA of brown planthopper gene NlUGT7 as well as application and method of dsRNA in prevention and treatment of brown planthopper

    CN122256353A