SCAR molecular marker for identifying male and female eucommia ulmoides oliver and application thereof
By developing male-specific SCAR molecular markers and their primers for Eucommia ulmoides, rapid and accurate sex identification has been achieved, solving the problems of long breeding cycles and high costs in traditional methods. This has promoted research on Eucommia ulmoides breeding efficiency and sex determination mechanisms, and optimized planting management and resource protection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HEZE ACAD OF AGRI SCI (HEZE BRANCH OF SHANDONG ACAD OF AGRI SCI)
- Filing Date
- 2025-05-16
- Publication Date
- 2026-04-14
AI Technical Summary
Traditional methods are insufficient for rapid and accurate sex identification in Eucommia ulmoides plants, resulting in long breeding cycles, high costs, and the inability to conduct early screening. This limits the development of sex-related molecular markers and hinders research on sex determination mechanisms and breeding efficiency.
A highly specific SCAR molecular marker and its primers have been developed to identify a 154bp specific fragment in male Eucommia ulmoides plants via PCR amplification. A kit and identification method are provided to achieve rapid and accurate sex identification.
It can significantly shorten the breeding cycle, optimize planting management, improve gum yield and trait selection efficiency, promote research on sex determination mechanisms, and facilitate the protection of genetic resources and the integration of industry and technology.
Smart Images

Figure CN120464716B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of molecular biology and plant genetics, and in particular relates to a SCAR molecular marker for identifying the sex of Eucommia ulmoides and its application. Background Technology
[0002] The statements in this section are merely background information related to the present invention and do not necessarily constitute prior art.
[0003] Eucommia ulmoides, a dioecious economic tree species unique to my country, directly impacts gum production and planting efficiency through its sex differentiation. However, traditional sex determination relies on morphological observation during flowering, requiring waiting for the plant to reach reproductive maturity (typically 5-8 years). This results in a long breeding cycle, high costs, and an inability to achieve early screening, severely limiting the efficiency of breeding superior varieties. Although molecular marker technology has been widely used in plant genetic research, the lack of whole-genome information for Eucommia ulmoides or regional varietal differences have long left its sex determination mechanism a research gap, limiting the development of sex-related molecular markers.
[0004] Current research largely focuses on the development of universal genetic markers, while the screening of sex-specific molecular markers remains challenging. Although AFLP marker technology has been attempted to construct genetic linkage maps of Eucommia ulmoides and locate QTL loci for important traits, accurate identification of sex-related markers has not yet been achieved, hindering the industrial application of early sex determination technologies. Furthermore, the location and regulatory network of sex-determining genes in Eucommia ulmoides remain unclear, further impeding the design of highly specific molecular markers. Therefore, developing SCAR molecular marker technologies based on sex-determining regions (SDRs) or sex-linked loci has become a key requirement for solving the problem of efficient breeding and cultivation management of Eucommia ulmoides. Summary of the Invention
[0005] To overcome the shortcomings of the prior art, the present invention provides a SCAR molecular marker for identifying the sex of Eucommia ulmoides and its application.
[0006] To achieve the above objectives, one or more embodiments of the present invention provide the following technical solutions:
[0007] In a first aspect, the present invention provides a SCAR molecular marker for identifying the sex of Eucommia ulmoides, wherein the specific fragment sequence of the SCAR molecular marker is shown in SEQ ID NO.8.
[0008] SEQ ID NO.8:
[0009] TCCCTCTACGTTAGTGATTGGGGCACAAGTACATCCCAAAGCAACAGGAAGGAAGCATTGCAACAATCAAATTCAATGTAAGTAGGACGCACGTGGGTTTAAAAAAACCTCAGAATCCCCAAATTTAACCAAACACCTCCAGAAGGAAGCATT.
[0010] In a specific embodiment of the present invention, the amplification primer sequences of the SCAR molecular marker are shown in SEQ ID NO.2 and SEQ ID NO.3.
[0011] SEQ ID NO.2: 5'-TCCCTCTACGTTAGGTGATTGG-3',
[0012] SEQ ID NO. 3: 5'-AATGCTTCCTTCTGGAGGTG-3'.
[0013] The primers were obtained after extensive optimization. After comparing multiple primer pairs, it can be seen that this primer pair has high specificity, yielding a 154bp fragment that is only present in male plants.
[0014] In a second aspect, the present invention provides a pair of primers for identifying the sex of Eucommia ulmoides, the primer sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.3.
[0015] A third aspect of the present invention provides a product for identifying the sex of Eucommia ulmoides, the product comprising the SCAR molecular marker described in the first aspect and / or the primers described in the second aspect;
[0016] The product forms include capture probes, detection kits, or gene chips.
[0017] The kit also contains reagents required for PCR amplification, such as Taq DNA polymerase, PCR buffer, dNTPs, MgCl2, and water.
[0018] A fourth aspect of the invention provides the use of the SCAR molecular marker described in the first aspect and / or the primers described in the second aspect and / or the product for identifying the sex of Eucommia ulmoides described in the third aspect in any one or more of the following:
[0019] 1) Construct a database of sex-related traits in Eucommia ulmoides;
[0020] 2) To identify the sex of Eucommia ulmoides tissues, seeds, or seedlings;
[0021] 3) Achieve Eucommia ulmoides breeding.
[0022] In a fifth aspect, the present invention provides a method for identifying the sex of Eucommia ulmoides, wherein genomic DNA of the sample to be tested is extracted as a template, and PCR amplification and detection are performed using primers shown in SEQ ID NO.2-3. If a single band of 154 bp appears, it is male; if no corresponding band appears, it is female.
[0023] In a specific embodiment of the present invention, the detection method is electrophoresis or sequencing of the amplified products.
[0024] In a specific embodiment of the present invention, the detection method is to sequence the amplified product. If the sequencing result is the same as the sequence shown in SEQ ID NO.8, the sample can be determined to be male.
[0025] In a specific embodiment of the present invention, the annealing temperature of the SCAR-labeled primer is 53.8–57.0 °C.
[0026] In a specific embodiment of the present invention, the PCR amplification program is as follows: 98°C pre-denaturation for 10 seconds; 98°C denaturation for 10 seconds, 55°C annealing for 10 seconds, 72°C extension for 5 seconds, 35 cycles; 72°C extension for 10 minutes.
[0027] In a specific embodiment of the present invention, the Eucommia ulmoides is preferably Huazhong No. 1 or Huazhong No. 5.
[0028] The above one or more technical solutions have the following beneficial effects:
[0029] This invention provides a 154 bp male-specific gene fragment of Eucommia ulmoides, along with a pair of SCAR molecular marker primers, and based on this, a kit and method for identifying the sex of Eucommia ulmoides. The primers provided by this invention can amplify the genomes of various Eucommia ulmoides species with high specificity and good stability. Using the kit and method, male Eucommia ulmoides plants can be identified rapidly and effectively.
[0030] The molecular markers provided by this invention can accelerate the breeding process, quickly distinguishing male and female plants during the seedling stage and significantly shortening the breeding cycle. This helps breeders screen plants of the target sex early on, enabling the targeted cultivation of high-yielding female plants or male plants with superior pollen. Combined with molecular-assisted breeding, it can optimize the design of hybrid combinations, improving the breeding efficiency of traits such as gum content and stress resistance.
[0031] This technology can optimize planting and management strategies. The ratio of male to female Eucommia ulmoides plants directly affects gum production (e.g., retaining 5%-10% male plants for pollination) can increase the yield of Eucommia ulmoides gum and medicinal components. Molecular marker technology can guide the regulation of sex ratio during the seedling stage. Through large-scale seedling sex identification, planting density can be precisely planned, avoiding resource waste caused by an excessively high proportion of male plants in traditional planting. In addition, this technology can also be used for sex-linked trait research, providing data support for targeted cultivation.
[0032] Advancing research on sex determination mechanisms. The development of sex molecular markers helps to elucidate the genetic basis of sex differentiation in Eucommia ulmoides. By comparing the genomic differences between male and female plants, sex-related genes (such as sex-determining regions, SDRs) can be located, revealing their epigenetic regulatory networks. Such research not only lays the foundation for gene-editing breeding but also provides a reference model for research on other dioecious plants.
[0033] Promoting the integration of industry and technology, and combining it with genomics and bioinformatics, can help construct a database of sex-related traits in Eucommia ulmoides, thus promoting the establishment of a precision breeding system. On the industrial side, this technology can be integrated into intelligent seedling systems to achieve automated sex detection of seedlings, reducing labor costs. In the future, it can also explore the synergistic screening of sex markers and mucilage synthesis pathway genes to improve the economic benefits of the entire industry chain.
[0034] Contributing to the protection of genetic resources. Wild Eucommia ulmoides populations face the risk of genetic diversity loss due to overexploitation. Sex molecular markers can be used for population genetic structure analysis, assessing the sex genetic diversity of different geographical populations, reducing resource waste caused by indiscriminate planting, providing a scientific basis for germplasm resource bank construction and ecological restoration projects, and promoting the sustainable management of Eucommia ulmoides plantations.
[0035] Advantages of additional aspects of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description
[0036] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0037] Figure 1 The image shows the PCR amplification results of primer M1-F / R in 12 male Eucommia ulmoides plants in Example 1 of this invention. The leftmost DNA marker is TaKaRa DL2,000 DNA Marker (3427A), and the molecular weights from top to bottom are 2000, 1000, 750, 500, 250, and 100 bp, respectively. Lanes 1-6 are male Eucommia ulmoides plant No. 1, and lanes 7-11 are male Eucommia ulmoides plant No. 5.
[0038] Figure 2This is an example of the PCR amplification of primer M1-F / R in 10 female Eucommia ulmoides plants in Example 1 of this invention. The template in the rightmost lane is ddH2O, and the DNA marker in the leftmost lane is TaKaRa DL2,000 DNA Marker (3427A). The molecular weights from top to bottom are 2000, 1000, 750, 500, 250, and 100 bp, respectively. Lanes 1-10 are female Eucommia ulmoides plants No. 1.
[0039] Figure 3 The image shows the PCR amplification results of primer M2-F / R in 11 male Eucommia ulmoides plants in Example 1 of this invention. The leftmost DNA marker is TaKaRa DL2,000 DNA Marker (3427A), with molecular weights of 2000, 1000, 750, 500, 250, and 100 bp from top to bottom. Lanes 1-6 represent male Eucommia ulmoides plant No. 1, and lanes 7-11 represent male Eucommia ulmoides plant No. 5.
[0040] Figure 4 The image shows the PCR amplification results of primer M2-F / R in nine female Eucommia ulmoides plants in Example 1 of this invention. The leftmost DNA marker is TaKaRa DL2,000 DNA Marker (3427A), and the molecular weights from top to bottom are 2000, 1000, 750, 500, 250, and 100 bp, respectively. Lanes 1-9 are female Eucommia ulmoides plants No. 1.
[0041] Figure 5 The image shows the PCR amplification results of primer M3-F / R in 11 male Eucommia ulmoides plants in Example 1 of this invention. The leftmost DNA marker is TaKaRa DL2,000 DNA Marker (3427A), and the molecular weights from top to bottom are 2000, 1000, 750, 500, 250, and 100 bp, respectively. Lanes 1-6 are male Eucommia ulmoides plant No. 1, and lanes 7-11 are male Eucommia ulmoides plant No. 5.
[0042] Figure 6 The image shows the PCR amplification results of primer M3-F / R in nine female Eucommia ulmoides plants in Example 1 of this invention. The leftmost DNA marker is TaKaRa DL2,000 DNA Marker (3427A), and the molecular weights from top to bottom are 2000, 1000, 750, 500, 250, and 100 bp, respectively. Lanes 1-9 are female Eucommia ulmoides plantlets No. 1. Detailed Implementation
[0043] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains; unless otherwise specified, the reagents and materials used in the following examples are commercially available.
[0044] It should be noted that any aspects of this invention not described in detail are well known to those skilled in the art. Experimental methods not specifically described in the following examples are generally performed under conventional conditions or as recommended by the manufacturer. Experimental steps not described in detail are based on references to *Molecular Cloning: A Laboratory Manual* (edited by Michael R. Green and Joseph Sambrook, 4th edition), pathophysiological experiments, online databases, etc.
[0045] Example 1
[0046] (1) Genomic DNA was isolated from leaf samples of 10 male and 10 female plants whose sex had been identified by CTAB method. The quality of the DNA was detected on 1.0% agarose gel and ultra-micro spectrophotometer. Then, ddRAD library was constructed.
[0047] The Eucommia ulmoides used was taken from Huazhong No. 1, which was harvested in 2021 from Dalin Eucommia Garden in Gaomi City, Shandong Province.
[0048] During library construction, the genomic DNA of each sample was digested using MseI and EcoRI enzymes, and adapters were ligated separately. The DNA samples were then mixed, and fragments of 200-600 bp in length were selected for PCR amplification, purification, and collection.
[0049] (2) The library was sequenced at both ends using Illumina next-generation sequencing technology, with a read length of 150 bp. After processing and analysis of the data, three genomic loci were finally identified as potential male-specific ddRAD markers. They were present in 10 males but not in 10 females, and were named M1, M2 and M3.
[0050] The nucleotide sequence of fragment M1 is shown in SEQ ID NO.1.
[0051] SEQ ID NO.1:
[0052] GGAACTAAAAGAGTCTGAAGTAATAAAATATCCCTCTACGTTAGGTGATTGGGGCACAAGTACATCCCAAAGCAACAGGAAGGAAGCATTGCAACAATCAAATTCAATGTAAGTAGGACGCACGTGGGTTTAAAAAAACCTCAGAATCCCCAAATTTAACCAAACACCTCCAGAAGGAAGCATTGCAAACAATCA
[0053] (3) Design corresponding primer pairs based on the above sequence for amplification. Primer and fragment information are shown in Table 1.
[0054] Table 1 Primer and fragment information
[0055]
[0056]
[0057] To improve primer specificity and stability and avoid differential bands in different samples of male or female plants using the same primers, primers M1-F and M1-R were designed on the M1 fragment after multiple experiments, resulting in fragment M1-1.
[0058] In 2022, 140 Eucommia ulmoides plants from the Chinese Medicinal Herb Germplasm Resource Nursery of Heze Academy of Agricultural Sciences (about 500 kilometers away from the original sampling point) were used as a separate population to verify the specificity marker. The sex of the Eucommia ulmoides used was subsequently verified by flower traits. The varieties included 30 male and 40 female plants of Huazhong No. 1 and 70 male plants of Huazhong No. 5.
[0059] DNA was extracted from plant leaves using the CTAB method and then amplified by PCR.
[0060] PCR reaction system: 10×Buffer 2.5μL, dNTPs 0.5mM, primers 0.2μM each, Taq enzyme 1U, template DNA 50ng, ddH2O to a final volume of 50μL. Reaction program: 98℃ pre-denaturation for 10sec; 35 cycles (98℃ 10s, 55℃ 10s, 72℃ 5s); 72℃ extension for 10min.
[0061] The reaction system for primer M2 is the same as that for primer M1. Reaction program: 98℃ pre-denaturation for 10 sec; 35 cycles (98℃ for 10 s, 55℃ for 10 s, 72℃ for 5 s); extension at 72℃ for 10 min.
[0062] The reaction system for primer M3 is the same as that for primer M1. Reaction program: 98℃ pre-denaturation for 10 sec; 35 cycles (98℃ for 10 s, 55℃ for 10 s, 72℃ for 5 s); extension at 72℃ for 10 min.
[0063] (4) The obtained PCR products were identified using 2% agarose gel electrophoresis.
[0064] For the M1 fragment, all tested male plants consistently amplified a 154bp specific fragment, while female plants did not show this band. Some results are shown below. Figure 1-2 As shown. Figure 1 The results of PCR amplification of primer M1-F / R in 12 male Eucommia ulmoides plants; Figure 2 This describes the PCR amplification results of primer M1-F / R in 10 female Eucommia ulmoides plants. Figure 1and Figure 2 It can be seen that a band appears at 154bp in male plants ( Figure 1 No specific band was found at 154 bp in female plants. This result was obtained by repeating the same procedure three times, indicating that the SCAR marker is stable and reliable. Therefore, this gene fragment is male-specific.
[0065] Figure 3 The results of PCR amplification using primer M2-F / R in 11 male Eucommia ulmoides plants; Figure 4 This describes the PCR amplification results of primer M2-F / R in nine female Eucommia ulmoides plants. Figure 3 , Figure 4 It is evident that amplification of Eucommia ulmoides genomic DNA using M2-F / R failed to yield a target band of approximately 500 bp. Furthermore, amplification of male plant DNA using M2-F / R produced disordered bands lacking specificity. Figure 3 No specific band of the target size was found in the M2-F / R amplification of female DNA. Figure 4 This result was obtained by repeating the same steps three times.
[0066] Figure 5 The results of PCR amplification using primer M3-F / R in 11 male Eucommia ulmoides plants; Figure 6 This describes the PCR amplification results of primer M3-F / R in nine female Eucommia ulmoides plants. Figure 5 , Figure 6 It is evident that amplification of Eucommia ulmoides genomic DNA using M3-F / R failed to yield the target band of approximately 900 bp; the bands obtained by M3-F / R in identifying male plants were disordered, and the target band could not be obtained in all male samples. Figure 5 No specific bands were found in the female plants. Figure 6 Furthermore, the results obtained from M3 showed significant individual differences and lacked universality. This result was obtained by repeating the same steps three times.
[0067] In summary, the PCR bands at M2 and M3 do not show significant and stable differences in sex and cannot be used for plant sex determination. In contrast, the PCR product at the M1 locus shows a stable single band in males but not in females. This demonstrates the stability of the above marker genes and the feasibility of the M1-F / R primer pair in determining the sex of Eucommia ulmoides.
[0068] Sanger sequencing of the gene fragment obtained by M1 amplification revealed that the gene fragment sequence is: TCCCTCTACGTTAGGTGATTGGGGCACAAGTACATCCCAAAGCAACAGGAAGGAAGCATTGCAACAATCAAATTCAATGTAAGTAGGACGCACGTGGGTTTAAAAAAACCTCAGAATCCCCAAATTTAACCAAACACCTCCAGAAGGAAGCATT (154bp, SEQ ID NO.8), which is consistent with the expected sequence.
[0069] The sequenced nucleotide sequences were compared with DNA and RNA sequences of plants, animals, and microorganisms in the NCBI nucleotide database (https: / / www.ncbi.nlm.nih.gov / ), and no homologous sequences were found.
[0070] Comparison with the publicly available Eucommia ulmoides genome database (https: / / bigd.big.ac.cn / gwh / Assembly / 13 / show) revealed no homologous sequences.
[0071] The above comparison results indicate that the present invention has discovered a new DNA sequence that is specific to male Eucommia ulmoides plants and can be used to identify the sex of Eucommia ulmoides.
[0072] While the specific embodiments of the present invention have been described above in conjunction with the accompanying drawings, this is not intended to limit the scope of protection of the present invention. Those skilled in the art should understand that various modifications or variations that can be made by those skilled in the art without creative effort based on the technical solutions of the present invention are still within the scope of protection of the present invention.
Claims
1. A SCAR molecular marker for identifying the sex of Eucommia ulmoides, characterized in that, The specific fragment sequence of the SCAR molecular marker is shown in SEQ ID NO.
8.
2. The SCAR molecular marker as described in claim 1, characterized in that, The amplification primer sequences for the SCAR molecular marker are shown in SEQ ID NO.2 and SEQ ID NO.
3.
3. A pair of primers for identifying the sex of Eucommia ulmoides, characterized in that, The primer sequences are shown in SEQ ID NO.2 and SEQ ID NO.
3.
4. A product for identifying the sex of Eucommia ulmoides, characterized in that, The product includes the primers as described in claim 3; The product is in the form of a test kit.
5. The use of the SCAR molecular marker of claim 1 and / or the primer of claim 3 and / or the product for identifying the sex of Eucommia ulmoides of claim 4 in any of the following: 1) Construct a database of sex-related traits in Eucommia ulmoides; 2) Identify the sex of Eucommia ulmoides tissues, seeds, or seedlings.
6. A method for identifying the sex of Eucommia ulmoides, characterized in that, Genomic DNA was extracted from the sample to be tested and used as a template. PCR amplification and detection were performed using the primers shown in SEQ ID NO.2-3. If a single band of 154 bp appeared, it was male; if no corresponding band appeared, it was female.
7. A method for identifying the sex of Eucommia ulmoides, characterized in that, Genomic DNA was extracted from the sample to be tested and used as a template. PCR amplification was performed using the primers shown in SEQ ID NO.2-3, and the detection method was to sequence the amplification products.
8. The method according to claim 7, characterized in that, If the sequencing result is identical to the sequence shown in SEQ ID NO.8, the sample can be identified as male; if no amplified band is found, the sample is female.
9. The method according to claim 6, characterized in that, The annealing temperature of the primers is 53.8–57.0 °C.
10. The method according to claim 6, characterized in that, The PCR amplification program was as follows: 98℃ pre-denaturation for 10 sec; 98℃ denaturation for 10 s, 55℃ annealing for 10 s, 72℃ extension for 5 s, 35 cycles; and 72℃ extension for 10 min.
Citation Information
Patent Citations
Primer, fragment and method for identifying gender of eucommia ulmoides
CN111549162A