Application of Samsn1 gene in preparation of medicine for repairing spinal cord injury
By detecting Samsn1 gene expression and using its inhibitor to regulate the inflammatory response of microglia, the problem of excessive inflammation after spinal cord injury is solved, and the repair and nerve function recovery of spinal cord injury are achieved.
Patent Information
- Application Number
- CN202510202983.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-24
- Publication Date
- 2025-08-12
AI Technical Summary
There is a lack of effective methods in the prior art to regulate the inflammatory response of microglia to promote repair after spinal cord injury, resulting in an excessive inflammatory response that may lead to further nerve damage.
By detecting Samsn1 gene expression and using its expression inhibitor to regulate the inflammatory response of microglia, inhibiting the expression of inflammatory factors such as TNF-α, IL-1β and IL-6, a spinal cord injury repair drug is prepared using Samsn1 gene expression inhibitors.
Significantly reduce the inflammatory response of microglia after spinal cord injury, promote the recovery of nerve function, and realize the repair of spinal cord injury.
Smart Images

Figure CN120464718A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to the application of the Samsn1 gene in the preparation of a drug for repairing spinal cord injury. Background Art
[0002] Microglia are the primary immune cells of the central nervous system (CNS) and play a key role in the inflammatory response and neural repair after spinal cord injury (SCI). Spinal cord injury is a serious medical condition that can lead to loss of sensory and motor function, severely impacting patients' quality of life. The rapid response of microglia after SCI and their persistent presence in the injured area offer new insights into the development of therapeutic strategies. In the early stages of SCI, microglia rapidly activate and migrate to the injury site, releasing inflammatory mediators such as tumor necrosis factor α (TNF-α), interleukin 1β (IL-1β), and interleukin 6 (IL-6), which participate in the local inflammatory response. While the inflammatory response plays an important role in clearing damaged cells and debris and preventing infection, excessive inflammation can also lead to further neural damage. In recent years, researchers have begun exploring therapeutic approaches to modulate microglial activity to promote recovery after SCI. For example, modulating the microglial inflammatory response using drugs or gene therapy can reduce post-injury neural damage and promote recovery of neural function. Therefore, drugs or molecules that intervene in the inflammatory response of microglia are expected to become important targets for the treatment of spinal cord injury and other central nervous system diseases.
[0003] SAM domain, SH3 domain, and nuclear localization signal 1 (SAMSN1) is a protein expressed in immune cells, particularly macrophages and dendritic cells. It plays an important role in immune responses, particularly in apoptosis and inflammation. In clinical studies, the potential of SAMSN1 as a biomarker is being explored, particularly in blood disorders and certain types of cancer. For example, SAMSN1 expression levels may correlate with the prognosis of certain leukemias. However, there have been no reports of its effects on microglia after spinal cord injury. Summary of the Invention
[0004] One of the purposes of the present invention is to provide a reagent for detecting Samsn1 gene expression and its use in preparing a diagnostic reagent for spinal cord injury.
[0005] The present invention sequenced the transcriptome of spinal cord injury and found that the expression of Samsn1 gene showed a gradually increasing trend after spinal cord injury. At the same time, Samsn1 was highly expressed in microglia. Therefore, it was inferred that the Samsn1 gene was related to spinal cord injury. The reagent for detecting Samsn1 gene expression can be used to prepare a diagnostic reagent for spinal cord injury.
[0006] In the present invention, the nucleotide sequence (CDS region) of the Samsn1 gene is as follows:
[0007] Rattus norvegicus SAM domain,SH3 domain and nuclear localizationsignals,1(Samsn1),mRNA NCBI Reference Sequence:NM_130821.2
[0008] >NM_130821.2:83-1201Rattus norvegicus SAM domain,SH3 domain and nuclear localization signals,1(Samsn1),mRNA
[0009] ATGCTAAAGAGGAAGCCATCCAATGCTTCAGAGAAGGAGAAACACCAAAAACCGAAGC
[0010] GCAGCAGTTTTGGGAATTTTGATCGTTTTCGGAATAATTCCATATCAAAATCTGATG
[0011] ACTCAATCGAGGTCCGGTGACGGGGAACTGACAAATGGAAGTGAGGAACAAAGCAAAA
[0012] CTTCAAACAATGGAGGAAGTCTAGGTAAAAAAGTGAGGGCTATTTCATGGACAATGAAG
[0013] AAAAAAGTAGGGAAAAAATACATCAAAGCTCTTCTGAGGAAAAAGAGGAGGAAATTA
[0014] GAGAGGAAACCCTCCAGTATCGGAACAGTGATCCCATGATTGGAACACGTACAGAGAA
[0015] GATCTCTCTTAAAGCCAGCGACTCTATGGACAGTCTTTACAGTGGGCAGAGCTCATCAA
[0016] GTGGGATAACAAACTGTTCAGATGGAACAAGCAATCGGGACAGCTTTCGACTGGACGA
[0017] CGACAGCCCCTACTCAGGGCCATTCTGTGGCCGTGCCCGAGTGCACACAGACTTCACAC
[0018] CAAGTCCCTATGACACAGACTCCCTTAAAATCAAGAAAGGAGACATCATAGACATTATCT
[0019] GCAAAACACCGATGGGAATGTGGACAGGGATGCTAAACAACAAAGTGGGGAACTTCAA
[0020] GTTCATTTACGTGGATGTTATCTCAGAAGAGGAAGCAGCTCCTAAGAAAGTAAAGGTGC
[0021] CCAGAAGCAGTAGAAGAGAAAACCCCCAGACTCTCCAAGAATTCTTAGAGAGGATTCA
[0022] TCTTCAGGAATATACTTCAGCATTTCTGCTCAATGGTTATGAGGCCCTGGATGACTTGAA
[0023] GGATATCAAAGAAAGCCATCTAATTGAACTAAACATTGCCAATCCAGAAGACAGGGCGA
[0024] GGCTCCTGTCTGCTGCTGAGAGTCTCCTGGATGAAGAAACTGCCGCGGAGCATGAAGA
[0025] GGAACCTGTGCCTCTGTCCTCAAACCCAGACATCTTGAGTGAATCACAGTTAGATGACT
[0026] GCCCGAGGGACTCTGGCTGTTACATCTCATCAGGAAATTCAGATAATGGCAAAGAAGAT
[0027] CCAGAGTCCCAAAGTCTGCCTGACATGGTACAGAAGATTTCCATCACGGAGCCCAGTGACTGA.
[0028] The second purpose of the present invention is to provide the use of a Samsn1 gene expression inhibitor in the preparation of a drug for promoting the repair of spinal cord injury.
[0029] The present invention knocks down the expression of Samsn1 by transfecting siRNA into microglial cells BV2, and detects the expression of inflammatory factors tumor necrosis factor α (TNF-α), interleukin 1β (IL-1β), and interleukin 6 (IL-6) after knocking down Samsn1. The results show that the expression of inflammatory factors in BV2 cells of the siRNA transfection group is decreased. Considering the high expression of Samsn1 in microglial cells, Samsn1 gene expression inhibitors can be used after spinal cord injury to regulate the inflammatory response of microglial cells, thereby inhibiting the expression of inflammatory factors at a specific stage and achieving spinal cord injury repair. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] Figure 1 The expression of Samsn1 during spinal cord injury. A represents the expression of Samsn1 during spinal cord injury (C represents the caudal end of the injury, R represents the rostral end of the injury, and S represents the sham operation group); B represents the high expression of Samsn1 in microglia.
[0031] Figure 2 The knockdown efficiency of Samsn1 siRNA in the microglial cell line BV2 (*p<0.05).
[0032] Figure 3 The effect of Samsn1 siRNA treatment on pro-inflammatory factors (*p<0.05). DETAILED DESCRIPTION
[0033] The preferred embodiments of the present invention will be described in detail below with reference to the examples. It should be understood that the following examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.
[0034] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0035] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.
[0036] Example 1
[0037] Expression of Samsn1 during spinal cord injury
[0038] According to the transcriptome sequencing results of spinal cord injury conducted by the inventor's research group in the early stage, it was found that the expression of Samsn1 gene showed a gradual upward trend after spinal cord injury, such as Figure 1 shown.
[0039] Example 2
[0040] Functional verification of Samsn1
[0041] Based on the results obtained in Example 1, this example further verifies the function of Samsn1.
[0042] 1. Culture and Electroporation of the Microglial Cell Line BV2
[0043] BV2 cells were cultured according to conventional methods, and BV2 cells passaged to the p2 generation were counted. A certain amount of cells were mixed with siRNA and thoroughly mixed to a final concentration of 1.0×10 6 BV2 cells were added with 200 nM siRNA, wherein the cell volume was 90 μL and the siRNA volume was 10 μL. Then, electrotransfection was performed according to the electrotransfection procedure of NEPA21 (NEPAGENE) neuronal cells (275 V, 0.7 ms).
[0044] Samsn1 siRNA is as follows:
[0045] Justice chain:CAGCUUCCGACUGGAUGAUTT
[0046] Antisense strand: AUCAUCCAGUCGGAAGCUGTT.
[0047] Ctrl siRNA:
[0048] Justice chain:UUCUCCGAACGUGUCACGUTT
[0049] Antisense strand: ACGUGACACGUUCGGAGAATT.
[0050] 2. RNA Extraction from Microglial Cell Line BV2
[0051] BV2 cells were added to 1 mL Reagent (Thermo Fisher), then place in a 1.5 mL RNase-free EP tube and lyse on ice for 5 minutes. Add 200 μL of chloroform, vortex vigorously for 20 seconds, and let stand at room temperature for 5 minutes. Centrifuge at 13,000 rpm at 4°C for 15 minutes. Carefully aspirate the supernatant, add 500 μL of isopropanol, gently mix by inversion, let stand at room temperature for 10 minutes, and centrifuge at 13,000 rpm at 4°C for 15 minutes. Discard the supernatant. Add 1 mL of 75% ethanol, gently wash the pellet, and centrifuge at 13,000 rpm at 4°C for 5 minutes. Discard the supernatant and air dry. Add an appropriate amount of RNase-free H2O and solubilize at 65°C for 10 minutes. Measure the OD value and concentration of RNA and store at -80°C until needed.
[0052] 3. RNA Reverse Transcription to cDNA
[0053] Reverse transcribe 500 ng of RNA into cDNA using a reverse transcription kit (Vazyme R312-01). Operate on ice in 20 μL per reaction as follows:
[0054]
[0055] The reaction procedure was: 37°C for 15 min, 85°C for 5 sec, and 4°C for ∞.
[0056] 4. Real-time quantitative PCR (qRT-PCR)
[0057] Samsn1 qRT-PCR primer sequences were designed according to primer design principles.
[0058] Samsn1 qRT-PCR primers are as follows:
[0059] Samsn1-F:5'-GCCAGCGACTCTATGGACAG-3'
[0060] Samsn1-R:5'-ACTTGGCGTGAAGTCTGGT-3'.
[0061] The cDNA obtained by reverse transcription was diluted 1:5 and subjected to the following qRT-PCR reaction.
[0062] (1) Prepare the qRT-PCR reaction solution according to the following components:
[0063]
[0064] (2) The reaction solution was mixed and the Real-time PCR reaction program was as follows: pre-denaturation, 95°C for 30 seconds; denaturation, 95°C for 5 seconds, annealing and extension, 60°C for 30 seconds; 40 cycles; melting curve stage: 95°C for 15 seconds, 60°C for 60 seconds, and 95°C for 15 seconds.
[0065] The results are as follows Figure 2 As shown, after 48 h of siRNA treatment, Samsn1 siRNA could significantly reduce the expression of Samsn1 in BV2 cells, regardless of whether LPS was added to stimulate BV2 activation (*P<0.05).
[0066] After spinal cord injury, microglia are rapidly activated and migrate to the injury site, releasing inflammatory mediators such as tumor necrosis factor α (TNF-α), interleukin 1β (IL-1β), and interleukin 6 (IL-6). These mediators are involved in the local inflammatory response. Therefore, this example also tested the expression changes of these inflammatory factors after reducing the expression of Samsn1. The results are shown in Figure 2. Figure 3 As shown in the figure, after 48 h of siRNA treatment, the Samsn1 siRNA treatment group could significantly reduce the expression of proinflammatory factors Tnf-α, IL-1β and IL-6 in BV2 cells, regardless of whether LPS was added to stimulate BV2 activation (*P<0.05).
Claims
1. Application of reagents for detecting Samsn1 gene expression in the preparation of diagnostic reagents for spinal cord injury.
2. Application of Samsn1 gene expression inhibitors in the preparation of drugs to promote spinal cord injury repair.
3. The use according to claim 2, characterized in that The Samsn1 gene expression inhibitor is selected from one or more of compounds, proteins, polypeptides, polysaccharides, glycoproteins, glycopeptides, and nucleic acids.
4. The use according to claim 3, characterized in that The Samsn1 gene expression inhibitor is siRNA.
5. The use according to claim 4, characterized in that The nucleotide sequence of the siRNA is as follows: Justice chain: CAGCUUCCGACUGGAUGAUTT Antisense strand: AUCAUCCAGUCGGAAGCUGTT.