Antisense oligonucleotides for treating hereditary HFE hemopigmentation

Abstract

The present disclosure relates to the field of diseases caused by iron overload, such as homeostatic iron regulatory protein (HFE) hemopigmentation. In particular, the present disclosure provides a method for targeting, in the liver, c.845Ggt; c.845Ggt; c.845Ggt; c.845Ggt; c.845Ggt; oligonucleotides of RNA editing technology for deamination of A nucleotides to reduce iron overload.

Description

Technical Field

[0001] The present invention relates to the field of medicine. It relates to the field of diseases caused by iron overload, such as hemochromatosis associated with the homeostatic iron regulatory protein (HFE). The present invention relates to the use of nucleotide editing technology to target the HFE gene and transcript to induce amino acid changes that restore the normal function of the homeostatic iron regulatory protein (HFE) in regulating the body's iron homeostasis. Background Art

[0002] Iron overload disorders represent an important class of human diseases. Among the major iron overload conditions, by far the most common and best studied is HFE-related hemochromatosis (HH). The most common HH pathogenic mutation in humans is the C282Y substitution in HFE, which leads to disruption of iron homeostasis (Milman NT et al. 2019. Gastroenterology Res. 12(5):221-232; Anderson GJ and Bardou-Jacquet E. 2021. Ann Transl Med. 9(80):731; Barton JC and Edwards CQ. 2018. Gene Reviews. Seattle (WA) University of Washington. 1993, updated December 6, 2018; Brissot P et al. 2018. Nat Rev Dis Primers. 4:18016; Cancado RD et al. 2022. Hematol Transfus Cell Ther. 44(1):95-99; Ye Q et al. 2016. PloS One. 11(9):e0163423). The disease is characterized by reduced expression of the iron-regulating hormone hepcidin, which leads to increased dietary iron absorption and deposition of iron in multiple tissues including the liver, pancreas, joints, heart and pituitary gland. The phenotype of HH is quite variable, with some individuals showing little or no signs of increased iron in the body, while others show severe iron overload, tissue damage and clinical sequelae. Most individuals with a genetic predisposition show signs of at least some iron overload (increased transferrin saturation and serum ferritin). Since it is a common condition in the Caucasian population (1:200 to 1:500), and even if a small number of affected individuals show clinical symptoms, it remains an important clinical entity. Early symptoms that may occur include abdominal pain, weakness, lethargy, weight loss, arthralgia, erectile dysfunction in men, loss of libido due to hypogonadism in women, loss of muscle mass, osteoporosis, diabetes and an increased risk of cirrhosis when serum ferritin is above 1000 ng / mL. Other findings may include progressive increases in skin pigmentation, congestive heart failure and / or arrhythmias, arthritis, and hypogonadism. Individuals with HH experience excessive absorption of normal dietary iron by the intestinal mucosa, leading to excessive and substantial iron storage, which can cause damage to target organs and potentially lead to organ failure.

[0003] Men are more likely to develop significant disease than women, who lose iron primarily through menstrual blood loss. Other forms of blood loss, immune system effects, the amount of bioavailable iron in the diet, and lifestyle factors (such as high alcohol intake) can also contribute to iron overload and disease manifestations. Cirrhosis is more common in C282Y homozygotes who consume more than 60g of alcohol daily. Symptoms associated with iron overload typically appear between the ages of 40 and 60 in men and after menopause in women. Sometimes, HH presents at an earlier age, but liver fibrosis or cirrhosis is rare before the age of 40. Generally speaking, the development of cirrhosis is believed to determine whether an individual has a normal life expectancy or a reduced life expectancy even with iron-depleting therapy, primarily due to the development of hepatocellular carcinoma. Treatment of patients with cirrhosis to achieve iron depletion cannot eliminate the 10%-30% risk of primary liver cancer. Generally speaking, death in individuals with clinical HH is usually caused by liver failure, primary liver cancer, extrahepatic cancer, congestive heart failure, or arrhythmias. Early screening studies showed that 38% to 50% of C282Y homozygotes develop iron overload, and 10% to 33% eventually develop symptoms or organ damage associated with hemochromatosis. Some individuals who are heterozygous for C282Y have elevated serum transferrin saturation and serum ferritin concentrations, but they generally do not develop complications of iron overload, although this can occur due to environmental influences, lifestyle, or other mutations (such as H63D of HFE or mutations in other iron homeostasis genes). Individuals who are homozygous for the C282Y mutation may be asymptomatic for decades and then show the onset of symptoms around age 40 for men and 50 for women. Patients with the C282Y mutation have a worse quality of life (as measured by the Short Form Health Status (SF-36) scale) than patients with other genotypes (Fonseca et al. 2018. BMC Med Genet. 19(1):3).

[0004] Phlebotomy (venipuncture) is the standard of care for patients with hemochromatosis. It is highly effective in preventing hemochromatosis damage, is safe, and is inexpensive. Early diagnosis and initiation of phlebotomy are important actions to prevent tissue and cellular damage caused by reactive oxygen species from iron overload. However, phlebotomy is not always effective, and the elderly often cannot tolerate this treatment regimen. Iron chelation therapy is not indicated for classic hemochromatosis, although in rare cases, iron chelators are an adjunct or alternative therapy, such as in severe iron overload when phlebotomy is ineffective and / or venous status is poor. Erythrocyte apheresis has been used to treat patients with hemochromatosis but is more expensive and less accessible than phlebotomy. Two studies have shown that adequate hemochromatosis treatment with early intervention is essential to prevent morbidity caused by hemochromatosis associated with HFE C282Y homozygosity. Ong et al. (Lancet Haematol. 2017; 4(12): e607-614) recruited patients with C282Y homozygous genotype and intermediate serum ferritin levels (300–1000 μg / L) and conducted a randomized controlled trial by dividing the cohort into two groups: iron reduction by erythrapheresis (treatment) or sham treatment by plasmapheresis (control). They identified an improvement in the Modified Fatigue Impact Scale (MFIS) score in the treatment group compared with the control group. In a large cohort study conducted in the UK Biobank that included 2,890 patients with C282Y homozygous genotype, Pilling et al. (BMJ. 2019; 364: k5222) concluded that hemochromatosis was associated with a significant prevalence and incidence of clinically diagnosed diseases (liver disease, rheumatoid arthritis, osteoarthritis, and diabetes) in both men and women (Cancado et al. 2022, supra).

[0005] The present disclosure aims to provide one or more alternative and / or improved compounds or compositions for treating hereditary HH. Summary of the Invention

[0006] Disclosed herein are RNA editing oligonucleotides (EONs) capable of forming a double-stranded (ds) complex with a region of an endogenous human HFE transcript molecule in a cell, wherein the region of the HFE transcript molecule comprises a target adenosine, and wherein the ds complex can recruit an endogenous ADAR enzyme to deaminate the target adenosine to inosine, thereby editing the HFE transcript molecule. Preferably, the HFE transcript molecule is a pre-mRNA or mRNA molecule. Preferably, the cell is a human liver cell, more preferably a hepatocyte. In a preferred aspect, the target adenosine is the c.845G>A mutation in the HFE gene. When the EON is in naked form, preferably at least one nucleotide comprises one or more non-naturally occurring chemical modifications, or one or more additional non-naturally occurring chemical modifications in the ribose, linkage, or base moiety, provided that the orphan nucleotide is not a cytidine comprising a 2'-OMe ribose substitution, and the orphan nucleotide is the nucleotide directly opposite the target adenosine in the EON.

[0007] Also disclosed herein is a vector, preferably a viral vector, more preferably an adeno-associated viral (AAV) vector, comprising a nucleic acid molecule encoding an EON, wherein the EON is capable of forming a ds complex with a region of an endogenous human HFE transcript molecule in a cell, wherein the region of the HFE transcript molecule comprises a target adenosine, and wherein the ds complex can recruit an endogenous ADAR enzyme to deaminize the target adenosine to inosine.

[0008] Also disclosed herein is a pharmaceutical composition comprising the disclosed EON or the disclosed carrier and a pharmaceutically acceptable carrier.

[0009] Also disclosed herein are EONs capable of forming a ds complex with a region of an endogenous human HFE transcript molecule in a cell for use in treating HFE hemochromatosis, wherein the region of the HFE transcript molecule comprises a target adenosine, and wherein the ds complex can recruit endogenous ADAR enzymes to deaminize the target adenosine to inosine.

[0010] Disclosed is a method for editing an HFE polynucleotide, comprising contacting the HFE polynucleotide with an EON capable of effecting an adenosine deaminase acting on RNA (ADAR)-mediated conversion of adenosine to inosine, which is associated with iron homeostasis, thereby editing the HFE polynucleotide. Disclosed is a method for treating HFE hemochromatosis in a patient in need thereof, comprising contacting an HFE polynucleotide in a cell of a subject with an EON capable of effecting an ADAR-mediated conversion of adenosine to inosine, which is associated with iron homeostasis, thereby treating the patient. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] One or more embodiments of the present invention will now be described, by way of example only, with reference to the accompanying drawings, in which:

[0012] Figure 1 The human HFE target RNA sequence (5' to 3'; SEQ ID NO: 52) is shown at the top, with the target adenosine in bold and the tyrosine codon at position 282 in the human HFE protein underlined. Below the target sequence, the sequences (also 5' to 3') of the initial 51 EONs designed to edit the target adenosine (SEQ ID NOs: 1 to 51, respectively, in order from top to bottom) are given. The chemical modifications in EON are as follows: m5Ue is 2'-MOE-modified 5-methyluridine; Ge is 2'-MOE-modified guanosine; m5Ce is 2'-MOE-modified 5-methylcytidine; Gm, Am, Um, and Cm are 2'-OMe-modified guanosine, adenosine, uridine, and cytidine, respectively; Af, Uf, Gf, and Cf are 2'-F-modified adenosine, uridine, guanosine, and cytosine, respectively; Zd is a cytidine analog, also known as a Benner base-bearing nucleoside (as further described herein), with a deoxy moiety at the 2' ribose position (=DNA); C2f is 2',2'-difluoro-modified cytidine; Ad and Cd are deoxyadenosine and deoxycytidine, respectively; asterisk "*" indicates a phosphorothioate (PS) linkage; "!" indicates a PNdmi linkage; and "^" indicates a methylphosphonate (MP) linkage. All other linkages are phosphodiester linkages.

[0013] Figure 2 Editing efficiency over time in an in vitro biochemical editing assay using EON RM4700 to RM4726 (as indicated) is shown and divided into three panels (A), (B), and (C) for ease of viewing.

[0014] Figure 3 Shown are the percentages of editing determined in EBV-immortalized B lymphocytes from a donor homozygous for the C282Y (c.845G>A) mutation in the HFE gene (GM14715) after exposure to 5 μM EON RM4700 to RM4723 and RM4725 (as indicated) for 72 hours in the presence of 1 μM saponin AG1856. Negative controls were scrambled oligonucleotides, untreated (NT) samples, samples without reverse transcriptase (-RT), and water controls.

[0015] Figure 4Shown are the percentages of editing determined after 72 hours of exposure to 5 μM EON RM4700 to RM4723 and RM4725 (as indicated) in EBV-immortalized B lymphocytes from a donor (GM14631) homozygous for the C282Y (c.845G>A) mutation in the HFE gene, in the presence of 1 μM saponin AG1856. Negative controls were samples using scrambled oligonucleotides, untreated (NT) samples, samples treated with AG1856 saponin alone, samples without reverse transcriptase (-RT), and a water control.

[0016] Figure 5 The human HFE target RNA sequence (5' to 3'; SEQ ID NO: 52) is shown at the top, with the target adenosine in bold and the tyrosine codon underlined. Figure 1 The sequences (also 5' to 3') of 49 other EONs (SEQ ID NOs: 66 to 164) designed to edit target adenosine are shown in FIG. Figure 1 As given, wherein Gd is deoxyguanosine, Ae is 2'-MOE modified adenosine, and L004 is a 3' attached tridentate GalNAc moiety as described in WO2022 / 271806.

[0017] Figure 6 The percentage of editing (black bar on the left side of the y-axis) was determined in EBV immortalized B lymphocytes from a donor homozygous for the C282Y (c.845G>A) mutation in the HFE gene, in the presence of 2 μM saponin AG1856, after exposure to EON as described below for 72 hours. Negative controls were untreated (NT) samples and saponin alone. RM4717 was taken from Figure 1 and Figure 3 (HFE-34) positive control EON. Hepcidin expression levels in these cells after EON treatment were determined in the same samples and are plotted on the open bars to the right of the y-axis. DETAILED DESCRIPTION

[0018] The present disclosure describes another method that can target the p.Cys282Tyr (C282Y) mutation in HFE to produce wild-type HFE protein and potentially restore normal iron processing, and thereby prevent, improve or treat hereditary HH. This technology is generally referred to as RNA editing. Disclosed herein are oligonucleotides that can be used to specifically deaminize specific target adenosines in (human) HFE transcripts (pre-mRNA and / or mRNA) in vivo (preferably using endogenous deaminases) to produce HFE proteins that restore their hepcidin regulatory function. To date, the most common mutation found in the HFE gene and that can lead to iron overload in homozygous genotypes is the C282Y mutation mentioned above, but the RNA editing technology disclosed herein is also applicable to other target adenosines within HFE that can be targeted to restore their function or even cause gain-of-function effects.

[0019] RNA editing is a natural process by which eukaryotic cells change the sequence of their RNA molecules, often in a site-specific and precise manner, thereby increasing the pool of RNA encoded by the genome by several orders of magnitude. RNA editing enzymes have been described for eukaryotic species throughout the animal and plant kingdoms, and these processes play an important role in managing cellular homeostasis in metazoans from the simplest life forms, such as Caenorhabditis elegans, to humans. Examples of RNA editing include the conversion of adenosine (A) to inosine (I) and cytidine (C) to uridine (U), which occur through enzymes called adenosine deaminases acting on RNA (ADARs) and APOBEC / AIDs (cytidine deaminases acting on RNA), respectively.

[0020] ADARs are multidomain proteins consisting of a catalytic domain and two to three double-stranded RNA recognition domains (depending on the enzyme in question). Each recognition domain recognizes a specific double-stranded RNA (dsRNA) sequence and / or conformation. The catalytic domain plays a role in recognizing and binding to a portion of the dsRNA helix, although the key function of the catalytic domain is to convert an A to an I near a predetermined position in the target RNA by deaminating the nucleobase. The cell's translation machinery reads inosine as guanosine, meaning that if the edited adenosine is in the coding region of an mRNA or pre-mRNA, it can recode the protein sequence. The A-to-I conversion can also occur in the 5' noncoding sequence of the target mRNA, creating a new translation start site upstream of the original start site, resulting in an N-terminally extended protein, or in the 3' UTR or other non-coding regions of the transcript, potentially affecting RNA processing and / or stability. Furthermore, the A-to-I conversion can occur within splicing elements within introns or exons of the pre-mRNA, thereby altering the splicing pattern. As a result, exons may be included or skipped. Enzymes that catalyze the deamination of adenosine belong to the ADAR enzyme family, which includes the human deaminases hADAR1 and hADAR2, as well as hADAR3. However, deaminase activity has not yet been demonstrated for hADAR3.

[0021] The use of oligonucleotides to edit target RNA using adenosine deaminase has been described (e.g., Woolf et al. 1995. PNAS 92:8298-8302; Montiel-Gonzalez et al. 2013. PNAS 110(45):18285-18290; Vogel et al. 2014. Angewandte Chemie Int Ed 53:267-271). A disadvantage of the method described by Montiel-Gonzalez et al. (2013) is that a fusion protein consisting of the boxB recognition domain of the bacteriophage λN protein genetically fused to the adenosine deaminase domain of a truncated native ADAR protein is required. This requires that the target cells be either transduced with the fusion protein (a major hurdle) or transfected with a nucleic acid construct encoding the engineered adenosine deaminase fusion protein for expression. Ibid., the system described by Vogel et al. (2014) suffers from similar drawbacks, as it is unclear how to apply the system without first having to genetically engineer the ADAR and then transfect or transform cells containing the target RNA to provide the cells with the engineered protein. US 9,650,627 describes a similar system. Ibid., the oligonucleotides of Woolf et al. (1995), which are 100% complementary to the target RNA sequence, suffer from a severe lack of specificity: almost all adenosines in the target RNA strand complementary to the antisense oligonucleotide are edited.

[0022] It is known that ADAR can act on any dsRNA. Through a process sometimes referred to as "promiscuous editing", the enzyme edits multiple A's in dsRNA. Therefore, it is necessary to circumvent this promiscuous editing and target only specific adenosines in the target RNA molecule to make it applicable to treatment. As above, Vogel et al. (2014) showed that such off-target editing can be inhibited by using 2'-O-methyl (2'-OMe) modified nucleosides at positions opposite to the adenosines that should not be edited in the oligonucleotide, and using unmodified nucleosides directly opposite to the specifically targeted adenosines on the target RNA. However, the specific editing effect at the target nucleotide has not yet been shown to be produced without the use of a recombinant ADAR enzyme with a covalent bond to AON. Several publications have shown that it is feasible to recruit endogenous ADARs (therefore without the need for exogenous and / or recombinant sources) while maintaining specificity, where a single adenosine in the target RNA molecule can be targeted and deaminated to inosine. WO2016 / 097212 discloses antisense oligonucleotides (AONs) for RNA targeted editing, wherein the AON is characterized by a sequence complementary to the target RNA sequence (referred to herein as the "targeting moiety"), and the presence of a stem-loop / hairpin structure (referred to herein as the "recruiting moiety"), which is preferably not complementary to the target RNA. Such oligonucleotides are referred to as "self-looping AONs". The role of the recruitment moiety is to recruit the natural ADAR enzyme present in the cell to the dsRNA formed by hybridization of the target sequence and the targeting moiety. Due to the presence of the recruitment moiety, there is no need for a conjugated entity or the presence of a modified recombinant ADAR enzyme. WO2016 / 097212 describes the recruitment moiety as a stem-loop structure that mimics a natural substrate (e.g., GluB receptor) or a Z-DNA structure known to be recognized by the dsRNA binding domain or Z-DNA binding domain of the ADAR enzyme. The stem-loop structure can be an intermolecular stem-loop structure formed by two separate nucleic acid chains, or an intramolecular stem-loop structure formed within a single nucleic acid chain. The stem-loop structure of the recruitment part as described is an intramolecular stem-loop structure formed within the AON itself, and it is believed to attract (endogenous) ADARs. Similar systems comprising stem-loop structures for RNA editing have been described in WO2017 / 050306, WO2020 / 001793, WO2017 / 010556, WO2020 / 246560 and WO2022 / 078995.

[0023] WO2017 / 220751 and WO2018 / 041973 describe next-generation AON types, which do not include this stem-loop structure, but are (almost completely) complementary to the target region. In one embodiment, there are one or more mismatched nucleotides, wobble or protrusions between the oligonucleotide and the target sequence. The only mismatch can be located at the nucleoside site relative to the target adenosine, but in other embodiments, AON (or RNA editing oligonucleotide, abbreviated as "EON") is described as having multiple protrusions and / or wobble when attached to the target sequence region. When the sequence of EON is carefully selected so that it can attract / recruit ADAR, it seems that RNA editing in vitro, in vitro and in vivo can be achieved with EON and endogenous ADAR enzymes lacking a stem-loop structure. "Orphan nucleoside" is defined as a nucleoside in an EON that is located directly relative to the target adenosine in the target RNA molecule, and it does not carry 2'-OMe modification. Orphan nucleosides can be deoxyribonucleosides (DNA), where the remainder of the EON can still carry a 2'-O-alkyl modification (such as 2'-OMe) at the sugar entity, or the nucleotides directly surrounding the orphan nucleoside contain chemical modifications (such as DNA compared to RNA) that further improve RNA editing efficiency and / or enhance resistance to nucleases. This effect can even be further improved by using sense oligonucleotides (SONs) that "protect" the EON from degradation (described in WO2018 / 134301). The use of chemical modifications and specific structures in oligonucleotides that can be used for ADAR-mediated editing of specific adenosines in target RNAs has been the subject of many publications in this field, such as WO2019 / 111957, WO2019 / 158475, WO2020 / 165077, WO2020 / 201406, WO2020 / 211780, WO2021 / 008447, WO2021 / 020550, WO2021 / 060527, WO2021 / 117729, WO2021 / 136408, WO2021 / 182474, WO2021 / 216853, WO2021 / 242778, WO2 021 / 242870, WO2021 / 242889, WO2022 / 007803, WO2022 / 018207, WO2022 / 026928 and WO2022 / 124345.For example, the use of specific sugar moieties is disclosed in WO2020 / 154342, WO2020 / 154343, WO2020 / 154344, WO2022 / 103839 and WO2022 / 103852, while WO2011 / 005761, WO2014 / 010250, WO2014 / 012081, WO2015 / 107425, WO2017 / 015575 (HTT), WO2017 / 062862, WO2017 / 160741、WO2017 / 192664、WO2017 / 192679(DMD)、WO2017 / 198775、WO2017 / 210647、WO2018 / 067973、WO2018 / 098264, WO2018 / 223056(PNPLA3), WO2018 / 223073(APOC3), WO2018 / 223081(PNPLA3), WO2018 / 237194, WO201 9 / 032607(C9orf72)、WO2019 / 055951、WO2019 / 075357(SMA / ALS)、WO2019 / 200185(DM1)、WO2019 / 217784(DM 1), WO2019 / 219581, WO2020 / 118246(DM1), WO2020 / 160336(HTT), WO2020 / 191252, WO2020 / 196662, WO2020 / 2 The use of stereo-defined linker moieties (generally for oligonucleotides, e.g., for exon skipping, gapmers, siRNAs, or specifically for RNA editing oligonucleotides directed to multiple target sequences) is described in WO 19981 (USH2A), WO 2020 / 219983 (RHO), WO 2020 / 227691 (C9orf72), WO 2021 / 071788 (C9orf72), WO 2021 / 071858, WO 2021 / 178237 (MAPT), WO 2021 / 234459, WO 2021 / 237223, and WO 2022 / 099159. In addition to these disclosures, a large number of publications relate to targeting specific RNA target molecules or specific adenosines in such RNA target molecules, whether for the purpose of repairing mutations that lead to premature stop codons or other disease-causing mutations.Examples of such disclosures targeting adenosine in specific target RNA molecules are: WO2020 / 157008 and WO2021 / 136404 (USH2A); WO2021 / 113270 (APP); WO2021 / 113390 (CMT1A); WO2021 / 209010 (IDUA, Hurler syndrome); WO2021 / 231673 and WO2021 / 242903 (LRRK2); WO2021 / 231675 (ASS1); WO2021 / 231679 (GJB2); WO2019 / 071274 and WO2021 / 231680 (MECP2); WO2021 / 231685 and WO2021 / 231692 (OTOF, autosomal recessive non-syndromic hearing loss); WO2021 / 231691 (XLRS); WO2021 / 231698 (argininosuccinate lyase deficiency); WO2021 / 130313 and WO2021 / 231830 (ABCA4); and WO2021 / 243023 (SERPINA1).

[0024] Disclosed herein are EONs that can produce (or trigger) RNA editing of a target adenosine in human HFE transcripts (pre-mRNA and / or mRNA), whereby the resulting HFE protein restores its wild-type function (e.g., hepcidin regulation). In a preferred aspect, the EON causes the deamination of the adenosine present at position 845 of the mutant mRNA, thereby producing inosine. In other words, the UAC codon encoding the tyrosine at amino acid position 282 (mutant form) is converted to a UIC codon, which is read as UGC by the translation machinery and encodes cysteine ​​(wild-type). In another embodiment, the EONs herein cause the deamination of another adenosine present in the HFE transcript, which can be any adenosine that, when deaminated to inosine, produces a gain-of-function HFE protein. Other mutations may be present in the HFE gene (and transcript) that can be targeted by RNA editing to restore normal HFE function. As disclosed herein, a preferred targeted mutation is the c.845G>A mutation in the human HFE gene, which results in the p.Cys282Tyr HFE protein mutation.

[0025] In a preferred embodiment, the EON herein is a single-stranded (ss) oligonucleotide comprising an "orphan nucleotide" located opposite the target adenosine, wherein the orphan nucleotide is chemically modified as disclosed herein, and wherein the remainder of the oligonucleotide is also chemically modified as disclosed herein to prevent its nuclease degradation. In another embodiment, the EON herein relates to any type of oligonucleotide or heteroduplex oligonucleotide complex that may or may not be bound to a hairpin structure (internally or at the end), may be bound to an ADAR or its catalytic domain, or wherein the oligonucleotide is expressed by a vector (such as AAV), or wherein the oligonucleotide is in a circular form. It should be understood that any type of oligonucleotide-based RNA editing is encompassed by the present invention if it involves the deamination of a nucleotide in the HFE transcript (preferably a mutation that causes C282Y) and results in restoration of HFE function.

[0026] In a preferred aspect, the EON herein is a "naked" oligonucleotide containing multiple chemical modifications in the ribose, base and / or internucleoside linkages of one or more nucleotides within the sequence, which can hybridize to the HFE transcript or a portion thereof containing the target adenosine and can recruit endogenous ADARs to deaminize the target adenosine.

[0027] It is noteworthy that when the EON comprises a chemical modification as detailed herein, it can still be delivered by means of a delivery vehicle. Suitable delivery vehicles are, for example, lipid nanoparticles (LNPs), which are nanosized lipid vesicles that carry the EON herein and assist in target cell delivery. If LNPs or any other similar type of carrier are used, the EON is still considered naked because it is not transcribed from an encoding polynucleotide (e.g., in the case where the EON is not considered "naked," but rather a transcribed plasmid or vector). Therefore, even if the chemically modified AON is encapsulated by a carrier (preferably LNP), it is still considered naked because, per se, it is prepared in a laboratory environment and then encapsulated in a carrier using methods known to those skilled in the art. The present disclosure also relates to a delivery vehicle, preferably LNP, comprising a chemically modified AON as disclosed herein, even more preferably as disclosed in any one of SEQ ID NOs: 1 to 51 and 66 to 164. It is understood by those skilled in the art that when using a delivery moiety or attachment of an EON (such as a GalNAc moiety for targeting hepatocytes in the liver, e.g., as Figure 5 When the GalNAc moiety L004 is present in the EON, the EON is still considered naked, as is the case when the GalNAc-EON is encapsulated in a delivery vehicle such as an LNP.

[0028] Implementation Plan

[0029] The present disclosure provides an EON capable of forming a ds complex with a region of an endogenous human HFE transcript molecule in a cell, wherein the region of the HFE transcript molecule comprises a target adenosine, and wherein the ds complex can recruit an endogenous ADAR enzyme to deaminate the target adenosine to inosine, thereby editing the HFE transcript molecule. In a preferred aspect, the HFE transcript molecule is a pre-mRNA or mRNA molecule. In one embodiment, the cell is a human liver cell, preferably a hepatocyte. In one embodiment, the target adenosine is a c.845G>A mutation in the HFE gene. In one embodiment, deamination of the target adenosine results in restoration of wild-type HFE protein, although this is not required in cases where the transcript comprises a mutation other than the c.845G>A mutation. In one embodiment, the EON comprises an alternative chemical modification as outlined in detail herein. Figure 1 or Figure 5 In one embodiment, the corresponding EON comprises the nucleotide sequence of any one of the EON sequences described in or consisting of. Figure 1 or Figure 5 In one embodiment, at least one nucleotide comprises one or more non-natural chemical modifications, or one or more additional non-natural chemical modifications in the ribose, linkage, or base moiety, provided that the orphan nucleotide is not a cytidine comprising a 2'-OMe ribose substitution, which is the nucleotide directly opposite the target adenosine in the EON. In one embodiment, the orphan nucleotide is a cytidine analog, such as a deoxynucleotide comprising a 6-amino-5-nitro-3-yl-2(1H)-pyridone nucleobase (also known as a Benner base). In one embodiment, the orphan nucleotide is a uridine analog, such as a deoxynucleotide comprising an isourea nucleobase. In one embodiment, the EON comprises one or more mismatches, wobbles, or bulges, wherein a single mismatch may be present when the target adenosine in the EON has a relative cytidine. If the orphan nucleotide is a cytidine, it does not comprise a 2'-OMe ribose substitution. In one embodiment, the one or more additional modifications in the linking moiety are each independently selected from PS, phosphonoacetate, phosphorodithioate, MP, sulfonylphosphoramidate or PNdmi internucleotide linkages. In one embodiment, the one or more additional modifications in the ribose moiety are mono- or di-substitutions at the 2', 3' and / or 5' positions of the ribose, each of which is independently selected from: -OH; -F; substituted or unsubstituted, linear or branched lower (C1-C1 10)Alkyl, alkenyl, alkynyl, alkaryl, allyl or aralkyl, which may be interrupted by one or more heteroatoms; -O-, S- or N-alkyl; -O-, S- or N-alkenyl; -O-, S- or N-alkynyl; -O-, S- or N-allyl; -O-alkyl-O-alkyl; -methoxy; -aminopropoxy; -methoxyethoxy; -dimethylaminooxyethoxy; and -dimethylaminoethoxyethoxy.

[0030] In one embodiment, the present disclosure provides a vector, preferably a viral vector, more preferably an AAV vector, comprising a nucleic acid molecule encoding an EON herein. In one embodiment, the present disclosure provides a pharmaceutical composition comprising an EON herein or a vector herein, and a pharmaceutically acceptable carrier. In one embodiment, the present disclosure provides an EON herein, a vector herein, an LNP formulation herein, or a pharmaceutical composition herein for treating an iron overload disorder (preferably HFE hemochromatosis). In one embodiment, the present disclosure provides the use of an EON herein, a vector herein, or an LNP formulation herein in the preparation of a medicament for treating an obstacle associated with iron overload (preferably HFE hemochromatosis).

[0031] In one embodiment, the present disclosure provides a method for editing an HFE polynucleotide, the method comprising contacting the HFE polynucleotide with an EON capable of achieving ADAR-mediated adenosine to inosine conversion of adenosine associated with iron homeostasis, thereby editing the HFE polynucleotide, preferably wherein the EON is as disclosed herein. In one embodiment, a method for treating HFE hemochromatosis in a patient in need thereof is provided, the method comprising contacting the HFE polynucleotide in the subject's cells with an EON capable of achieving ADAR-mediated adenosine to inosine conversion of adenosine associated with iron homeostasis (preferably wherein the EON is as disclosed herein), or a vector encoding the EON herein, or an LNP formulation herein, thereby treating the patient. In one embodiment, the present disclosure provides a method for treating HFE hemochromatosis, the method comprising administering a therapeutically effective amount of the EON herein, the vector herein, or the pharmaceutical composition herein to a patient in need thereof.

[0032] In one embodiment, the present disclosure provides a method for deamidating a target adenosine in an HFE pre-mRNA or mRNA molecule in a cell, the method comprising the following steps: (i) providing an EON, LNP formulation, or vector as disclosed herein to the cell; (ii) allowing the cell to take up the EON, LNP, or vector, respectively; (iii) annealing the EON to the HFE pre-mRNA or mRNA molecule; (iv) allowing an endogenous ADAR enzyme to deaminate the target adenosine in the target RNA molecule to inosine; and optionally (v) identifying the presence of inosine in the target RNA molecule. In a preferred aspect, the target adenosine is the c.845G>A mutation in human HFE pre-mRNA or mRNA. The step of identifying the presence of inosine at the position of the target adenosine preferably comprises: (a) determining the sequence of the HFE pre-mRNA or mRNA molecule; (b) assessing the presence of wild-type HFE protein; or (c) using a functional readout, preferably assessing serum or plasma ferritin concentration, or serum transferrin saturation percentage. Such assessment can be performed in vitro on a sample taken from a treated subject. For example, ferritin concentrations can be assessed before and after EON treatment to determine the level of EON activity (and, of course, RNA editing of target transcripts).

[0033] definition

[0034] The term "nucleoside" refers to a core base that is sugared with (deoxy) ribosyl, and it does not contain a phosphate group." nucleotide " is made up of nucleoside and one or more phosphate groups. Therefore, the term "nucleotide" refers to corresponding core base-(deoxy) ribosyl-phosphate joints, and any chemical modification of ribose moiety or phosphate group. Therefore, the term will include nucleotides containing locked ribosyl moieties (including 2'-4' bridges, including methylene or any other groups), non-locked nucleic acids (UNA), threose nucleic acids (TNA), nucleotides containing joints (including phosphodiester, phosphonoacetate, phosphotriester, PS, (di) thiophosphate, MP, methylphosphonothioate, aminophosphoric acid ester connections) etc. Sometimes, the terms adenosine and adenine, guanosine and guanine, cytidine and cytosine, uracil and uridine, thymine and thymidine / uridine, inosine and hypoxanthine are used interchangeably, and on the one hand refer to corresponding core bases, and on the other hand refer to nucleoside or nucleotides. Thymine (T) is also called 5-methyluracil (m 5U), and it is a derivative of uracil (U); thymine, 5-methyluracil and uracil are interchangeable throughout the document text. Similarly, thymine is also called 5-methyluracil, and it is a derivative of uridine; thymidine, 5-methyluridine and uridine are interchangeable throughout the document text. Sometimes, unless the context clearly requires differently, such as when a nucleoside is linked to an adjacent nucleoside and the connection between these nucleosides is modified, the terms "nucleobase", "nucleoside" and "nucleotide" are used interchangeably. As described herein, a nucleotide is a nucleoside plus one or more phosphate groups. The terms "ribonucleoside" and "deoxyribonucleoside", or "ribose" and "deoxyribose" are as used in the art.

[0035] Unless the context indicates otherwise, whenever oligonucleotides, oligomers, ONs, ASOs, oligonucleotide compositions, antisense oligonucleotides, AONs, (RNA) editing oligonucleotides, EONs and RNA (antisense) oligonucleotides are mentioned, both oligoribonucleotides and deoxyoligoribonucleotides are referred to. An oligonucleotide may completely lack RNA or DNA nucleotides (as they appear in nature) and may be composed entirely of modified nucleotides. Whenever "oligoribonucleotides" are mentioned, they may contain bases A, G, C, U or I. Whenever "deoxyoligoribonucleotides" are mentioned, they may contain bases A, G, C, T or I. However, the oligonucleotides of the present invention may contain a mixture of ribonucleosides and deoxyribonucleosides. When deoxyribonucleotides are used, since there is no modification at the 2' position of the sugar, the nucleotides are often abbreviated as dA, dC, dG, or T, where the "d" represents the deoxy nature of the nucleoside, while normal RNA or ribonucleosides modified at the 2' position are often abbreviated without the "d" and are often abbreviated with their respective modifications, and as explained herein.

[0036] Reference to a nucleotide in an oligonucleotide includes, for example, cytosine, 5-methylcytosine, 5-hydroxymethylcytosine, 5-formylcytosine, 5-acetylcytosine, 5-hydroxycytosine, and β-D-glucosyl-5-hydroxymethylcytosine. Reference to adenine includes N6-methyladenine, 8-oxoadenine, 2,6-diaminopurine, and 7-methyladenine. Reference to uracil includes dihydrouracil, isouracil, N3-glycosylated uracil, pseudouracil, 5-methyluracil, N1-methylpseudouracil, 4-thiouracil, and 5-hydroxymethyluracil. Reference to guanine includes 1-methylguanine, 7-methylguanosine, N2,N2-dimethylguanosine, N2,N2,7-trimethylguanosine, and N2,7-dimethylguanosine. Whenever reference is made to a nucleoside or nucleotide, ribofuranose derivatives are included, such as 2'-deoxy, 2'-hydroxy and 2'-O-substituted variants, such as 2'-OMe, and other modifications, including 2'-4' bridged variants. Whenever reference is made to an oligonucleotide, the linkage between the two mononucleotides may be a phosphodiester linkage and modifications thereof, including phosphonoacetate, phosphotriester, PS, phosphorodithioate, MP, phosphoramidate linkers, phosphoguanidine, thiophosphoguanidine, sulfophosphoramidate, and the like.

[0037] The term "comprising" encompasses "including" as well as "consisting of", e.g. a composition "comprising X" may consist of X alone, or may include some additional substances, e.g. X + Y. The term "about" in relation to a value x is optional and means, for example, that x + 10%.

[0038] The word "substantially" does not exclude "completely", for example, a composition "substantially free of Y" may be completely free of Y. Where relevant, the word "substantially" may be omitted from the definition of the present invention.

[0039] As used herein, the term "complementary" refers to the fact that an EON hybridizes to a second nucleic acid strand under physiological conditions (e.g., when an oligonucleotide (= guide oligonucleotide) as a first nucleic acid strand forms a heteroduplex RNA editing oligonucleotide complex or HEON with another complementary nucleic acid strand, or when it forms a double-stranded complex with a target RNA sequence). The term does not necessarily mean that every nucleotide in a nucleic acid strand is perfectly paired with its relative nucleotide in the relative sequence. In other words, although an EON may be complementary to a target sequence, there may be mismatches, wobbles, and / or protrusions between the oligonucleotide and the target sequence, while under physiological conditions, the EON still hybridizes to the target sequence such that the cellular RNA editing enzyme can edit the target adenosine. Thus, the term "substantially complementary" also refers to the fact that, despite the presence of mismatches, wobbles, and / or protrusions, the EON still has enough matching nucleotides between the EON and the target sequence such that the EON hybridizes to the target RNA under physiological conditions. As shown herein, an EON may be complementary to a target sequence if it is able to hybridize to its target under physiological conditions, but may also contain one or more mismatches, wobbles, and / or protrusions.

[0040] The term "downstream" in relation to a nucleic acid sequence means further along the sequence in the 3' direction; the term "upstream" means the opposite. Thus, in any sequence encoding a polypeptide, the start codon is upstream of the stop codon in the sense strand and downstream of the stop codon in the antisense strand.

[0041] Reference to "hybridization" generally refers to specific hybridization and excludes nonspecific hybridization. Specific hybridization can occur using techniques well known in the art under experimental conditions selected to ensure the most stable interaction between the probe and the target when the probe and the target have at least 70%, preferably at least 80%, and more preferably at least 90% sequence identity.

[0042] As used herein, the term "mismatch" refers to the relative nucleotides in a double-stranded RNA complex that do not form a perfect base pair according to the Watson-Crick base pairing rules. Traditionally, mismatched nucleotides include GA, CA, UC, AA, GG, CC, and UU pairs. In some embodiments, EON comprises less than four mismatches with the target sequence, such as 0, 1, or 2 mismatches. "Wobble" base pairs are GU, IU, IA, and IC base pairs. Although G:G pairing is considered a mismatch, this does not necessarily mean that the interaction is unstable, which means that Hoogsteen base pairing may be considered a mismatch based on the source of the nucleotide, but still relatively stable. Based on the present invention, the term "mismatch" may be somewhat outdated. For example, a single G:G pairing in a double-stranded RNA can be very stable, but is still defined as a mismatch.

[0043] The term "splicing mutation" refers to mutations in genes encoding pre-mRNA in which the splicing machinery is dysfunctional because the splicing of introns from exons is disturbed and, due to the aberrant splicing, subsequent translation is out of frame, leading to premature termination of the encoded protein. This shortened protein is often rapidly degraded and lacks any functional activity.

[0044] The EONs herein (and the complementary nucleic acid strands when two oligonucleotides form an HEON) can be almost entirely chemically modified, for example by providing the nucleotides with 2'-OMe substitutions, 2'-F substitutions, or 2'-O-methoxyethyl (2'-MOE) substitutions on the ribose moiety. The orphan nucleotides in the EON are preferably cytidine or an analog thereof (such as a nucleotide bearing a Benner base), or uridine or an analog thereof (such as isouridine), and / or in one embodiment, contain a di-F modification at the 2' position of the sugar; in another embodiment, contain a deoxyribose (2'-H, DNA); and in yet another embodiment, at least one, and in another embodiment, neither, of the two adjacent nucleotides flanking the orphan nucleotide contain a 2'-OMe modification. Full modification (where all nucleotides of the oligonucleotide carry a 2'-OMe modification and a natural base) results in an oligonucleotide that is non-functional in terms of RNA editing (as known in the art), presumably because it would hinder ADAR activity at the target site. Typically, adenosine in a target RNA can be protected from editing by providing a counter nucleotide with a 2'-OMe group (at least in the absence of other chemical substitutions or modifications within the nucleotide), or by providing guanine or adenine as the counter base (as these two nucleobases also reduce editing of the counter adenosine).

[0045] Various chemistries and modifications are known in the oligonucleotide field and can be readily used according to the present disclosure. Conventional internucleoside linkages between nucleotides can be altered by monothio or dithio alterations of phosphodiester bonds, producing PS esters or phosphorodithioates, respectively. Other modifications of internucleoside linkages are also possible, including amidation and peptide linkers.

[0046] 53, 54, 55, 56, 57, 58, 59, or 60 nucleotides.

[0047] RNA editing entities known in the art (such as human ADAR enzymes) edit dsRNA structures with different specificities, depending on several factors. One of the important factors is the degree of complementarity of the two chains that constitute the dsRNA sequence. The perfect complementarity of the two chains usually causes the catalytic domain of human ADAR to deaminize adenosine in a non-discriminatory manner, reacting with any adenosine encountered. The specificity of hADAR1 and 2 can be improved by introducing chemical modifications and / or ensuring that there are several mispairings in the dsRNA (which may help to locate the dsRNA binding domain in a manner not yet clearly defined). In addition, the deamination reaction itself can be enhanced by providing an oligonucleotide comprising a mispairing relative to adenosine to be edited. According to the instructions in this application, those skilled in the art will be able to design the complementary part of the oligonucleotide according to their needs.

[0048] The RNA editing protein present in the most notable cell used with EON herein is human ADAR2. It will be understood by those of ordinary skill in the art that the degree to which the editing entity in the cell is redirected to other target sites can be adjusted by changing the affinity of the first nucleic acid chain to the editing molecule recognition domain. Accurate modification can be determined by repeated trials and / or by a computational method based on the structural interaction between the recognition domain of EON and the editing molecule. In addition, or alternatively, the degree of recruiting and redirecting the editing entity resident in the cell can be regulated by the administration and dosing regimen of EON. This is to be determined by an experimenter (in vitro) or a clinician (usually in Phase I and / or Phase II clinical trials).

[0049] The present disclosure also relates to modifying target RNA sequences in eukaryotic, preferably metazoan, more preferably mammalian, and most preferably human cells. The present disclosure is particularly suitable for modifying RNA sequences in cells and tissues in which HFE is expressed and in which the protein functions. The pathogenic mechanism by which mutated HFE gene products affect iron homeostasis is not yet fully understood. Hepcidin, produced in the liver, is the "master regulator" of iron homeostasis in the body, and its main task is to inactivate ferroportin. Ferroportin plays an important role in regulating the outward transport (efflux) of iron across the cell membrane in enterocytes, hepatocytes and macrophages. The normal HFE and transferrin receptor 2 complex on the cell membrane of hepatocytes stimulates the production / activation of hepcidin, which then inhibits intestinal iron uptake. In hemochromatosis, due to a defect in the HFE complex, the production / activation of hepcidin is reduced, resulting in increased intestinal iron uptake, which is largely independent of the body's iron status. Therefore, HH is characterized by low plasma hepcidin concentrations, which is called "hepcidin deficiency." Intracellular iron accumulation can cause oxidative stress, DNA damage, cell necrosis and fibrosis over time. This development is commonly seen in the liver, where the initial fibrosis can eventually progress to cirrhosis. Since HFE is mainly produced in liver cells and plays an important role, the preferred target cells of EON herein are liver cells, more preferably liver cells. Target cells can be located in vitro, in vitro or in vivo. An advantage of EON disclosed herein is that they can be used with in situ cells in living organisms or with cells in culture. In some embodiments, cells are processed in vitro and then introduced into living organisms (e.g., reintroduced into the organism of their original source). EON herein can also be used to edit target RNA sequences from transplants or in cells in so-called organoids (e.g., liver tissue organoids). Organoids can be considered as three-dimensional in vitro derived tissues, but are driven using specific conditions to produce separate isolated tissues. In a therapeutic setting, they are useful because they can be derived from the patient's cells in vitro, and then organoids can be reintroduced into the patient as autologous materials that are less likely to be rejected than normal transplants.

[0050] Without wishing to be bound by theory, RNA editing by hADAR2 is thought to occur in the nucleus during transcription or splicing, or on primary transcripts in the cytoplasm (e.g., where mature mRNA, miRNA, or ncRNA can undergo editing).

[0051] It should be clear that if the deamination of any adenosine within the HFE transcript results in an enhancement or restoration of HFE protein function, the targeted editing according to the present disclosure can be applied to that adenosine. However, as outlined herein, it is preferred to target the adenosine at position 845 in the mutant HFE transcript product (=c.845G>A mutation) to produce a change from a UAC codon (encoding tyrosine) to a UIC (or UGC, encoding cysteine). In general, RNA editing can be used to produce RNA sequences with different properties. Such properties can be coding properties (producing proteins with different sequences or lengths, resulting in changes in protein properties or functions), or binding properties (leading to inhibition or overexpression of the RNA itself or the target or binding partner; the entire expression pathway can be changed by recoding the miRNA or its homologous sequence on the target RNA). Protein function or localization can be arbitrarily changed by functional domains or recognition motifs (including but not limited to signal sequences, targeting or localization signals, recognition sites for proteolytic cleavage or co-translational or post-translational modification, catalytic sites of enzymes, binding sites for binding partners, signals for degradation or activation, etc.). These and other forms of RNA and protein "engineering" are encompassed by the present invention, whether for the purpose of preventing, delaying, or treating disease, or for any other purpose in medicine or biotechnology, as diagnostic, prophylactic, therapeutic, research tools, or otherwise. Thus, any RNA editing of a target adenosine in the HFE transcript that results in improved or restored HFE protein function is encompassed by the present invention.

[0052] The present disclosure opens up a whole new field of using gene editing technology to treat iron overload or HH.Gene editing technology is not particularly limited.Suitable technologies include known gene therapy technologies, which include DNA editing technologies such as CRISPR / Cas, ZFN, TALEN and large-range nucleases, and preferred RNA editing technologies, such as ADAR-mediated editing technologies as further described in detail herein.

[0053] The amount, dose, and dosing schedule of the EON to be administered can vary depending on the cell type, the disease to be treated, the target population, the route of administration (e.g., systemic versus local), the severity of the disease, and the acceptable level of side effects, but these can and should be assessed through trial and error during in vitro studies, preclinical, and clinical trials. Trials are particularly straightforward when the modified sequence results in readily detectable phenotypic changes or changes in a designated biomarker (level or activity). Higher doses of EON may compete for binding to ADARs within the cell, thereby depleting the amount of entities free to participate in RNA editing, but routine dosing trials will reveal any such effects for a given EON and a given target.

[0054] A suitable experimental technique involves delivering EON to a cell line or test organism, and then collecting biopsy samples at different time points thereafter. The sequence of the target RNA can be assessed in a biopsy sample, and the ratio of cells with modification can be easily tracked. Information can be retained after the test is performed once, and future delivery can be performed without collecting a biopsy sample. Therefore, the method of the present invention can include the presence of the desired change in the target RNA sequence of the identification cell, thereby verifying whether the target RNA sequence has been modified. This step generally involves sequencing the relevant portion of the target RNA or its cDNA copy (or when the target RNA is a precursor mRNA, a cDNA copy of its splicing product) as discussed above, and therefore sequence changes can be easily verified. Alternatively, changes in protein function can be assessed, for example, by measuring or evaluating serum or plasma ferritin concentration or serum transferrin saturation percentage before and / or after treatment, or evaluating any other potential marker, the measurement preferably being performed in vitro on a sample obtained from a treated subject.

[0055] After RNA editing occurs in a cell, the modified RNA may become diluted over time, for example due to cell division, limited half-life of the edited RNA, etc. Therefore, in practical therapeutic terms, the methods of the present invention may involve repeated delivery of EONs until sufficient target RNA is modified to provide a tangible benefit to the patient and / or maintain the benefit over time.

[0056] The EON herein is particularly suitable for therapeutic use, and therefore the present disclosure also relates to a pharmaceutical composition comprising the EON herein, or a vector or plasmid encoding the EON herein, and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutically acceptable carrier can simply be a saline solution. This can be usefully isotonic or hypotonic, especially for pulmonary delivery. The present disclosure also provides a delivery vehicle (e.g., a syringe, inhaler, nebulizer) comprising the pharmaceutical composition of the present invention.

[0057] The present disclosure also provides the EONs described herein for use in methods for repairing mutations in a target HFE RNA sequence in a mammal (preferably a human liver cell) as described herein. Similarly, the present disclosure provides the use of the EONs described herein in the preparation of a medicament for producing an alteration in a target HFE RNA sequence in a mammal (preferably a human liver cell) as described herein, thereby treating, preventing, or ameliorating diseases associated with iron overload, such as HFE hemochromatosis.

[0058] The present disclosure also provides a method for deamidating at least one specific target adenosine present in a target HFE RNA sequence, the method comprising the steps of: providing an EON as described herein to a cell; allowing the cell to take up the EON; annealing the EON to a target RNA molecule; allowing a mammalian ADAR enzyme comprising a natural dsRNA binding domain as found in the wild-type enzyme to deaminate the target adenosine in the target RNA molecule (preferably the adenosine at position 845 in the mutant HFE transcript) to inosine; and optionally identifying the presence of inosine in the RNA sequence.

[0059] The present disclosure also provides a method for deamidating at least one specific target adenosine present in a target HFE RNA sequence in a cell, the method comprising the steps of: providing a vector or plasmid encoding the EON described herein to the cell; allowing the cell to take up the vector or plasmid; annealing the EON to the target RNA molecule; allowing a mammalian ADAR enzyme comprising a natural dsRNA binding domain as found in the wild-type enzyme to deaminate the target adenosine in the target RNA molecule (preferably the adenosine at position 845 in the mutant HFE transcript) to inosine; and optionally identifying the presence of inosine in the RNA sequence.

[0060] In a preferred aspect, depending on the final deamination effect of the A to I conversion, the identification step includes the following steps: sequencing the target RNA; assessing the presence of a functional protein; assessing whether the splicing of the pre-mRNA is altered by the deamination; or using a functional readout, as the target RNA should encode a functional protein after deamination. An example is assessing ferritin or hepcidin concentrations after RNA editing. Ferritin concentration is generally considered the best biomarker of iron levels in the body. Serum transferrin saturation percentage is an indicator of blood iron content and iron supply to organs. High serum transferrin saturation is often the primary indicator of HFE hemochromatosis and can be present even when serum ferritin is still within the normal range. Therefore, identification of deamination to inosine can be a functional readout using an appropriate biomarker. Functional assessment of HFE hemochromatosis, as described herein, will generally be based on methods known to those skilled in the art. Following deamination of the target adenosine, a highly suitable method for identifying the presence of inosine is, of course, dPCR or even sequencing using methods well known to those skilled in the art. However, those skilled in the art of liver disease may also employ tests to monitor certain biomarkers associated with iron overload, as discussed above.

[0061] EON herein is suitably used in an aqueous solution (e.g., saline) or suspension optionally containing additives, excipients, and other ingredients compatible with pharmaceutical use, in a concentration range of 1 ng / ml to 1 g / ml, preferably from 10 ng / ml to 500 mg / ml, more preferably from 100 ng / ml to 100 mg / ml. Dosage range can suitably be between about 1 μg / kg and about 100 mg / kg, preferably from about 10 μg / kg to about 10 mg / kg, more preferably from about 100 μg / kg to about 1 mg / kg. Application can be by inhalation (e.g., by atomization), intranasal, oral, injection or infusion, intravenous, subcutaneous, intradermal, intramuscular, intratracheal, intraperitoneal, intrarectal, intrathecal, cisterna magna, parenteral, etc. Application can be solid form, powder, pill, gel, solution, sustained-release formulation form, or any other form compatible with pharmaceutical use in human body.

[0062] In one embodiment, the method herein comprises the following steps: administering an EON or pharmaceutical composition herein to a subject, allowing the EON to form a ds-nucleic acid complex with a target nucleic acid molecule specifically complementary thereto in the subject's cells; engaging an endogenously present adenosine deaminase (such as ADAR2); and allowing the enzyme to deaminate the target adenosine in the target nucleic acid molecule to inosine, thereby alleviating, preventing, or ameliorating a disease associated with iron overload. Diseases treatable according to this method are preferably, but not limited to, the genetic diseases listed herein, as well as any other disease in which deamination of adenosine in the HFE transcript will restore protein function in a patient in need thereof.

[0063] The RNA editing molecules present in cells are generally proteins in nature, such as the ADAR enzymes found in metazoans (including mammals). Preferably, the cell editing entity is an enzyme, more preferably an adenosine deaminase or a cytidine deaminase, still more preferably an adenosine deaminase. These are enzymes with ADAR activity. The most noteworthy are human ADARs hADAR1 and hADAR2, including any subtypes thereof. RNA editing enzymes known in the art for which oligonucleotide constructs according to the present invention can be conveniently designed include adenosine deaminases (ADARs) acting on RNA (such as hADAR1 and hADAR2 in humans or human cells) and cytidine deaminases. It is known that hADAR1 exists in two subtypes; a long 150kDa interferon-induced version and a shorter 100kDa version, the latter produced by alternative splicing from a common pre-mRNA. Therefore, the level of the 150kDa subtype available in the cell can be affected by interferon, particularly interferon gamma (IFN-γ). hADAR1 can also be induced by TNF-α. This provides an opportunity to develop combination therapies in which IFN-γ or TNF-α and EON according to the present invention are administered to patients simultaneously or subsequently in any order as a combination product or as a separate product. Certain disease conditions may have occurred simultaneously with elevated levels of IFN-γ or TNF-α in certain tissues of the patient, creating further opportunities for more specific editing of diseased tissues. One of ordinary skill in the art will appreciate that the extent to which the editing entity inside the cell is redirected to other target sites can be regulated by changing the affinity of the first nucleic acid chain for the recognition domain of the editing molecule.

[0064] Chemical modification

[0065] As described in GB 2215614.5 (unpublished), when an EON forms a so-called heteroduplex RNA editing oligonucleotide (HEON) complex with a complementary strand, all chemical modifications listed below that can be used for the EON herein can also be used for the sense strand complementary to the EON, except that the relative sense strand does not have an orphan nucleotide. Thus, modifications associated with orphan nucleotides are only relevant to the EON herein, but all other modifications are relevant to the EON herein and any (protective) sense oligonucleotide that can be used with the EON in a pharmaceutical product. This includes the use of hydrophobic moieties (such as tocopherol and cholesterol) and cell-specific ligands (such as GalNAc moieties), which have also been described herein and described in detail in GB 2215614.5 (unpublished), which can be combined with the EON or its relative strand or both.

[0066] The internucleoside linkages in the oligonucleotides herein may comprise one or more naturally occurring internucleoside linkages and / or modified internucleoside linkages. Without limitation, at least one, at least two or at least three internucleoside linkages at the 5' and / or 3' ends of the EON are preferably modified internucleoside linkages. Preferred modified internucleoside linkages are PS linkages. In one embodiment, all internucleoside linkages of the EON are modified internucleoside linkages. In one embodiment, the EON comprises a PNdmi connection connecting the most terminal nucleoside at the 5' and / or 3' ends, respectively, and the penultimate nucleoside at each of the two ends. The PNdmi connection preferably used in the EON herein has a structure of the formula:

[0067]

[0068] A common limiting factor in oligonucleotide-based therapies is the ability of the oligonucleotide to be taken up by cells (when the oligonucleotide itself is delivered, or when a "naked" oligonucleotide without a delivery vehicle is used), its biodistribution, and its resistance to nuclease-mediated degradation. Those skilled in the art will recognize that, and the art has described in detail, a variety of chemical modifications can help overcome such limitations. Examples of such currently commonly used chemical modifications are 2'-O-methyl (commonly abbreviated as 2'-OMe or 2'-O-Me), 2'-F and 2'-O-methoxyethyl (also commonly referred to as 2'-methoxyethoxy or 2'-MOE) modifications of the sugar, and the use of PS linkages between nucleosides. WO2020 / 201406 discloses the use of MP linkage modifications at certain positions around the orphan nucleotides in the first nucleic acid chain. The ribose 2' group in all nucleotides of an EON (except for the ribose moiety of orphan nucleotides, which have certain limitations regarding compatibility with RNA editing) can be independently selected from 2'-H (i.e., DNA), 2'-OH (i.e., RNA), 2'-OMe, 2'-MOE, 2'-F, or 2'-4'-linkages (e.g., locked nucleic acids (LNA)), or other ribose 1'-, 2'-, 3'-, 4'-, or 5'-substitutions. Orphan nucleotides in EONs that do not contain other chemical modifications to the ribose, base, or linkage preferably do not carry 2'-OMe or 2'-MOE substitutions, but may carry 2'-F, 2',2'-difluoro (diF), or 2'-ara-F (FANA) substitutions, or may be DNA. GB 2214347.3 (unpublished) describes modification of the 2' position of the ribose moiety of orphan nucleotides by 2',2'-disubstituted substitutions (e.g., diF), which is also applicable to the invention described herein. The 2'-4' linkage can be selected from many linkers known in the art, such as a methylene linker, an amide linker, or a constrained ethyl linker (cEt).

[0069] The present disclosure provides an EON for deaminating a target nucleotide (preferably adenosine) in a target RNA, wherein the EON is complementary to a stretch of nucleotides comprising the target adenosine in the target RNA, wherein the nucleotide in the first nucleic acid strand directly opposite the target nucleotide is an orphan nucleotide, and when the target nucleotide is adenosine, the orphan nucleotide preferably comprises a base or a modified base or a base analog (e.g., Benner base Z) having an NH moiety at a position analogous to a ring nitrogen. The nucleotides in the EON are numbered such that the orphan nucleotide is numbered 0, and the 5' nucleotide of the orphan nucleotide is numbered +1. The count further increases positively (+) toward the 5' end and negatively (-) toward the 3' end, wherein the first nucleotide 3' of the orphan nucleotide is numbered -1. The internucleoside linkages in the EON are numbered such that linkage number 0 is the 5' linkage of the orphan nucleotide, and the linkage position in the oligonucleotide increases positively (+) toward the 5' end and negatively (-) toward the 3' end.

[0070] Preferably, EON comprises one or more (chirally pure or chirally mixed) PS connections. In one embodiment, PS connections connect terminal 3,4,5,6,7 or 8 nucleotides at each end of the first nucleic acid chain. In one embodiment, EON comprises one or more phosphoramidate (PN) connections. In one embodiment, PN connections connect two nucleotides at each end of the EON.

[0071] The nucleosides in EONs can be natural nucleosides (deoxyribonucleosides or ribonucleosides) or non-natural nucleosides. It should be noted that for RNA editing (where double-stranded RNA is often a substrate for enzymes with deaminating activity (such as ADARs)), ribonucleosides are considered "natural", while deoxyribonucleosides may (for the sake of argument) be considered non-natural or modified simply because DNA does not exist in the RNA-RNA double-stranded substrate configuration. Those skilled in the art understand that when a nucleotide has a natural ribose moiety, it can still be non-naturally modified in terms of bases and / or linkages.

[0072] In addition to specific preferred chemical modifications at certain positions in the compounds herein, the compounds may also comprise or consist of one or more (additional) modifications to the nucleobases, scaffolds and / or backbone linkages, which may or may not be present in the same monomer, for example at the 3' and / or 5' positions. Scaffold modifications refer to the presence of modified forms of the ribosyl moiety (i.e., pentose moiety) as naturally occurring in RNA, such as bicyclic sugars, tetrahydropyranoses, hexoses, morpholinos, 2'-modified sugars, 4'-modified sugars, 5'-modified sugars, and 4'-substituted sugars. Examples of suitable modifications include, but are not limited to, 2'-O-modified RNA monomers, such as 2'-O-alkyl or 2'-O-(substituted)alkyl, such as 2'-OMe, 2'-O-(2-cyanoethyl), 2'-MOE, 2'-O-(2-thiomethyl)ethyl, 2'-O-butyryl, 2'-O-propargyl, 2'-O-allyl, 2'-O-(2-aminopropyl), 2'-O-(2-(dimethylamino)propyl), 2'-O- '-O-(2-amino)ethyl, 2'-O-(2-(dimethylamino)ethyl); 2'-deoxy (DNA); 2'-O-(haloalkyl)methyl, such as 2'-O-(2-chloroethoxy)methyl (MCEM), 2'-O-(2,2-dichloroethoxy)methyl (DCEM); 2'-O-alkoxycarbonyl, such as 2'-O-[2-(methoxycarbonyl)ethyl] (MOCE), 2'-O-[2-(N-methylamino)ethyl] 2'-halogenated, such as 2'-F, FANA; 2'-O-[2-(methylamino)-2-oxoethyl] (NMA); bicyclic or bridged nucleic acid (BNA) scaffold modifications, such as conformationally constrained nucleotide (CRN) monomers, locked nucleic acid (LNA) monomers, xylosyl-LNA monomers, α-LNA monomers, α- l-LNA monomer, β-d-LNA monomer, 2'-amino-LNA monomer, 2'-(alkylamino)-LNA monomer, 2'-(acylamino)-LNA monomer, 2'-N-substituted 2'-amino-LNA monomer, 2'-thio-LNA monomer, (2'-O,4'-C) constrained ethyl (cEt) BNA monomer, (2'-O,4'-C) constrained methoxyethyl (cMOE) BNA monomer, 2',4'-BNA NC (NH) monomer, 2',4'-BNA NC (NMe) monomer, 2',4'-BNA NC(NBn) monomers, ethylene-bridged nucleic acid (ENA) monomers, carba-LNA (cLNA) monomers, 3,4-dihydro-2H-pyranose nucleic acid (DpNA) monomers, 2'-C-bridged bicyclic nucleotide (CBBN) monomers, oxo-CBBN monomers, heterocyclic bridged BNA monomers (such as triazole or tetrazolyl linked), amide bridged BNA monomers (such as AmNA), urea bridged BNA monomers, sulfonamide bridged BNA monomers, bicyclic carbocyclic nucleotide monomers, TriNA monomers, α-l-TriNA monomers, bicyclic DNA (bcDNA) monomers, F-bcDNA monomers, tricyclic DNA (tcDNA) monomers A) monomers, F-tcDNA monomers, α-anomeric bicyclic DNA (abcDNA) monomers, oxetane nucleotide monomers, locked PMO monomers derived from 2'-amino LNA, guanidine bridged nucleic acid (GuNA) monomers, spirocyclopropene bridged nucleic acid (scpBNA) monomers and derivatives thereof; cyclohexenyl nucleic acid (CeNA) monomers, altriol nucleic acid (ANA) monomers, hexitol nucleic acid (HNA) monomers, fluorinated HNA (F-HNA) monomers, pyranosyl-RNA (p-RNA) monomers, 3'-deoxypyranosyl DNA (p-DNA), non-locked nucleic acid (UNA); reverse versions of any of the above monomers. All of these modifications are known to those skilled in the art.

[0073] The base sequence of the EON herein is complementary to a portion of the base sequence of the target HFE transcript (including at least one target adenosine to be deaminated to inosine (preferably adenosine at position 845)), and thus can anneal (or hybridize) with the target transcript. Base sequence complementarity can be determined using programs such as BLAST. Those skilled in the art can readily determine the conditions (temperature, salt concentration, etc.) under which the two chains can hybridize, taking into account the complementarity between the chains.

[0074] Unlike the described gapmers and their relationship to RNase decomposition and the use of such gapmers in double-stranded complexes (see, for example, EP 3954395 A1), the EONs herein do not contain stretches of DNA nucleotides that would make the target sequence (or sense nucleic acid strand) a target for RNase-mediated decomposition. In one embodiment, the EONs do not contain four or more consecutive DNA nucleotides anywhere in their sequence. In one embodiment, the EONs are composed of as many (chemically) modified nucleotides as possible to enhance resistance to RNase-mediated decomposition while producing the RNA editing effect as efficiently as possible. This means that the orphan nucleotides and several other nucleotides within the EON may be DNA, but there are no four or more consecutive stretches of DNA nucleotides within the EON. Therefore, the EONs herein are not gapmers. Gapmers reduce the expression of target transcripts but do not produce RNA editing of specific adenosines within the target transcripts. In principle, gapmers are ss nucleic acids consisting of a central region (a DNA gap region with at least four consecutive deoxyribonucleotides) and wing regions directly located at their 5' end (5' wing region) and 3' end (3' wing region). In contrast, an EON herein can be any oligonucleotide that produces an RNA editing effect (wherein a target adenosine in a target RNA molecule is deaminated to inosine) and is therefore as resistant as possible to RNase-mediated degradation to produce this effect.

[0075] In one embodiment, the EON (or its sense strand to which it can anneal prior to entry into the target cell) is conjugated to a hydrophobic moiety, such as palmitoyl or its analogs, cholesterol or its analogs, or tocopherol or its analogs. It is preferably conjugated to the 5' terminus. In cases where the hydrophobic moiety is conjugated to both the 5' terminus and the 3' terminus, such hydrophobic moieties may be the same or different. The hydrophobic moiety conjugated to the oligonucleotide may be conjugated directly or indirectly through another substance. When the hydrophobic moiety is conjugated directly, the conjugation may be via a covalent bond, an ionic bond, a hydrogen bond, or the like. When the hydrophobic moiety is conjugated indirectly, the conjugation may be via a linker. The linker may be a cleavable linker or a non-cleavable linker. A cleavable linker is one that is cleavable under physiological conditions, such as in cells or animals (e.g., humans). Cleavable linkers are selectively cleaved by endogenous enzymes (e.g., nucleases) or by physiological conditions specific to the body or cell site, such as pH or reducing conditions (e.g., glutathione concentration). The example of cleavable joint includes but is not limited to one or both esters and disulfide bonds in amide, ester, phosphodiester, phosphate, carbamate, and natural DNA joint. Cleavable joint also includes self-degradable joint. Non-cleavable joint refers to the joint that does not crack under physiological conditions, or the joint that cracks very slowly compared with cleavable joint, such as PS connection, the modified or unmodified deoxyribonucleoside that is connected by PS connection, the spacer that is connected by PS key and the joint consisting of modified or unmodified ribonucleoside. When joint is nucleic acid (such as DNA) or oligonucleotide, chain length is not limited. However, its length can be 2 to 20 bases, 3 to 10 bases or 4 to 6 bases generally. The length or composition of the spacer that connects part and oligonucleotide are not limited, and can include for example ethylene glycol, TEG, HEG, alkyl chain, propyl group, 6-aminohexyl or dodecyl.

[0076] The present disclosure also provides a kind of pharmaceutical composition, it comprises EON disclosed herein, and further comprises pharmaceutically acceptable carrier and / or other additives, and is soluble in pharmaceutically acceptable organic solvent etc.The dosage form of the EON or pharmaceutical composition used can depend on the obstacle to be treated and the tissue that needs to be targeted, and can be selected according to the routine procedures of this area.The pharmaceutical composition can be used by single dose administration or multiple dose administration.It can be used daily or with appropriate time intervals, and this can be determined using the common sense of this area, and can be adjusted based on the effectiveness of obstacle and active ingredient.

[0077] In one embodiment, EON comprises at least one nucleotide having a sugar moiety comprising 2'-OMe modification. In one embodiment, EON comprises at least one nucleotide having a sugar moiety comprising 2'-MOE modification. In one embodiment, EON comprises at least one nucleotide having a sugar moiety comprising 2'-F modification. In one embodiment, orphan nucleotides carry 2'-H in the sugar moiety and are therefore referred to as DNA nucleotides, even if additional modifications may be present in their bases and / or in the connection with their adjacent nucleosides. In one embodiment, orphan nucleotides carry 2'-F in the sugar moiety. In one embodiment, orphan nucleotides carry diF substitutions in the sugar moiety. In one embodiment, orphan nucleotides carry 2'-F and 2'-C-methyl in the sugar moiety. In one embodiment, orphan nucleotides comprise 2'-F in the arabinose configuration (FANA) of the sugar moiety. In one embodiment, the EON is an antisense oligonucleotide that can form a double-stranded nucleic acid complex with a target RNA molecule, wherein the double-stranded nucleic acid complex can recruit adenosine deaminase to deaminate the target adenosine in the target HFE RNA molecule, wherein the nucleotide opposite the target adenosine in the EON is an orphan nucleotide, and wherein the orphan nucleotide has the following structure:

[0078]

[0079] wherein: X is O, NH, OCH2, CH2, Se, or S; B is a nitrogenous base selected from cytosine, uracil, isouracil, N3-glycosylated uracil, pseudoisocytosine, 8-oxoadenine, and 6-amino-5-nitro-3-yl-2(1H)-pyridone; R1 and R2 are both independently selected from H, OH, F, or CH3; R3 is the 5' portion of the orphan nucleotide of EON, which consists of 7 to 30 nucleotides; and R4 is the 3' portion of the orphan nucleotide of EON, which consists of 4 to 25 nucleotides. The nucleotides 3' and / or 5' to the orphan nucleotide may be DNA, more preferably the nucleotide at the 3' (position -1).

[0080] In one embodiment, the first nucleic acid strand comprises at least one methylphosphonate (MP) internucleoside linkage according to the following structure:

[0081]

[0082] The preferred position for MP attachment in EON herein is position-2, thereby linking the nucleoside at position-1 to the nucleoside at position-2, although other positions for MP attachment are not specifically excluded.

[0083] In one embodiment, the EON comprises at least one nucleotide having a sugar moiety comprising a 2'-fluoro (2'-F) modification. The preferred position of the nucleotide carrying the 2'-F modification is position -3 in the EON, which can coexist with the same 2' modification in orphan nucleotides as discussed above.

[0084] In one embodiment, the EON comprises at least one phosphonoacetate or phosphonoacetamide internucleoside linkage.

[0085] In one embodiment, the EON comprises at least one nucleotide comprising a locked nucleic acid (LNA) ribose modification or a unlocked nucleic acid (UNA) ribose modification. In one embodiment, the EON comprises at least one nucleotide comprising a TNA ribose modification.

[0086] As known to those skilled in the art, oligonucleotides (such as EONs as described herein) are typically composed of repeating monomers. Such monomers are typically nucleotides or chemically modified nucleotides. The most common naturally occurring nucleotides in RNA are adenosine monophosphate (A), cytidine monophosphate (C), guanosine monophosphate (G), and uridine monophosphate (U). These consist of a pentose sugar, a ribose sugar, a phosphate group connected at the 5'-end by a phosphate ester, and a base connected at the 1'-end. The sugar connects the base and the phosphate and is therefore commonly referred to as the "scaffold" of the nucleotide.

[0087] Therefore, the modification of pentose is often referred to as "scaffold modification". The original pentose can be completely replaced by another part that similarly connects a base and a phosphate. Therefore, it should be understood that although pentose is usually a scaffold, the scaffold is not necessarily a pentose. Examples of scaffold modifications that can be applied to the monomers of the EON of the present invention are disclosed in WO2020 / 154342, WO2020 / 154343 and WO2020 / 154344.

[0088] In one embodiment, the EON herein may comprise one or more nucleotides with a 2'-MOE ribose modification. Furthermore, in one embodiment, the EON comprises one or more nucleotides without a 2'-MOE ribose modification, and wherein the 2'-MOE ribose modification is located at a position that does not prevent deamination of the target adenosine by an enzyme with adenosine deaminase activity. In another embodiment, the EON comprises a 2'-OMe ribose modification at a position that does not comprise a 2'-MOE ribose modification, and / or wherein the oligonucleotide comprises a deoxynucleotide at a position that does not comprise a 2'-MOE ribose modification. In one embodiment, the EON comprises one or more nucleotides comprising a 2' position comprising 2'-MOE, 2'-OMe, 2'-OH, 2'-deoxy, TNA, 2'-fluoro (2'-F), 2',2'-difluoro (diF) modification, 2'-fluoro-2'-C-methyl modification or a 2'-4'-linkage (i.e., a bridged nucleic acid, such as a locked nucleic acid (LNA or, for example, the examples mentioned in WO2018 / 007475)). In another embodiment, the other nucleic acid monomers used are arabinose nucleic acids and 2'-deoxy-2'-fluoroarabinose nucleic acids (FANA), for example, for the purpose of improving affinity. The 2'-4' linkage can be selected from linkers known in the art, such as methylene linkers or restricted ethyl linkers. Various 2' modifications are known in the art. For example, further examples are disclosed in more detail in, for example, WO2016 / 097212, WO2017 / 220751, WO2018 / 041973, WO2018 / 134301, WO2019 / 219581, WO2019 / 158475, and WO2022 / 099159. In all cases, the modification should be compatible with editing so that the EON fulfills its role as an edit-generating oligonucleotide that can form a double-stranded complex with the target RNA and recruit a deaminase that can then deaminize the target adenosine. When a monomer comprises a non-locked nucleic acid (UNA) ribose modification, the monomer can have a 2' position comprising the same modifications discussed above, such as 2'-MOE, 2'-OMe, 2'-OH, 2'-deoxy, 2'-F, 2',2'-diF, 2'-fluoro-2'-C-methyl, arabinonucleotide, FANA, or a 2'-4'-linkage (i.e., a bridged nucleic acid, such as a locked nucleic acid (LNA)).

[0089] Base (sometimes referred to as core base) is generally adenine, cytosine, guanine, thymine or uracil, or its derivatives. Base (sometimes referred to as core base) is defined as the part that can be combined with another core base by hydrogen bond, polarized bond (such as by CF part) or aromatic electron interaction. Cytosine, thymine and uracil are pyrimidine bases, and are usually connected to support by its 1-nitrogen. Adenine and guanine are purine bases, and are usually connected to support by its 9-nitrogen. As used in this article, the term "adenine", "guanine", "cytosine", "thymine", "uracil" and "hypoxanthine" refer to the core base itself. The term "adenosine", "guanosine", "cytidine", "thymidine", "uridine" and "inosine" refer to the core base connected to (deoxy) ribosyl sugar.

[0090] The nucleobase in the EON herein can be adenine, cytosine, guanine, thymine or uracil, or any other moiety capable of interacting with another nucleobase through hydrogen bonding, polarized bonding (such as CF) or aromatic electronic interactions. The nucleobase at any position in the nucleic acid chain can be a modified form of adenine, cytosine, guanine or uracil, such as hypoxanthine (the nucleobase in inosine), pseudouracil, pseudocytosine, isouracil, N3-glycosylated uracil, 1-methylpseudouracil, orotic acid, agmatidine, lysidine, 2-thiouracil, 2-thiothymine, 5-substituted pyrimidines (e.g., 5-halouracil, 5-halomethyluracil, 5-trifluoromethyluracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-formyluracil) , 5-aminomethylcytosine, 5-formylcytosine), 5-hydroxymethylcytosine, 7-deazaguanine, 7-deazaadenine, 7-deaza-2,6-diaminopurine, 8-aza-7-deazaguanine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, 8-oxoadenine, 3-deazapurine (such as 3-deazaadenosine), pseudoisocytosine, N4-ethylcytosine, N2-cyclopentylguanine, N2-cyclopentyl-2-aminopurine, N2-propyl-2-aminopurine, 2,6-diaminopurine, 2-aminopurine, G-clamp and its derivatives, Super A, Super T, Super G, amino-modified nucleobases or their derivatives; and degenerate or universal bases, such as 2,6-difluorotoluene, or deletions such as abasic sites (e.g., 1-deoxyribose, 1,2-dideoxyribose, 1-deoxy-2-O-methylribose, azaribose).

[0091] In one embodiment, the nucleotide analog is an analog of a nucleic acid nucleotide. In one embodiment, the nucleotide analog is an analog of adenosine, guanosine, cytidine, thymidine, uridine, deoxyadenosine, deoxyguanosine, deoxycytidine, deoxythymidine, or deoxyuridine. In one embodiment, the nucleotide analog is not guanosine or deoxyguanosine. In one embodiment, the nucleotide analog is not a nucleic acid nucleotide. In one embodiment, the nucleotide analog is not adenosine, guanosine, cytidine, thymidine, uridine, deoxyadenosine, deoxyguanosine, deoxycytidine, deoxythymidine, or deoxyuridine.

[0092] Nucleotide is usually connected to adjacent nucleotides through the condensation of its 5'-phosphate moiety and the 3'-hydroxyl moiety of adjacent nucleotide monomers. Similarly, its 3'-hydroxyl moiety is usually connected to the 5'-phosphate of adjacent nucleotide monomers. This forms a phosphodiester bond. Phosphodiester and support form an alternating copolymer. Bases are grafted on this copolymer, i.e., grafted on the support moiety. Due to this characteristic, the alternating copolymer formed by the support connection of the oligonucleotide is generally referred to as the "main chain" of the oligonucleotide. Since the phosphodiester bond connects adjacent monomers together, they are generally referred to as "main chain connection". It should be understood that when the phosphate group is modified so that it is replaced by a similar part (such as PS), this type of part is still referred to as the main chain connection of the monomer. This is referred to as "main chain connection modification". In general, the main chain of the oligonucleotide comprises alternating supports and main chain connections.

[0093] The EON herein may comprise a linkage modification. The linkage modification may be, but is not limited to, a modified version of a phosphodiester present in RNA, such as PS, chirally pure PS, (R)-PS, (S)-PS, MP, chirally pure methylphosphonate, (R)-methylphosphonate, (S)-methylphosphonate, phosphoguanidine (such as PNdmi), chirally pure phosphoguanidine, (R)-phosphoguanidine, (S)-phosphoguanidine, phosphorodithioate (PS2), phosphoacetate (PACE), phosphonoacetamide (PACA), thiophosphonoacetate, thiophosphonoacetamide, methylphosphorothioate, methylphosphonothioate, PS prodrug, alkylated PS, H-phosphonate, ethyl phosphate, ethyl PS, boranophosphate, borane PS, methylborane phosphate, methylborane PS, methylborane phosphonate, methylborane phosphorothioate, phosphate, phosphotriester, aminoalkylphosphotriester and derivatives thereof. Other modifications include phosphoramidite, phosphoramidate, N3'→P5' phosphoramidate, phosphorodiamidate, phosphorothioate, sulfamate, diethylenesulfoxide, amide, sulfonate, siloxane, sulfide, sulfone, methylacetyl, alkenyl, methylenehydrazine, sulfonamide, triazole, oxalyl, carbamate, methyleneimino (MMI) and thioacetamide nucleic acid (TANA); and their derivatives. Also included are various salts, mixed salts and free acid forms, as well as 3'→3' and 2'→5' linkages.

[0094] In one embodiment, EON comprises the replacement of one of non-bridging oxygen in phosphodiester connection.This modification can make base pairing unstable slightly, but can significantly increase the resistance to nuclease degradation.Preferred nucleotide analogs or equivalents include PS, phosphonoacetate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, H-phosphonate, methylphosphonate and other alkylphosphonates (including 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates), phosphinates, phosphoramidate (including 3'-aminophosphoramidate and aminoalkylphosphoramidate), thiophosphoramidate, thioalkylphosphonates, thioalkylphosphotriester, selenophosphate or borane phosphate.Particularly preferably, modified internucleoside connection containing PS.These non-naturally occurring modifications to connection are many chiral (such as PS), which means that there are Rp and Sp configurations well known by persons skilled in the art.In one embodiment, the chirality that PS connects is controlled, which means that each is Rp configuration or Sp configuration in connection, taking the preferred one. The selection of Rp or Sp configuration at a specific attachment position may depend on the target sequence and the efficiency of binding and induction to provide RNA editing. However, if not particularly desired, the composition may include AONs having both Rp and Sp configurations at certain specific attachment positions as active compounds. Mixtures of such AONs are also feasible, where certain positions preferably have one of the configurations, while other positions are unimportant.

[0095] Likewise, in all cases, the modification should be compatible with editing so that the EON fulfills its role as an oligonucleotide that produces editing, which, when attached to its target sequence, can recruit adenosine deaminase due to the dsRNA properties that appear. In all aspects of the invention, the enzyme with adenosine deaminase activity is preferably ADAR1, ADAR2 or ADAT. In a highly preferred embodiment, the EON is an RNA editing oligonucleotide that targets a precursor mRNA or mRNA, wherein the target nucleotide is adenosine in the target RNA, wherein adenosine is deaminated to inosine, which is read by the translation machinery as guanosine. The present disclosure also provides a pharmaceutical composition comprising the EON described herein and a pharmaceutically acceptable carrier.

[0096] Other chemical modifications of the EON herein include substitution of one or more than one of any hydrogen atoms with deuterium or tritium, examples of which can be found in, for example, WO 2014 / 022566 or WO 2015 / 011694.

[0097] The present disclosure provides EON herein for treating or preventing an obstacle associated with iron overload, or a pharmaceutical composition comprising EON herein. In one embodiment, the present disclosure provides EON herein for treating or preventing a disease associated with iron overload (such as HH), or a pharmaceutical composition comprising EON herein. In one embodiment, EON herein for treating or preventing HH, or a pharmaceutical composition comprising EON herein is provided.

[0098] The EON herein preferably does not contain a 5' terminal O6-benzylguanosine or a 5' terminal amino modification, and preferably is not covalently linked to a SNAP-tag domain (engineered O6-alkylguanosine-DNA-alkyltransferase). The EON herein preferably does not contain a boxB RNA hairpin sequence. In one embodiment, the EON herein contains 0, 1, 2, or 3 wobble base pairs with the target sequence, and / or 0, 1, 2, 3, 4, 5, 6, 7, or 8 mismatch base pairs with the target RNA sequence. When the orphan nucleotide is uridine, there is no mismatch. An alternative to uridine is to position isouridine opposite the target adenosine, which may not pair as G pairs with U. Preferably, the target adenosine in the target sequence forms a mismatch base pair with the nucleoside directly opposite the target adenosine in the EON.

[0099] It should be noted that when EON is delivered via a vector (e.g., an AAV vector), there is no chemical modification in the EON acting on the target RNA molecule. Although it is preferred to use "naked" EON with chemical modifications as described herein, EON delivered by other means, such as expression via an AAV vector, or circular or hairpin-structured editing molecules (recruiting moieties, such as disclosed in WO2016 / 097212, WO2017 / 050306, WO2020 / 001793, WO2017 / 010556, WO2020 / 246560, and WO2022 / 078995) are also encompassed by the present invention, as these can also be applied to edit adenosine in the target HFE RNA molecule to produce functionally restored HFE protein.

[0100] The EONs herein can utilize endogenous cellular pathways and naturally available ADAR enzymes to specifically edit target adenosines in target RNA sequences. The EONs herein are capable of recruiting and complexing with ADARs, and then promoting the deamination of a (single) specific target adenosine nucleotide in the target RNA sequence. Ideally, only one adenosine is deaminated. The EONs herein, when complexed with ADARs, preferably result in the deamination of a single target adenosine.

[0101] Analysis of the natural targets of ADAR enzymes indicates that these targets typically contain mismatches between the two strands of the RNA helix edited by ADAR1 or 2. These mismatches have been shown to enhance the specificity of the editing reaction (Stefl et al. 2006. Structure 14(2): 345-355; Tian et al. 2011. Nucleic Acids Res 39(13): 5669-5681). Characterization of the optimal pattern of pairing / mismatched nucleotides between EON and target RNA is also crucial for developing effective ADAR-based EON therapies.

[0102] As mentioned above, EON herein utilizes specific nucleotide modifications at predetermined points to ensure stability and correct ADAR combination and activity. These changes can be different and can include modifications connected in the main chain of EON, the sugar moiety of nucleotides and core bases or phosphodiester as outlined in detail herein. They can also be distributed in a variable manner throughout the EON sequence. Specific modifications may be needed to support the interaction of different amino acid residues in the RNA binding domain of the ADAR enzyme and those in the deaminase domain. For example, PS connections or 2'-OMe or 2'-MOE modifications between nucleotides can be tolerated in certain parts of EON, while in other parts they should be avoided to avoid destroying the key interactions of the enzyme with phosphate and 2'-OH groups. In the case where the target sequence is not optimal for ADAR editing, specific nucleotide modifications may also be necessary to enhance the editing activity to substrate RNA. Previous work has confirmed that certain sequence environments are easier to edit. For example, the target sequence 5'-UAG-3' (with a target A in the middle) contains the most preferred nearest neighbor nucleotide for ADAR2, while the 5'-CAA-3' target sequence is less preferred (Schneider et al. 2014. Nucleic Acids Res 42(10):e87). Structural analysis of the ADAR2 deaminase domain suggests that editing can be enhanced by carefully selecting the nucleotides opposite the target trinucleotide. For example, a 5'-CAA-3' target sequence paired with a 3'-GCU-5' sequence on the opposite strand (forming an AC mismatch in the middle) is less preferred due to steric clashes between the guanosine base and the amino acid side chains of ADAR2. Although other adenosines in the HFE transcript may also be targeted, resulting in impaired protein function, in a preferred aspect, the adenosine at position 845 is deaminated. The present disclosure provides RNA editing oligonucleotides (collectively referred to herein as EONs) that can result in the deamination of adenosines in HFE transcripts, resulting in a fully functional HFE protein in the control of iron levels. This means that the present invention is not strictly limited to the deamination of adenosine at position 845, but other (single or multiple) adenosines can also be targeted, which can also lead to enhanced function of the HFE protein. Other adenosines that are equally important (or potentially becoming more important) for HFE function can be identified, for example, by genetic screening or computer simulation in the human population, and these adenosines can also be targeted by RNA editing according to the teachings of this disclosure. The present disclosure covers all RNA events and oligonucleotides that can be used for such targeting, regardless of the exact nucleic acid molecule or EON.

[0103] Mutagenesis studies of human ADAR2 revealed that a single mutation (E488Q) from glutamic acid to glutamine at residue 488 resulted in a 60-fold increase in the rate constant for deamination compared to the wild-type enzyme (Kuttan and Bass. 2012. Proc Natl Acad Sci USA. 109(48): 3295-3304). During the deamination reaction, ADAR flips the edited base out of its RNA duplex and into the enzyme active site (Matthews et al. 2016. Nat Struct Mol Biol. 23(5): 426-433). When ADAR2 edits adenosine under a preferred environment (A:C mismatch), the nucleotide opposite the target adenosine is often referred to as an "orphan cytidine." The crystal structure of ADAR2 E488Q bound to double-stranded RNA (dsRNA) reveals that the glutamine (Gln) side chain at position 488 can provide a hydrogen bond to the N3 position of orphan cytidine, which results in an increase in the catalytic rate of ADAR2 E488Q. In the wild-type enzyme, glutamic acid (Glu) is present at position 488 instead of glutamine (Gln), and the amide group of glutamine does not exist, but is a carboxylic acid. In order to obtain the same contact between orphan cytidine and the E488Q mutant, protonation is required for such contact to occur in the wild-type case. In order to utilize endogenously expressed ADAR2 to correct disease-associated mutations, it is crucial to maximize the editing efficiency of the wild-type ADAR2 enzyme present in the cell. WO2020 / 252376 discloses the use of EONs with modified RNA bases (especially at the position of orphan cytidine) to mimic the hydrogen bond pattern observed for the E488Q ADAR2 mutant. By replacing the nucleotide opposite the target adenosine in the EON with a cytidine analog (which serves as a hydrogen bond donor at N3), it is envisioned that the same contact, which is believed to provide the enhanced catalytic rate for the mutant enzyme, can be stabilized. Two cytidine analogs are of particular interest: pseudoisocytidine (also known as "piC"; Lu et al. 2009. J Org Chem. 74(21):8021-8030; Burchenal et al. 1976. Cancer Res 36:1520-1523) and Benner base Z (also known as "dZ"; Yang et al. 2006. Nucl Acid Res. 34(21):6095-6101), which were initially chosen because they provide a hydrogen bond donor at N3 with minimal perturbation to the nucleobase shape. Benner base is also known as 6-amino-5-nitro-3-yl-2(1H)-pyridone. In addition to modifications of the ribose 2' group, cytidine analogs may also be present in AONs.The ribose 2' group in the AON can be independently selected from 2'-H (i.e. DNA), 2'-OH (i.e. RNA), 2'-OMe, 2'-MOE, 2'-F or 2'-4' linkages (i.e. bridged nucleic acids, such as locked nucleic acids (LNA)) or other 2' substitutions. The 2'-4' linkage can be selected from linkers known in the art, such as methylene linkers or constrained ethyl linkers.

[0104] In one embodiment, the EON herein comprises one or more sugar moieties that are mono- or di-substituted at the 2', 3' and / or 5' positions, such as: -OH; -H; -F; substituted or unsubstituted, linear or branched lower (C 1- C 10 ) alkyl, alkenyl, alkynyl, alkaryl, allyl or aralkyl, which may be interrupted by one or more heteroatoms; -O-, S- or N-alkyl; -O-, S- or N-alkenyl; -O-, S- or N-alkynyl; -O-, S- or N-allyl; -O-alkyl-O-alkyl; -methoxy; -aminopropoxy; -methoxyethoxy; -dimethylaminooxyethoxy; and -dimethylaminoethoxyethoxy.

[0105] In one embodiment, the nucleotide analogs or equivalents in the EON herein comprise one or more base modifications or substitutions. Modified bases include synthetic and natural bases, such as inosine, xanthine, hypoxanthine, and other pyrimidines and purine bases known in the art or to be known, such as -aza, denitrogenation, -hydroxyl, -halogen, -thio, thiol, -alkyl, -alkenyl, -alkynyl, -thioalkyl derivatives. Purine core bases and / or pyrimidine core bases can be modified to change their properties, such as by amination or deamination of heterocycles. Exact chemistry and form can be different due to oligonucleotide constructs and applications, and can be tested according to the wishes and preferences of those skilled in the art.

[0106] The EON herein is generally longer than 10 nucleotides, preferably more than 11, 12, 13, 14, 15, 16 nucleotides, still more preferably more than 17 nucleotides. In one aspect, the EON herein is longer than 20 nucleotides. The EON herein is preferably shorter than 100 nucleotides, still more preferably shorter than 60 nucleotides, still more preferably shorter than 50 nucleotides. In a preferred aspect, the EON herein comprises 18 to 70 nucleotides, more preferably 18 to 60 nucleotides, and even more preferably 18 to 50 nucleotides. Thus, in a particularly preferred aspect, the EON herein comprises 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides. In one embodiment, the EON herein is 27, 28, 29 or 30 nucleotides in length.

[0107] In one aspect, the EON herein has inverted deoxy-T or dideoxy-T nucleotides incorporated at either or both ends.

[0108] As described above, in some embodiments of the present disclosure, an EON is provided for forming a ds complex with a human HFE RNA molecule in human liver cells. Thus, the therapeutic effect is preferably on human liver cells in vivo. Of course, the method can also be performed in vitro or ex vivo.

[0109] The present disclosure provides an EON or pharmaceutical composition for treating a disease. The present disclosure also provides the use of the EON or pharmaceutical composition herein in the preparation of a medicament for treating a disease. The present disclosure also provides a method for treating a disease in a patient, comprising administering a therapeutically effective amount of the EON or pharmaceutical composition herein. Preferably, the disease is caused by iron overload caused by the C282Y mutation in HFE. The EON is preferably administered therapeutically rather than prophylactically (after genetic counseling), but this does not exclude that it may also be beneficial.

[0110] After RNA editing occurs in a cell, the modified RNA becomes diluted over time, for example due to cell division, limited half-life of the edited RNA, etc. Therefore, in practical therapeutic terms, the methods of the present invention may involve repeated delivery of EONs until sufficient target RNA is modified to provide a tangible benefit to the patient and / or maintain the benefit over time.

[0111] Example

[0112] Example 1. Editing of target adenosines in human HFE target RNA molecules using an in vitro biochemical editing assay.

[0113] First, an initial set of HFE-targeted EONs (RM4700 to RM4726; shown in Figure 1 ), to address the editing of human HFE target (precursor) mRNA in an in vitro biochemical editing assay. To obtain the HFE target RNA, an HFE G-block (IDT) containing a T7 promoter sequence and (a portion of) the HFE sequence was used as a template, and PCR was performed using a forward primer 5'-CTC GAC GCAAGC CAT AAC AC-3' (SEQ ID NO: 53) and a reverse primer 5'-TGG ACC GAC TGG AAA CGT AG-3' (SEQ ID NO: 54). The 5' to 3' G-block sequence (SEQ ID NO: 55) is as follows, where the underlined and bold are the target adenosines, and where the underlined are the primer sequences:

[0114]

[0115] The PCR product was then used as a template for in vitro transcription. The reaction used the MEGAscript T7 transcription kit. RNA was purified on a urea gel and then extracted in 50mM Tris-Cl pH 7.4, 10mM EDTA, 0.1% SDS, 0.3M NaCl buffer and subsequently phenol-chloroform purified. The purified RNA was used as a target for the biochemical editing assay.

[0116] Initially, EON RM4700 to RM4726 were annealed with HFE target RNA in a buffer (5 mM Tris-Cl pH 7.4, 0.5 mM EDTA, and 10 mM NaCl) at a target RNA to oligonucleotide ratio of 1:3 (600 nM oligonucleotide and 200 nM target RNA). The sample was heated at 95°C for 3 minutes and then slowly cooled to room temperature. Next, the editing reaction was performed. The annealed oligonucleotide / target RNA was mixed with protease inhibitors (cOmplete TM, Mini, EDTA-free Protease I, Sigma-Aldrich), RNase inhibitor (RNasin, Promega), poly A (Qiagen), tRNA (Invitrogen) and editing reaction buffer (15mM Tris-Cl pH 7.4, 1.5mM EDTA, 3% glycerol, 60mM KCl, 0.003% NP-40, 3mMMgCl2 and 0.5mM DTT) were mixed so that their final concentrations were 6nM oligonucleotide and 2nM target RNA. The reaction was started by adding purified ADAR2 (GenScript) to a final concentration of 6nM to the mixture and incubated at 37°C for the predetermined time points. Each reaction was terminated by adding 95μl of 95°C 3mM EDTA solution. A 6μl aliquot of the terminated reaction mixture was then used as a template for cDNA synthesis using a Maxima reverse transcriptase kit (Thermo Fisher) and random hexamer primers (ThermoFisher Scientific). In the presence of primers and dNTPs, RNA was initially denatured at 95°C for 5 minutes and then slowly cooled to 10°C, after which first-strand synthesis was performed in a total volume of 20 μl using an extension temperature of 62°C according to the manufacturer's instructions. Products were amplified by PCR for pyrosequencing analysis using 1 μl of cDNA as a template using the Amplitaq gold 360 DNA polymerase kit (Applied Biosystems) according to the manufacturer's instructions. PCR was then performed using the following thermal cycling protocol: initial denaturation at 95°C for 5 minutes, followed by 40 cycles of 95°C for 30 seconds, 58°C for 30 seconds, and 72°C for 30 seconds, and a final extension at 72°C for 7 minutes.

[0117] Since inosine base pairs with cytidine during cDNA synthesis in the reverse transcription reaction, the nucleotide incorporated into the edited position during PCR will be guanosine. The percentage of guanosine (edited) relative to adenosine (unedited) was determined by pyrosequencing. Pyrosequencing of PCR products and data analysis were performed using a PyroMark Q48 Autoprep instrument (QIAGEN) according to the manufacturer's instructions, with 10 μl of PCR product and 4 μM sequencing primer as input: the analysis performed by the instrument provides results for the selected nucleotide as the percentage of adenosine and guanosine detected at that position, and the extent of A to I editing at the selected position is therefore measured by the percentage of guanosine at that position.

[0118] Figure 2Results are given in A, B, and C, each with a subset of data points from a given EON. It can be clearly seen that all EONs tested were able to mediate RNA editing in the biochemical editing assay, although with varying efficiencies. The best performing EONs in this in vitro assay were those with 18 nucleotides on the 5' side of the orphan nucleotide and 11 nucleotides on the 3' side of the orphan nucleotide (e.g., RM4716, RM4717, RM4718, and RM4719).

[0119] Example 2. Editing of target adenosine in human HFE target RNA molecules in B lymphocytes from donors carrying the C282Y mutation.

[0120] Next, EON RM4700 to RM4723 and RM4725 were tested for their ability to mediate RNA editing by recruiting endogenous ADAR enzymes in B lymphocytes from donors homozygous for C282Y (c.845G>A) mutations in two different HFE genes. The two donors were referred to as GM14715 and GM14631, and B lymphocytes were provided by Corriel. Human Epstein-Barr virus (EBV) immortalized B lymphocytes were cultured in RPMI-1640 / 10% FBS / 1% Pen-Strep. The cells were maintained at 37°C in a 5% CO2 atmosphere.

[0121] A total of 0.2 × 10 6Cells were co-treated with 5 μM EON + 1 μM AG1856 saponin in a total volume of 200 μl in 48-well plates. It is known to those skilled in the art that a variety of saponins have been used in many types of applications, and therapeutic uses of saponins have also been described (Weng A et al. 2009. Planta medica 75(13):1421-1422; Weng A et al. 2010. J Chromatography B 878(7):713-718; Weng A et al. 2012. Molecular Oncology 6(3):323-332; Weng A et al. 2012. J Controlled Disease 164(1):74-86; Thakur et al. 2014. J Chromatography B 955:1-9; Jia et al. 1998. J Natural Products 61(11):1368-1373; Haddad et al. 2004. Helvetica chimica acta 87(1):73-81; Fu et al. 2005. J Natural Products 68(5):754-758; Moniuszko-Szajwaj et al. 2016. Helvetica chimica acta 99(5):347-354; Fuchs H et al. 2017. Biomedicines 5(2):14). A specific saponin (SO1861) derived from Saponaria officinalis has also been described to mediate improved intracellular delivery of peptide and lipid nanoparticles and nucleic acids (Weng A et al. 2015. J Controlled Release 206:75-90; Sama S et al. 2017. Int J Pharmaceutics 534:195-205). WO2019 / 011914 discloses a saponin (GE1741) isolated from Gypsophila elegans, which provides improved effects in delivering small molecules (such as nucleic acid molecules) to cells (see also Sama S et al. 2018. J Biotechnology 284: 131-139). WO2021 / 122998 (and EP3838910B1, from priority applications) discloses another class of saponins derived from Agrostemma githago L., which has further improved properties relative to previously described SO1861 and GE1741 saponins, especially in toxicity and endosomal escape (see also Clochard J et al. 2020. Int J Pharm 589: 119822).The inventors of the present invention utilized saponin AG1856 (also known as triterpene glycoside, or triterpene saponin) disclosed in WO2021 / 122998 to enhance the RNA editing effect of HFE transcripts in B lymphocytes discussed above.

[0122] Negative controls were samples treated with EON with scrambled sequence (sequence not shown), untreated samples (NT), samples without reverse transcriptase (-RT) (see below), and water samples.

[0123] 72 hours after the first exposure to EON and AG1856, cells were collected and total RNA was isolated using the SV Total RNA Isolation System Kit (Promega). After removing the culture medium, the cells were washed once with PBS. After completely aspirating the PBS, 100 μL of BL+TG (Promega) was added to lyse the cells and collect the intracellular material. After adding 35 μL of 2-propanol, the mixture was loaded onto the column and subjected to several washing steps and DNaseI treatment. After elution in a total volume of 20 μL of DNase / RNase-free water, RNA yield was determined using spectrophotometric analysis (NanoDrop) and stored at -80°C.

[0124] cDNA was generated using Maxima reverse transcriptase (RT, Thermo Fisher). Typically, 500 ng of total RNA was used to supplement DNase- and RNase-free water to a total volume of 20 μL containing 4 μL 5×RT buffer, 1 μL dNTP mixture (each 10 mM), and 1 μL random hexamer (all from Thermo Fisher). The sample was loaded into a T100 thermal cycler (Bio-Rad) and initially incubated at 25°C for 10 minutes, followed by a cDNA reaction temperature of 50°C for 30 minutes; and a termination step of 5 minutes at 85°C. The sample was cooled to 4°C and then stored at -20°C.

[0125] To determine editing efficiency, cDNA samples were used in digital PCR (dPCR) assays. The first dPCR was designed to distinguish between cDNA species containing native adenosine and edited inosine (which is converted to guanidine during cDNA synthesis). The second multiplex dPCR used primer / probe sets targeting exons 1 and 2 to quantify the total HFE transcript copies (cDNA molecules) in the mixture. The third assay used primers that bind to exons 4 / 7 and probes that overlap with the exon 4 / 6 boundary to quantify exon 5 skipping. The primer and probe sequences are as follows, where "+" refers to the LNA nucleotide on the 3' side:

[0126] Total determination

[0127] hHFE_e01_Fw GGCGCTTCTCCTCCTGATG SEQ ID NO: 56 hHFE_e01-02_TEXTGCTGCGTTCACACTCTCTGCAC SEQ ID NO: 57 hHFE_e02_rv CCACGTAGCCCAAAGCTTCA SEQ ID NO: 58 Editing assay

[0128] hHFE_e04_fw CGTATTGCCCAATGGGGATG SEQ ID NO:59 hHFE_e04_edited_FAMCAGAGATATACGT+G+CCAGGTGGA SEQ ID NO:60

[0129]

[0130] Jump measurement

[0131]

[0132] A total of 1.3 μL of cDNA mixture was used in a dPCR mixture containing 3 μL of 4× dPCR mastermix (Qiagen), 0.6 μL of primers, and 0.3 uL of probe (10 μM stock concentration) supplemented with DNase- and RNase-free water to a total volume of 13 μL. From this mixture, 12 μL was transferred to an 8.5K divider plate, and the fluorophore was measured on the Qiaquity instrument. The dPCR cycling conditions were as follows: enzyme activation at 95°C for 2 minutes, followed by denaturation at 95°C for 15 seconds and annealing / extension at 63°C for 30 seconds for 40 cycles. The percentage of A to I editing was determined by dividing the number of G-containing molecules by the total number (G-containing species plus A-containing species) and multiplying by 100.

[0133] Figure 3 Results from editing experiments using B lymphocytes from donor GM14715 are shown in Figure 2 and clearly indicate that, despite varying efficiencies, all tested EONs were able to mediate RNA editing of mutations in the HFE transcript. In this cell-based assay, editing was observed to be as high as nearly 30% with the best-performing EON, EON RM4717. Following treatment with EONs, skipping of exon 4 in the HFE transcript was limited (approximately 2%) (data not shown), and the amount of HFE transcript remained relatively stable after EON treatment (data not shown). Figure 4 Results of editing experiments using B lymphocytes from donor GM14631 are shown, which again show varying efficiencies but are comparable to those of Figure 3The results are consistent with those shown in . RM4716 performed best, reaching an editing level of nearly 50%. Samples of RM4704 and RM4707 were lost (indicated by X) during the measurement period of this initial experiment. It can be clearly seen from these two experiments that EONs with 18 nucleotides at the 5' end of the orphan nucleotide and 9, 11 or 13 nucleotides at the 3' end of the orphan nucleotide provided the highest efficiency. RM4725, which contains a long 2'-F nucleotide at the 5' end of the EON and a relatively short nucleotide (only 5 nucleotides) at the 3' end, gave relatively low RNA editing.

[0134] These experiments showed that the inventors could use endogenous ADAR enzymes and RNA editing-mediating oligonucleotides to achieve ADAR-mediated editing in EBV-immortalized B lymphocytes from donors carrying both alleles of the HFE c.845G>A mutation.

[0135] Example 3. Editing of target adenosine in human HFE target RNA molecules in GM14715 B lymphocytes and hepcidin expression after treatment.

[0136] In the original design of EON( Figure 1 ) based on another group of EONs with different lengths and chemical modifications. These EONs and their modifications are shown in Figure 5 Some of these were used to treat GM14715 B lymphocytes as described in Example 2 and co-treated with 2 μM saponin AG1856. After 72 hours of treatment, the editing percentage was determined as described above. Figure 6 The percentage of editing observed for these EONs is shown, which is compared to the Figure 3 The well-performing RM4717 is shown in the figure for comparison. Figure 6 The results in clearly show that the best performer (D282-10; RM106443; SEQ ID NO: 73) gave over 40% editing of the target adenosine in the HFE transcript, which is even higher than initially observed with RM4717.

[0137] To determine the downstream functional effects of these EON-induced RNA editing effects, we investigated whether hepcidin expression levels increased after restoration of C282Y mutant mRNA in B lymphocytes. The same samples in which the percentage of editing was determined were used to quantify HAMP expression. To this end, a dPCR assay was designed to detect HAMP mRNA and the housekeeping gene GUSB, which was used to normalize HAMP expression data. Figure 6 The data presented in

[15] show that at high editing levels, HAMP mRNA expression is also increased.

[0138] HAMP assay

[0139]

[0140] GUSB assay

[0141]

[0142] Example 4. Generation of human hepatocytes carrying the C282Y mutation for in vitro screening of EONs.

[0143] Because the liver plays a central role in iron homeostasis, EONs need to be tested on cell models that better reflect the target tissue. To this end, a human hepatocyte-like cell line was constructed. Because some EONs carry a 3'-attached tridentate GalNAc moiety, these cells enable GalNAc-assisted EON uptake through the asialoglycoprotein receptor (ASGR) expressed by hepatocytes. A human induced pluripotent stem cell (iPSC) line was generated in which C282Y (c.845G>A; rs1800562) was introduced into the HFE gene using the CRISPR / Cas9 gene editing method. These iPSC C282Y cells differentiated into mature hepatocyte-like cells, in which the expression of mature hepatocyte markers and ASGR was confirmed.

[0144] Example 5. Quantification of intracellular iron levels after editing of target adenosine in HFE target RNA.

[0145] Since one of the typical clinical manifestations of HH is high iron levels in serum and liver, an iron measurement assay was developed to quantify intracellular and tissue iron levels. The goal was to quantify iron levels after treatment with HFE C282Y-edited EONs to determine the impact of HFE restoration on iron metabolism. Several iron quantification methods were explored, such as spectrophotometry, in which iron is complexed with a chromophore (such as ferrozine or ferene-s), enabling subsequent colorimetric detection at a specific wavelength. Alternatively, inductively coupled plasma mass spectrometry (ICP-MS) was used to quantify the number of iron atoms in cell lysates.

[0146] Example 6. Quantification of amino acid repair in C282Y HFE after editing of the target adenosine.

[0147] To determine the impact of EON-mediated restoration of HFE on its protein sequence, a method was developed that enables the differentiation and quantification of wild-type and mutant HFE (C282Y) proteins. Liquid chromatography tandem mass spectrometry (LC-MS / MS) was explored as a potential peptide quantification technique. This technique enables quantification of target HFE peptides in cells and tissues. Ideally, the assay would be able to detect both the restored wild-type HFE peptide sequence (or the C294 HFE mouse equivalent) containing the C282 amino acid and the mutant HFE C282Y peptide.

Claims

1. An RNA-editing oligonucleotide (EON) capable of forming a double-stranded complex with a region of an endogenous human HFE transcript molecule in a cell, wherein the region of the HFE transcript molecule comprises a target adenosine, and wherein the double-stranded complex can recruit an endogenous ADAR enzyme to deaminate the target adenosine to inosine, thereby editing the HFE transcript molecule. 2 . The EON of claim 1 , wherein the HFE transcript molecule is a pre-mRNA or mRNA molecule.

3. The EON according to claim 1 or 2, wherein the cells are human liver cells, preferably hepatocytes.

4. The EON according to any one of claims 1 to 3, wherein the target adenosine is the c.845G>A mutation in the human HFE gene. 5 . The EON according to claim 1 , wherein the EON comprises or consists of a nucleotide sequence of any one of the EON sequences of SEQ ID NOs: 1 to 51 and 66 to 164.

6. The EON of any one of claims 1 to 5, wherein at least one nucleotide comprises one or more non-naturally occurring chemical modifications, or one or more additional non-naturally occurring chemical modifications in the ribose, linkage, or base moieties, with the proviso that the orphan nucleotide is not a cytidine comprising a 2'-OMe ribose substitution, the orphan nucleotide being the nucleotide directly opposite the target adenosine in the EON.

7. The EON according to claim 6, wherein the orphan nucleotide is a cytidine analogue, preferably a deoxynucleotide comprising a 6-amino-5-nitro-3-yl-2(1H)-pyridinone nucleobase.

8. The EON according to claim 6, wherein the orphan nucleotide is a uridine analog, preferably a deoxynucleotide comprising an isourea nucleobase.

9. The EON according to any one of claims 6 to 8, wherein the one or more additional modifications in the linking moiety are each independently selected from phosphorothioate (PS), phosphonoacetate, phosphorodithioate, methylphosphonate (MP), sulfonylphosphoramidate or PNdmi internucleotide linkages.

10. The EON according to any one of claims 6 to 9, wherein the one or more additional modifications in the ribose moiety are mono- or di-substitutions at the 2', 3' and / or 5' position of the ribose, each independently selected from: -OH; ·-F； Substituted or unsubstituted, linear or branched lower (C1-C 10 ) an alkyl, alkenyl, alkynyl, alkaryl, allyl or aralkyl group, which may be interrupted by one or more heteroatoms; -O-, S- or N-alkyl; ●-O-, S-, or N-alkenyl; -O-, S-, or N-alkynyl; -O-, S- or N-allyl; -O-alkyl-O-alkyl; ●-methoxy; ●-aminopropoxy; ●-methoxyethoxy; -dimethylaminooxyethoxy; and ●-Dimethylaminoethoxyethoxy.

11. A vector, preferably a viral vector, more preferably an adeno-associated virus (AAV) vector, comprising a nucleic acid molecule encoding the EON according to any one of claims 1 to 5.

12. A lipid nanoparticle (LNP) formulation comprising the EON according to any one of claims 1 to 10.

13. A pharmaceutical composition comprising the EON according to any one of claims 1 to 10, the carrier according to claim 11 or the LNP formulation according to claim 12; and a pharmaceutically acceptable carrier.

14. The EON according to claims 1 to 10, the vector according to claim 11, the LNP formulation according to claim 12 or the pharmaceutical composition according to claim 13 for use in the treatment of homeostatic iron regulatory protein (HFE) hemochromatosis.

15. Use of the EON according to any one of claims 1 to 10 in the manufacture of a medicament for the treatment of homeostatic iron regulatory protein (HFE) hemochromatosis. 16 . A method for editing an HFE polynucleotide, the method comprising contacting the HFE polynucleotide with the EON according to claim 1 , thereby editing the HFE polynucleotide.

17. A method of treating homeostatic iron regulatory protein (HFE) hemochromatosis in a patient in need thereof, the method comprising contacting an HFE polynucleotide in a cell of the subject with an EON according to any one of claims 1 to 10, thereby treating the patient.

18. A method for treating HFE hemochromatosis, comprising administering to a patient in need thereof a therapeutically effective amount of the EON according to any one of claims 1 to 10, the vector according to claim 11, the LNP formulation according to claim 12, or the pharmaceutical composition according to claim 13.

19. A method for deaminating a target adenosine in an HFE pre-mRNA or mRNA molecule in a cell, the method comprising the steps of: (i) providing the cell with an EON according to any one of claims 1 to 10; (ii) allowing the cells to take up the EON; (iii) annealing the EON to the HFE pre-mRNA or mRNA molecule; (iv) allowing endogenous ADAR enzymes to deaminize target adenosine in the target RNA molecule to inosine; and optionally (v) identifying the presence of inosine in the target RNA molecule.

20. The method of any one of claims 16 to 19, wherein the target adenosine is a c.845G>A mutation in an HFE pre-mRNA or mRNA molecule.

21. The method according to claim 19 or 20, wherein step (v) comprises: a) determining the sequence of the HFE pre-mRNA or mRNA molecule; b) assessing the presence of wild-type HFE protein; or c) Using a functional readout, preferably assessing serum or plasma ferritin concentration, or percentage of serum transferrin saturation.

Images