Application of polysaccharide in promoting proliferation of bacteroides simplex

Abstract

The invention discloses application of polysaccharide in promoting proliferation of bacteroides simplex. The polysaccharide is xyloglucan or a derivative thereof. By inoculating bacteroides simplex into the culture medium containing the xyloglucan or the derivative thereof for culture, the specificity of proliferation of the bacteroides simplex is remarkably improved, and the xyloglucan or the derivative thereof not only accelerates the proliferation rate of the bacteroides simplex, but also improves the maximum proliferation capacity of the bacteroides simplex.

Description

Technical Field

[0001] The present application belongs to the field of microbial technology, and specifically relates to the application of a polysaccharide in promoting the proliferation of Bacteroides monomorpha. Background Art

[0002] In the complex and exquisite intestinal microecological system of the human body, Bacteroides uniformis (B. uniformis), as a core member of the genus Bacteroides, plays a vital role in the stable maintenance of intestinal function with its unique biological characteristics of Gram-negative and obligate anaerobicity.

[0003] In terms of disease associations, a wealth of rigorous scientific research has revealed a close link between the abundance of Bacteroides monocytogenes and the development and progression of various diseases. Decreased abundance of Bacteroides monocytogenes is significantly associated with conditions such as enteritis, anorexia, obesity, diabetes, abdominal distension, cognitive development and emotional and motor disorders, attention deficit hyperactivity disorder (ADHD), chronic kidney disease, and osteoporosis. This finding highlights the crucial importance of maintaining a steady state of Bacteroides monocytogenes abundance in disease prevention and treatment, providing new research directions and potential targets for prevention and treatment strategies for related diseases.

[0004] However, the abundance of Bacteroides monocytogenes is highly susceptible to a variety of factors. Changes in daily diet and the widespread use of antibiotics can lead to imbalances in its abundance. Once imbalanced, this not only disrupts the balance of the intestinal microbiome but can also trigger or aggravate the aforementioned diseases, posing a serious threat to human health.

[0005] With the development of social economy and the continuous improvement of people's health awareness, the attention paid to intestinal health is increasing. Against this background, the market for intestinal flora regulation products is showing a booming trend, and products that regulate intestinal flora, such as probiotics and functional foods, are widely favored by consumers. However, the current means of flora regulation in existing technologies are relatively single, and most probiotic products focus on traditional strains such as Lactobacillus or Bifidobacterium, lacking specific regulatory strategies for Bacteroides monomorpha. In the field of polysaccharides, the existing technology has not reported any products that can specifically promote the proliferation of Bacteroides monomorpha. This means that there is a huge technical gap and research space in the use of polysaccharides to regulate intestinal flora, especially in the regulation of Bacteroides monomorpha. Summary of the Invention

[0006] Given the key position of Bacteroides monocytogenes in the human intestinal microecological system, its abundance is closely related to the occurrence and development of various diseases, and the existing technology lacks effective means for the specific proliferation of Bacteroides monocytogenes. This application aims to provide an innovative application based on xyloglucan to achieve the purpose of efficiently promoting the proliferation of Bacteroides monocytogenes, thereby providing new strategies and approaches for regulating the balance of intestinal flora, preventing and treating diseases related to the imbalance of Bacteroides monocytogenes abundance.

[0007] In one aspect of the present application, a use of a polysaccharide in promoting the proliferation of Bacteroides monomorpha is provided, wherein the polysaccharide is xyloglucan or a derivative thereof.

[0008] In one embodiment, the xyloglucan is derived from plant extracts.

[0009] In one embodiment, the xyloglucan is derived from tamarind, apple, Arabidopsis, pea, seaweed, wheat, corn, sugarcane, soybean, bamboo, etc.

[0010] In one embodiment, the Bacteroides monomorpha is inoculated and cultured in a culture medium containing the xyloglucan or its derivatives to increase the abundance of the Bacteroides monomorpha.

[0011] In one embodiment, the Bacteroides monomorpha is cultured to an OD 600 The mixture is diluted to 0.2-0.6 and then inoculated into a culture medium containing the xyloglucan or its derivatives for cultivation.

[0012] In one embodiment, the Bacteroides monomorpha is cultured to an OD 600 is 0.4.

[0013] In one embodiment, the dilution multiple is 20 to 200 times.

[0014] In one embodiment, the dilution factor is 50-fold.

[0015] In one embodiment, the concentration of xyloglucan or its derivative in the culture medium is 1-5 mg / mL.

[0016] In one embodiment, the concentration of xyloglucan or its derivative in the culture medium is 2 mg / mL.

[0017] In one embodiment, the xyloglucan or its derivative is added to the culture medium and stirred at 50° C. for at least 4 hours to obtain the culture medium containing the xyloglucan or its derivative.

[0018] In one embodiment, the culture conditions are: culture under anaerobic conditions at 25-45°C.

[0019] In one embodiment, the culture condition is: culture under anaerobic conditions at 37°C.

[0020] In one embodiment, the culture medium is selected from Columbia Blood solid medium, Columbia Blood somatic medium, and Anaerobic Base Broth (ABB) medium.

[0021] In another aspect of the present application, a method for culturing Bacteroides monomorpha is provided, comprising:

[0022] The Bacteroides monomorpha is inoculated into a culture medium containing the xyloglucan or its derivatives for cultivation to increase the abundance of the Bacteroides monomorpha.

[0023] In one embodiment, the xyloglucan is derived from a plant extract.

[0024] In one embodiment, the Bacteroides monomorpha is cultured to an OD 600 The concentration of xyloglucan is 0.2-0.6, and after dilution, the mixture is inoculated into a culture medium containing the xyloglucan or its derivatives for cultivation.

[0025] In one embodiment, the dilution multiple is 20 to 200 times.

[0026] In one embodiment, the dilution factor is 50-fold.

[0027] In one embodiment, the concentration of xyloglucan or its derivative in the culture medium is 1-5 mg / mL.

[0028] In one embodiment, the concentration of xyloglucan or its derivative in the culture medium is 2 mg / mL.

[0029] In one embodiment, the culture conditions are: culture under anaerobic conditions at 25-45°C.

[0030] In one embodiment, the culture condition is: culture under anaerobic conditions at 37°C.

[0031] In one embodiment, the culture medium is selected from Columbia Blood solid medium, Columbia Blood solid medium or Anaerobic Basic Broth (ABB) medium.

[0032] In another aspect of the present application, a culture for promoting the proliferation of Bacteroides monomorpha is provided, wherein the culture comprises a basal culture medium and xyloglucan or a derivative thereof.

[0033] In one embodiment, the concentration of the xyloglucan or its derivative in the culture is 1-5 mg / mL.

[0034] In one embodiment, the concentration of xyloglucan or its derivative in the culture is 2 mg / mL.

[0035] In one embodiment, the basal culture medium is selected from Columbia Blood solid medium, Columbia Blood somatic medium or Anaerobic Basic Broth (ABB) medium.

[0036] In another aspect of the present application, a food composition is provided, comprising xyloglucan or a derivative thereof as an effective ingredient, and the composition is used to regulate the balance of intestinal flora and increase the abundance of Bacteroides monomorpha.

[0037] In one embodiment, the xyloglucan is derived from a plant extract.

[0038] In one embodiment, the xyloglucan is derived from tamarind, apple, Arabidopsis, pea, seaweed, wheat, corn, sugarcane, soybean, bamboo, etc.

[0039] In one embodiment, the food composition is in the form of a prebiotic, a dairy starter culture, a dietary fiber supplement, or a medical formula food, suitable for human or animal nutritional intervention.

[0040] In one embodiment, the food composition is used to improve host metabolic syndrome, intestinal barrier function or immune system status.

[0041] In another aspect of the present application, a pharmaceutical preparation is provided, comprising xyloglucan or a derivative thereof as an active ingredient.

[0042] In one embodiment, the xyloglucan is derived from a plant extract.

[0043] In one embodiment, the xyloglucan is derived from tamarind, apple, Arabidopsis, pea, seaweed, wheat, corn, sugarcane, soybean, bamboo, etc.

[0044] In one embodiment, the pharmaceutical preparation is used to prevent or treat diseases associated with intestinal flora imbalance, and its mechanism of action partially relies on promoting the proliferation of Bacteroides monocytogenes.

[0045] In one embodiment, the disease comprises inflammatory bowel disease, obesity, or metabolic syndrome.

[0046] In one embodiment, the pharmaceutical preparation is in the form of tablets, capsules, granules, oral solutions or rectal preparations.

[0047] In one embodiment, the pharmaceutical preparation is used in combination with antibiotics, probiotics or immunomodulators.

[0048] In another aspect of the present application, a biological feed additive is provided, wherein the feed additive comprises xyloglucan or a derivative thereof.

[0049] In one embodiment, the xyloglucan is derived from a plant extract.

[0050] In one embodiment, the xyloglucan is derived from tamarind, apple, Arabidopsis, pea, seaweed, wheat, corn, sugarcane, soybean, bamboo, etc.

[0051] In one embodiment, the feed additive is used to promote the proliferation of Bacteroides monomorpha in the intestines of livestock and poultry, improve animal intestinal health, and increase feed conversion rate.

[0052] The beneficial effects of this application are:

[0053] Adding xyloglucan or its derivatives to the culture medium of Bacteroides monomorpha significantly boosted its growth, accelerating its growth rate and increasing its maximum growth capacity. However, no similar effect was observed on Bacteroides ovatus, a member of the same genus.

[0054] At the same time, functional foods, pharmaceutical preparations and biological feed additives developed based on xyloglucan have enriched the product lines of related industries and met the needs of different consumer groups and breeding fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 : is a gel electrophoresis diagram of P_GH74 amplification in the embodiment of the present application; wherein, lane 1 is the result of amplification with the genome of Bacteroides monomorpha, and lane 2 is the result of amplification with the genome of Bacteroides ovatus;

[0056] Figure 2 This is the effect of the culture solution of xyloglucan on the proliferation of Bacteroides monomorpha in the examples of this application;

[0057] Figure 3 This is the effect of the xyloglucan culture solution on the proliferation of Bacteroides ovatus in the examples of this application;

[0058] Figure 4 This is the effect of culture solutions with different xyloglucan contents on the proliferation of Bacteroides monomorpha in the examples of this application. DETAILED DESCRIPTION

[0059] The technical scheme of the present application will be clearly and completely described below in conjunction with specific embodiments, but it will be understood by those skilled in the art that the following described embodiments are some embodiments of the present application, rather than all embodiments, and are only used to illustrate the present application, and should not be considered as limiting the scope of the present application. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present application. Those who do not specify specific conditions in the embodiments are carried out according to conventional conditions or the conditions recommended by the manufacturer. Those whose reagents or instruments are not specified as manufacturers are conventional products that can be purchased commercially.

[0060] Xyloglucan, a naturally biodegradable polysaccharide, is unique in that it is derived from tamarind seeds. Its molecular structure is based on a cellulose-like backbone with xylose and galactose-xylose substituents. This unique structure gives xyloglucan its "mucus-like" molecular form, which in turn imparts its adhesive properties. Within the body, xyloglucan's adhesive properties have important physiological implications. It acts as a physical barrier, effectively protecting mucosal cells from damage by various harmful factors, including microorganisms, allergens, and pro-inflammatory compounds, providing reliable protection. Numerous studies have also confirmed xyloglucan's beneficial effects, such as relieving constipation, lowering cholesterol levels, enhancing exercise endurance, and preventing inflammatory bowel disease (IBD).

[0061] However, in the field of polysaccharide research, there is currently a lack of polysaccharide varieties that can effectively promote the proliferation of Bacteroides monomorpha, and there have been no reports that xyloglucan can promote the proliferation of Bacteroides monomorpha. However, the applicants have found through research that the proliferation of Bacteroides monomorpha is significantly improved in culture media containing xyloglucan or its derivatives, and the proliferation effect is significantly enhanced.

[0062] As a core intestinal flora, Bacteroides monocytogenes plays a key role in human health. Precise regulation of its number and activity is crucial for metabolic balance, inflammatory response regulation, and the prevention and treatment of neurological diseases. Xyloglucan or its derivatives not only promote the proliferation of Bacteroides monocytogenes but also have the ability to regulate the interactions between intestinal flora. Based on these advantages, xyloglucan or its derivatives show great potential for dual applications in the food and pharmaceutical fields, and are expected to provide new approaches and methods for addressing related health issues.

[0063] In one embodiment of the present application, there is provided use of xyloglucan or a derivative thereof in promoting the proliferation of Bacteroides monomorpha.

[0064] Bacteroides uniformis is a vital component of the human intestinal microbiota, participating in physiological processes such as carbohydrate metabolism, short-chain fatty acid (SCFA) production, and immune regulation. Xyloglucan, a polysaccharide widely found in plant cell walls, is composed of monosaccharides such as glucose and xylose linked by specific glycosidic bonds. It possesses unique biological activities and functional properties, such as enhancing immunity, promoting intestinal health, and providing antioxidant benefits. Its derivatives can be chemically modified (such as sulfation and acetylation) to enhance their bioactivity. Studies have shown that the addition of xyloglucan to the culture medium significantly accelerates the proliferation rate of Bacteroides uniformis and also increases its maximum proliferation capacity.

[0065] The applicant's research discovered that the genome of Bacteroides uniformis carries a gene encoding GH74, a key enzyme for xyloglucan degradation. By designing specific primers targeting GH74 (xyloglucan-specific endo-1,4-β-D-glucanase) and conducting PCR amplification experiments, it was found that this gene is only present in Bacteroides uniformis and is not detected in other Bacteroides species (such as Bacteroides ovatus). GH74 has the activity to specifically cleave β-1,4-glycosidic bonds in xyloglucan, enabling efficient degradation of this complex polysaccharide. Due to its specific enzymatic properties, xyloglucan can selectively promote the proliferation of Bacteroides uniformis.

[0066] In certain embodiments, the xyloglucan is extracted from plants, preferably those with high xyloglucan content and easy extraction. Extraction methods include, but are not limited to, solvent extraction, enzymatic extraction, and ultrasound-assisted extraction. The extracted xyloglucan can be analyzed and evaluated for purity using techniques such as high-performance liquid chromatography (HPLC) and infrared spectroscopy (IR).

[0067] In certain embodiments, the xyloglucan is derived from tamarind, apple, Arabidopsis, pea, seaweed, wheat, corn, sugarcane, soybean and / or bamboo. Tamarind seeds have a high xyloglucan content and a stable structure, making them suitable for industrial extraction. Apple pectin coexists with xyloglucan, and xyloglucan can be separated by a specific process. Arabidopsis, as a model plant, has high research value for its xyloglucan, but its yield is relatively low. Xyloglucan coexists with oligosaccharides in legumes, and can be separated in a targeted manner.

[0068] In certain embodiments, the polysaccharide is a derivative of xyloglucan. These xyloglucan derivatives can be modified by chemical or biological methods to significantly improve their solubility, stability, biological activity, and functional properties, expanding their applications in food, medicine, cosmetics, and other fields. Specifically, chemical modification can include carboxymethylation, sulfation, or oxidative degradation. Carboxymethylation involves the reaction of xyloglucan with chloroacetic acid under alkaline conditions to introduce carboxymethyl groups (-CH2COOH), enhancing water solubility, as exemplified by carboxymethyl fenugreek xyloglucan. Sulfation involves the reaction of xyloglucan with a sulfuric acid reagent (such as chlorosulfonic acid) to introduce sulfate groups (-OSO3H), enhancing anticoagulant and antiviral activities, as exemplified by sulfated apple xyloglucan. Oxidative degradation involves the degradation of xyloglucan using oxidants such as hydrogen peroxide and sodium periodate, reducing its molecular weight and improving its solubility, as exemplified by the oxidative degradation of Arabidopsis xyloglucan. Biological modification can involve enzymatic modification or microbial fermentation. Enzymatic modification utilizes specific enzymes such as β-glucosidase and xylanase to partially hydrolyze or graft xyloglucan, enhancing its functionality, such as immunomodulation, as exemplified by the enzymatic hydrolysis of pea xyloglucan. Microbial fermentation, through microbial fermentation (e.g., lactic acid bacteria), converts xyloglucan into oligosaccharides or metabolites, enhancing its prebiotic activity. Furthermore, xyloglucan can be grafted with functional monomers (e.g., acrylic acid and methacrylic acid) through free radical polymerization to introduce new functionalities, such as pH responsiveness or temperature sensitivity, as exemplified by acrylic acid grafted onto xyloglucan.

[0069] In certain embodiments, xyloglucan or its derivatives promote the proliferation of Bacteroides monomorpha by inoculating Bacteroides monomorpha in a culture medium containing xyloglucan or its derivatives to increase the abundance of Bacteroides monomorpha. Abundance can be measured by plate spreading, flow cytometry, quantitative polymerase chain reaction (qPCR), or metagenomics. Plate spreading involves diluting the culture medium and spreading it on a solid culture medium, then counting colony-forming units (CFU). Flow cytometry uses fluorescently labeled antibodies to detect the number of viable Bacteroides monomorpha cells. qPCR quantitatively detects specific genes of Bacteroides monomorpha (e.g., the 16S rRNA gene) to assess their relative abundance. Metagenomics analyzes the genomic copy number of Bacteroides monomorpha in the culture medium through high-throughput sequencing.

[0070] In certain embodiments, the Bacteroides monomorpha is cultured to an OD of 600 After being diluted to 0.2-0.6, the OD value is inoculated into a culture medium containing the xyloglucan or its derivatives. 600 The absorbance value at 600 nm reflects the turbidity of the Bacteroides monocytogenes suspension. 0.2-0.6 corresponds to the early logarithmic growth stage of Bacteroides monocytogenes, when bacterial metabolism is active. The purpose of dilution is to reduce the concentration of Bacteroides monocytogenes to the required range for inoculation, to avoid excessive initial bacterial load leading to rapid depletion of nutrients in the culture medium. For example, if the culture is cultured to OD 600It can be 0.2, 0.3, 0.4, 0.5, 0.6.

[0071] In certain embodiments, dilution is performed with sterile saline.

[0072] Furthermore, the dilution multiple is 20 to 200 times, for example, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 110 times, 120 times, 130 times, 140 times, 150 times, 160 times, 170 times, 180 times, 190 times, or 200 times.

[0073] In certain embodiments, the concentration of the xyloglucan or its derivatives in the culture medium is 1~5 mg / mL. Within this range, it has a good proliferation-promoting effect on Bacteroides monocytogenes. A concentration that is too low is not enough to activate the metabolic enzymes of the bacteria, and the proliferation effect is not significant. A concentration that is too high may cause osmotic pressure imbalance, bacterial cell dehydration, growth inhibition, accumulation of metabolites, and undecomposed xyloglucan may inhibit the absorption of other nutrients. Specifically, the concentration of the xyloglucan or its derivatives in the culture medium can be 1 mg / mL, 1.5 mg / mL, 2 mg / mL, 2.5 mg / mL, 3 mg / mL, 3.5 mg / mL, 4 mg / mL, 4.5 mg / mL, and 5 mg / mL.

[0074] In certain embodiments, xyloglucan is poorly soluble in water and is preheated and dissolved in phosphate buffered saline (PBS) or basal culture medium, filtered and sterilized, and then added to the culture medium.

[0075] In certain embodiments, the xyloglucan or its derivative is added to the culture medium and stirred at 50°C for at least 4 hours to obtain the culture medium containing the xyloglucan or its derivative. Heating at 50°C can reduce the viscosity of xyloglucan, promote dissolution while maintaining its activity. The solubility of xyloglucan increases with increasing temperature, but excessively high temperature may cause molecular chain breakage or degradation into oligosaccharides, reducing its prebiotic effect. Stirring for 4 hours ensures sufficient dissolution and no excessive degradation. A magnetic stirrer can be used for stirring, and ultrasonic treatment can be added during the stirring process to further increase the dissolution rate.

[0076] In certain embodiments, Bacteroides monomorpha is inoculated into a culture medium containing xyloglucan or a derivative thereof and cultured under anaerobic conditions at 25-45° C. Specifically, the culture temperature can be 25° C., 27° C., 29° C., 31° C., 33° C., 35° C., 37° C., 39° C., 41° C., 43° C., or 45° C.

[0077] In certain embodiments, the culture medium is selected from Columbia Blood Solid Medium, Columbia Blood Somatic Medium, or Anaerobic Basal Broth.

[0078] In another embodiment of the present application, a method for culturing Bacteroides monomorpha is provided, comprising: inoculating the Bacteroides monomorpha in a culture medium containing xyloglucan or a derivative thereof to increase the abundance of the Bacteroides monomorpha. Specifically, the method includes the steps of strain activation, bacterial liquid preparation, inoculation, and anaerobic culture.

[0079] In certain embodiments, the xyloglucan is extracted from plants, specifically, tamarind, apple, Arabidopsis, pea, seaweed, wheat, corn, sugarcane, soybean and / or bamboo.

[0080] In certain embodiments, the Bacteroides monomorpha is cultured to an OD600 of 0.2 to 0.6, diluted, and inoculated into a culture medium containing the xyloglucan or its derivatives. 600 The dilution ratio can be 0.2, 0.3, 0.4, 0.5, or 0.6. The dilution multiple is 20 to 200 times, for example, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 110 times, 120 times, 130 times, 140 times, 150 times, 160 times, 170 times, 180 times, 190 times, or 200 times.

[0081] In certain embodiments, the concentration of xyloglucan or its derivative in the culture medium is 1-5 mg / mL, for example, 1 mg / mL, 1.5 mg / mL, 2 mg / mL, 2.5 mg / mL, 3 mg / mL, 3.5 mg / mL, 4 mg / mL, 4.5 mg / mL, or 5 mg / mL.

[0082] In certain embodiments, Bacteroides monomorpha is inoculated into a culture medium containing xyloglucan or a derivative thereof and cultured under anaerobic conditions at 25-45° C. Specifically, the culture temperature can be 25° C., 27° C., 29° C., 31° C., 33° C., 35° C., 37° C., 39° C., 41° C., 43° C., or 45° C.

[0083] In certain embodiments, the culture medium is selected from blood plate medium, Columbia blood medium, and anaerobic basic broth (ABB) medium.

[0084] In another embodiment of the present application, a culture for promoting the proliferation of Bacteroides monocytogenes is provided, comprising a basal culture medium and xyloglucan or a derivative thereof. The basal culture medium is the essential nutrient for microbial growth, providing Bacteroides monocytogenes with essential nutrients such as a carbon source, nitrogen source, inorganic salts, and growth factors. According to the basal culture medium formula, the various nutrients are accurately weighed, an appropriate amount of distilled water is added, and after heating to dissolve, the pH is adjusted to an appropriate range (generally 6.5-7.5). The culture is then dispensed into suitable containers, sterilized with high-pressure steam, and cooled for later use. Xyloglucan or a derivative thereof is added to the sterilized basal culture medium in a predetermined amount and thoroughly stirred to dissolve, thereby obtaining a culture for promoting the proliferation of Bacteroides monocytogenes. This culture can significantly promote the proliferation of Bacteroides monocytogenes and improve its physiological properties, thus possessing broad application prospects.

[0085] In certain embodiments, the concentration of xyloglucan or its derivative in the culture is 1-5 mg / mL, for example, 1 mg / mL, 1.5 mg / mL, 2 mg / mL, 2.5 mg / mL, 3 mg / mL, 3.5 mg / mL, 4 mg / mL, 4.5 mg / mL, or 5 mg / mL.

[0086] In certain embodiments, the basal culture medium is selected from Columbia Blood solid medium, Columbia Blood somatic medium, or Anaerobic Basic Broth (ABB) medium.

[0087] In another embodiment of the present application, a food composition is provided, comprising xyloglucan or a derivative thereof as an active ingredient. The food composition is used to regulate the balance of intestinal flora and increase the abundance of Bacteroides monomorpha. It can be added to various food matrices to create functional foods. These include, but are not limited to, dairy products (e.g., yogurt, cheese), cereal products (e.g., bread, biscuits), and beverages (e.g., juice, tea). The appropriate method and process for addition can be selected based on the characteristics of the various food matrices. The food composition is used to improve host metabolic syndrome, intestinal barrier function, or immune system status.

[0088] It is understandable that different food matrices have varying effects on the stability and bioavailability of xyloglucan or its derivatives. For example, the proteins and fats in dairy products may interact with xyloglucan, affecting its fermentation and metabolism; while dietary fiber in cereal products may compete with xyloglucan for fermentation substrates by intestinal flora. Therefore, when selecting a food matrix, its compatibility and synergistic effects with xyloglucan or its derivatives need to be comprehensively considered.

[0089] In certain embodiments, the preparation of the food composition comprises:

[0090] Obtaining raw materials of xyloglucan or its derivatives that meet quality standards, as well as corresponding food matrix raw materials;

[0091] Add xyloglucan or its derivatives to the food matrix according to the predetermined addition amount and mix thoroughly; select appropriate mixing equipment and methods according to the type of food to ensure uniform distribution of the active ingredients;

[0092] According to the characteristics of the food matrix, corresponding processing and molding operations are carried out. For example, for dairy products, fermentation and coagulation processes can be carried out; for cereal products, baking and molding processes can be carried out;

[0093] After processing and shaping, the food should be packaged using appropriate packaging materials and methods to ensure the quality and stability of the food. The packaged food should be stored in a suitable environment, such as room temperature, refrigeration or freezing.

[0094] In certain embodiments, the xyloglucan is derived from a plant extract. Preferably, the xyloglucan is derived from tamarind, apple, Arabidopsis, pea, seaweed, wheat, corn, sugarcane, soybean and / or bamboo.

[0095] In certain embodiments, the food composition is in the form of a prebiotic, a dairy starter culture, a dietary fiber supplement, or a medical formula food, suitable for human or animal nutritional intervention.

[0096] A prebiotic is a substance that selectively stimulates the growth and reproduction of one or a few beneficial bacteria in the intestine while remaining undigested and absorbed by the human body. A dairy starter culture is a type of microbial preparation that ferments dairy products. The starter culture in this application contains, in addition to traditional lactic acid bacteria (such as Lactobacillus bulgaricus and Streptococcus thermophilus), xyloglucan or its derivatives to enhance the fermentation effect and nutritional value of the product. A dietary fiber supplement is a product rich in dietary fiber. The supplement in this application contains xyloglucan or its derivatives as one of its main ingredients, combined with natural dietary fiber (such as oat fiber and apple fiber). Formulated foods for medical use are specially formulated to meet the specific nutrient or dietary needs of people with restricted food intake, digestive and absorption disorders, metabolic disorders, or specific disease states. The formulated foods for medical use in this application use xyloglucan or its derivatives as the primary nutritional intervention ingredient, combined with other nutrients (such as protein, fat, carbohydrates, vitamins, and minerals), to provide comprehensive nutritional support for specific populations while also regulating the intestinal flora and improving health.

[0097] In another embodiment of the present application, a pharmaceutical preparation is provided, which contains xyloglucan or its derivatives as an effective ingredient. Xyloglucan, as a natural polysaccharide, has multiple biological activities, such as immunomodulation, anti-oxidation, anti-tumor, etc. At the same time, it can promote the proliferation of Bacteroides monocytogenes. By preparing xyloglucan or its derivatives into pharmaceutical preparations, its pharmacological effects can be fully exerted, providing new options for the treatment of related diseases. The pharmaceutical preparation is used to prevent or treat diseases related to intestinal flora imbalance, and its mechanism of action partly depends on promoting the proliferation of Bacteroides monocytogenes, such as inflammatory bowel disease, obesity or metabolic syndrome.

[0098] In certain embodiments, the xyloglucan is derived from a plant extract. Preferably, the xyloglucan is derived from tamarind, apple, Arabidopsis, pea, seaweed, wheat, corn, sugarcane, soybean and / or bamboo.

[0099] In certain embodiments, the pharmaceutical preparation is in the form of a tablet, capsule, granule, oral solution, or rectal formulation. Specifically, xyloglucan or its derivative is uniformly mixed with excipients, granulated using a wet or dry granulation process, and then compressed into tablets. Excipients include fillers (such as starch, lactose), disintegrants (such as sodium carboxymethyl starch, cross-linked polyvinylpyrrolidone), lubricants (such as magnesium stearate, talc), and binders (such as povidone K30, hypromellose). The drug powder is then filled into hollow capsules to form capsules. After mixing the drug with excipients (such as sucrose powder, dextrin), water is added to form a soft material. The mixture is granulated using a granulator, dried, and packaged. The xyloglucan or its derivative is dissolved in an appropriate amount of solvent, such as purified water or ethanol, to form an oral solution. The solvent is selected based on the solubility and stability of the drug. Xyloglucan or its derivatives are mixed evenly with a matrix in a certain proportion, heated and melted to fully disperse the drug in the matrix to prepare a rectal preparation. According to the properties of the drug and the requirements of administration, a suitable matrix such as polyethylene glycol, glycerol gelatin, etc. is selected.

[0100] In certain embodiments, the pharmaceutical formulation is used in combination with antibiotics, probiotics, or immunomodulators.

[0101] In another embodiment of the present application, a biological feed additive is provided, comprising xyloglucan or a derivative thereof, and used to promote the proliferation of Bacteroides monomorpha in the intestines of livestock and poultry, thereby improving the intestinal health of the animals and increasing feed conversion rate.

[0102] In certain embodiments, the xyloglucan is derived from a plant extract. Preferably, the xyloglucan is derived from tamarind, apple, Arabidopsis, pea, seaweed, wheat, corn, sugarcane, soybean and / or bamboo.

[0103] In certain embodiments, the biological feed additive can be a powder or a liquid. For example, xyloglucan is mixed with a carrier (such as diatomaceous earth) to form a particle size of 80-200 mesh to form a separate body; a preservative (such as potassium sorbate) is added to a xyloglucan aqueous solution to form a liquid.

[0104] The technical solution of this application is further explained below with reference to specific examples.

[0105] Example 1 Recovery culture and identification of Bacteroides monomorpha

[0106] The Bacteroides uniformis ATCC8492 and Bacteroides ovatus ATCC8483 used were purchased from the Beina Biological Microbial Strain Engineering Technology Research Center.

[0107] 1.1 Recovery culture of Bacteroides monomorpha and Bacteroides ovatus

[0108] The culture medium for the strain was: ① Columbia solid blood medium, containing: special peptone: 23.0 g / L, soluble starch: 1.0 g / L, sodium chloride: 5.0 g / L, agar: 10.0 g / L, defibrinated sheep blood: 5 vt% (added at 50°C), pH: 7.3±0.2 (25°C); ② Columbia liquid blood medium, containing: special peptone: 23.0 g / L, soluble starch: 1.0 g / L, sodium chloride: 5.0 g / L, defibrinated sheep blood: 5 vt% (added at 50°C), pH: 7.3±0.2 (25°C).

[0109] Specific process: ① Prepare two Columbia solid blood culture plates mentioned above; ② After disinfecting the surface of the ampoule tube, open it in a safety cabinet, burn the top with an alcohol lamp, and then quickly drip sterile water to break it, and then break it with tweezers; ③ Pipette 0.5mL of sterile water (placed in an anaerobic environment for 24 hours) into a lyophilized tube, fully dissolve the bacterial powder, and then spread it onto two plates, 200μL / plate, and apply it evenly; ④ Incubate the plates at 37℃ under anaerobic conditions for 48 hours; after 48 hours of incubation, pick a single colony from the marked plate and transfer it to a Columbia liquid blood culture plate, and incubate it at 37℃ under anaerobic conditions for 48 hours to complete the recovery culture.

[0110] 1.2 Identification of Bacteroides monomorpha

[0111] Bioinformatics analysis of the Bacteroides monomorpha genome revealed that its genome contains the key enzyme GH74 for xyloglucan degradation, while other similar Bacteroides species, such as Bacteroides ovatus, do not contain these enzymes. Therefore, specific primers were designed to detect the expression of this key enzyme. According to the instructions of the bacterial genomic DNA extraction kit (Tiangen Biochemical Technology Co., Ltd., Cat. No.: DP302-02), genomic DNA of Bacteroides monomorpha and Bacteroides ovatus was extracted and the DNA concentration and purity were tested. 260 / OD 280 A ratio in the range of 1.7 to 1.9 is considered acceptable.

[0112] PCR amplification of 16S rRNA fragments was performed using the extracted genomic DNA from each strain as a template. The PCR amplification process was as follows: the PCR amplification system shown in Table 1 was prepared and placed in a sterile, enzyme-inactivated PCR tube. The tube was briefly centrifuged and PCR amplification was performed according to the PCR amplification conditions shown in Table 2.

[0113] Table 1 PCR amplification system

[0114]

[0115] Among them, the upstream primer (F) of P_GH74 is GCCATGTTTACCACCGGTTT; the downstream primer (R) is AGGTCGAAATGCGTAAAGCC.

[0116] Table 2 PCR amplification conditions

[0117]

[0118] The results are as follows Figure 1 As shown, Figure 1 The gel electrophoresis diagram of P_GH74 amplification is shown, where lane 1 shows the amplification result using the genome of Bacteroides monomorpha, and lane 2 shows the amplification result using the genome of Bacteroides ovatus. This shows that Bacteroides monomorpha possesses the GH74 gene, a key enzyme for degrading xyloglucan, while this gene was not detected in Bacteroides ovatus.

[0119] Example 2 Effect of Xyloglucan on the Proliferation of Bacteroides monomorpha

[0120] 2.1 Preparation of xyloglucan-added culture medium

[0121] Xyloglucan was purchased from Puxitang Company, product number: 37294-28-3. Xyloglucan powder was slowly added to the stirred culture medium and dissolved in the culture medium at a concentration of 2 mg / mL. Stirring was continued at 50°C for at least 4 hours.

[0122] 2.2 Bacteroides monomorpha proliferation experiment

[0123] Anaerobic basic broth (ABB) medium was used for the Bacteroides monomorpha growth assay. This medium primarily provides a suitable growth environment for anaerobic microorganisms, rather than directly providing a large carbon source. The composition of this medium typically includes amino acids, a nitrogen source, and vitamins, primarily to meet the basic growth requirements of anaerobic bacteria. ABB medium contains: 16.0 g peptone, 7.0 g yeast extract, 5.0 g sodium chloride, 1.0 g starch, 1.0 g glucose, 1.0 g sodium pyruvate, 1.0 g arginine, 0.5 g sodium succinate, 0.5 g cysteine hydrochloride, 0.4 g sodium bicarbonate, 0.5 g ferric pyrophosphate, 0.005 g hemin, 0.0005 g vitamin K, 0.5 g sodium thioglycolate, and 1.0 g dithiothreitol. The pH is 6.8 ± 0.2 (25°C).

[0124] The revived Bacteroides monomorpha ATCC8492 and Bacteroides ovatus from Example 1 were cultured to OD 600 The bacterial strains were diluted 50 times to 0.4 and inoculated into equal volumes of ABB culture medium containing or without xyloglucan. The cultures were cultured at 37°C under anaerobic conditions. The OD values of the bacteria were detected at different time points. 600 A growth curve was plotted. Xyloglucan powder was slowly added to the stirred culture medium to dissolve it in the culture medium at a concentration of 2 mg / mL. Stirring was continued at 50°C for 4 hours to obtain a culture medium containing xyloglucan.

[0125] The results of the effects of culture medium containing or not containing xyloglucan on the proliferation of Bacteroides monomorpha are as follows Figure 2 As shown. Figure 2 It can be seen that xyloglucan significantly improves the proliferation of Bacteroides monocytogenes ATCC8492 after being added into the culture medium. Xyloglucan not only accelerates the proliferation rate of Bacteroides monocytogenes, but also improves the maximum proliferation capacity of Bacteroides monocytogenes.

[0126] In order to compare the effect of xyloglucan on the proliferation of other Bacteroides, the present application conducted the same proliferation experiment using Bacteroides ovatus ATCC8483. Figure 3 As shown, the results showed that the addition of xyloglucan could not significantly improve the proliferation ability of Bacteroides ovatus.

[0127] Example 3 Effect of xyloglucan content on the proliferation of Bacteroides monomorpha

[0128] In order to compare the effects of culture solutions containing different xyloglucan contents on the proliferation of Bacteroides monomorpha, ABB culture solutions containing 0.5 mg / mL, 1 mg / mL, 2 mg / mL, and 4 mg / mL xyloglucan were prepared, and the revived Bacteroides monomorpha ATCC8492 and Bacteroides ovatus from Example 1 were cultured to OD 600The OD value of the bacteria was 0.4, diluted 50 times, and cultured at 37℃ under anaerobic conditions after inoculation. 600 The xyloglucan powder was slowly added to the stirred culture solution, and the stirring was continued at 50° C. for 4 hours to obtain a culture solution containing xyloglucan.

[0129] The results are as follows Figure 4 As shown, the results showed that the addition of 1 mg / mL, 2 mg / mL, and 4 mg / mL xyloglucan could significantly increase the proliferation of Bacteroides monocytogenes, among which the proliferation of Bacteroides monocytogenes tended to increase with the increase of xyloglucan concentration.

[0130] Although the embodiments of the present application are described above, the present application is not limited to the above-mentioned specific embodiments and application fields. The above-mentioned specific embodiments are merely illustrative and instructive, and not restrictive. A person of ordinary skill in the art, guided by this specification and without departing from the scope of protection of the claims of this application, may also devise various forms, all of which fall within the scope of protection of this application.

Claims

1. A use of a polysaccharide in promoting the proliferation of Bacteroides monomorpha, characterized in that: The polysaccharide is xyloglucan or its derivatives.

2. The use according to claim 1, characterized in that The xyloglucan is derived from tamarind, apple, Arabidopsis, pea, seaweed, wheat, corn, sugarcane, soybean and / or bamboo.

3. The use according to claim 1, characterized in that The Bacteroides monomorpha is inoculated into a culture medium containing the xyloglucan or its derivatives and cultured to increase the abundance of the Bacteroides monomorpha.

4. The use according to claim 3, characterized in that The Bacteroides monomorpha was cultured to OD 600 The concentration of xyloglucan is 0.2-0.6, and after dilution, the mixture is inoculated into a culture medium containing the xyloglucan or its derivatives for cultivation.

5. The use according to claim 4, characterized in that The dilution multiple is 20 to 200 times; The concentration of the xyloglucan or its derivative in the culture medium is 1-5 mg / mL; The volume ratio of the xyloglucan or its derivative to the culture medium is 1:

1.

6. The use according to claim 3, characterized in that The xyloglucan or its derivative is added to the culture medium, and stirred at 50° C. for at least 4 hours to obtain the culture medium containing the xyloglucan or its derivative.

7. A method for culturing Bacteroides monomorpha, characterized in that: include: The Bacteroides monomorpha is inoculated into a culture medium containing the xyloglucan or its derivatives for cultivation to increase the abundance of the Bacteroides monomorpha.

8. A culture for promoting the proliferation of Bacteroides monomorpha, characterized in that The culture comprises a basal medium and xyloglucan or a derivative thereof; The basal culture medium is selected from Columbia blood solid medium, Columbia blood somatic medium or anaerobic basal broth medium; The concentration of the xyloglucan or its derivative in the culture is 1-5 mg / mL.

9. A food composition, characterized in that The composition comprises xyloglucan or a derivative thereof and is used for regulating the balance of intestinal flora and increasing the abundance of Bacteroides monotypica.

10. A pharmaceutical preparation, characterized in that The pharmaceutical preparation contains xyloglucan or a derivative thereof; the pharmaceutical preparation is used to prevent or treat diseases associated with intestinal flora imbalance, and its mechanism of action partially depends on promoting the proliferation of Bacteroides monocytogenes.

Images