Garlic-derived exosome-like nano-vesicles, extraction method thereof and application of nano-vesicles in acute lung injury

Abstract

The invention provides garlic-derived exosome-like nano-vesicles as well as an extraction method and application thereof in acute lung injury, and belongs to the technical field of biological medicines. The invention provides an extraction method of garlic-derived exosome-like nano-vesicles, which comprises the following steps: adjusting to five times of centrifugation, sequentially increasing centrifugal force, and after the five times of centrifugation, precipitate contains the garlic-derived exosome-like nano-vesicles. By utilizing the garlic-derived exosome-like nano-vesicle, the content of inflammatory factors in mouse alveolar lavage fluid and lung tissues can be reduced, and the mRNA expression level can be reduced; the mouse lung tissue expression of cGAS, Sting, TBK1, p-TBK1, IRF3, p-IRF3, p65 and p-p65 is reduced, the cGAS / Stin / NF-kappa B signal channel is regulated, and the occurrence and development of acute lung injury are effectively retarded.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to garlic-derived exosome-like nanovesicles, an extraction method thereof, and an application thereof in acute lung injury. Background Art

[0002] Acute lung injury (ALI) is a severe inflammatory disease associated with alveolar damage, subsequent macrophage activation, inflammatory cell infiltration, and cytokine production. It is characterized by acute lung tissue damage and subsequent impairment of lung tissue and function caused by various pulmonary and systemic insults, such as infection, chemical exposure, and mechanical injury. Despite the continuous advancement of medical technology and treatment options, the mortality rate of ALI remains high, ranging from 35% to 55%, and no effective drug treatment options have been found for ALI. Therefore, the development of potentially therapeutic drugs is of great significance for the treatment of ALI. It is currently believed that the systemic inflammatory response following infection and trauma is the root cause of ALI. Controlling the primary disease and curbing the uncontrolled systemic inflammatory response it induces is essential for the prevention and treatment of ALI. In recent years, the discovery of safe and effective anti-acute lung injury substances from natural plants as alternatives to and adjunctive treatments for ALI has become an important research direction.

[0003] Exosomes possess unique morphology and compositional characteristics. They are contained within multivesicular bodies formed by the fusion of multiple endosomes with the plasma membrane. They are vesicles with a diameter of 30 to 150 nm and have a lipid bilayer membrane structure. Exosomes carry characteristic bioinformatics molecules from maternal cells, such as proteins, lipids, DNA, and non-coding RNA, and possess natural molecular transport properties and excellent biocompatibility. Research on exosomes has rapidly advanced in recent years, primarily focusing on cardiovascular, oncology, nervous system, and stem cell research. However, research on exosomes, both domestically and internationally, has primarily focused on animal exosomes, while research on plant exosomes is still in its early stages. Although little is known about their origin, composition, and function, some studies have suggested that plant-derived exosomes may participate in intercellular communication and serve as a means of regulating plant innate immunity.

[0004] Garlic (Allium sativum L., commonly known as garlic, garlic, garlic head, garlic), a plant of the genus Allium in the Liliaceae family, is an essential condiment in daily diets and is also commonly used as a medicinal plant for disease prevention and treatment. It contains a variety of bioactive compounds, including organosulfur compounds, saponins, polyphenols, and polysaccharides. The main pharmacological effects of garlic and its active ingredients include antioxidant, lipid-lowering, antitumor, antibacterial, and anti-infective properties, as well as nutritional and medicinal benefits. They have preventive and ameliorative effects on common diseases, including cancer and metabolic disorders. Furthermore, garlic and its extracts have been reported to exhibit anti-inflammatory activity, with garlic extract significantly alleviating liver inflammation and damage caused by Eimeria nipple infection. Garlic, with its nutritional composition and potent bioactivity, makes it a promising source for extracting plant-derived exosome-like vesicles. However, whether garlic-derived exosome-like nanovesicles have biological effects on acute lung injury remains unresolved. Summary of the Invention

[0005] The present invention provides garlic-derived exosome-like nanovesicles, an extraction method thereof, and an application thereof in acute lung injury. The garlic-derived exosome-like nanovesicles can be used to treat diseases such as acute lung injury by regulating the expression of cGAS / Sting / NF-κB.

[0006] The present invention provides a method for extracting garlic-derived exosome-like nanovesicles, comprising: using garlic juice as a raw material, sequentially performing a first centrifugation, a second centrifugation, a third centrifugation, and a fourth centrifugation; performing a fifth centrifugation on the supernatant obtained by the fourth centrifugation; wherein the precipitate obtained by the fifth centrifugation contains the garlic-derived exosome-like nanovesicles;

[0007] The centrifugal force of the first centrifugation is 1500-2500g, the centrifugal force of the second centrifugation is 3000-4000g, the centrifugal force of the third centrifugation is 4500-5500g, the centrifugal force of the fourth centrifugation is 9500-10500g, and the centrifugal force of the fifth centrifugation is 110000-130000g.

[0008] In a preferred embodiment of the present invention, the first centrifugation time is 15 to 25 minutes, the second centrifugation time is 35 to 45 minutes, the third centrifugation time is 35 to 45 minutes, the fourth centrifugation time is 35 to 45 minutes, and the fifth centrifugation time is 115 to 125 minutes.

[0009] The present invention also provides the use of exosome-like nanovesicles extracted by the above extraction method in preparing a reagent for regulating the cGAS / Sting / NF-κB signaling pathway.

[0010] In a preferred embodiment of the present invention, the zeta potential of the exosome-like nanovesicles is -7.8 mA and the particle size is 140 to 160 nm.

[0011] In a preferred embodiment of the present invention, the regulation of the cGAS / Sting / NF-κB signaling pathway includes reducing the expression of at least one of the following proteins: cyclic GMP-AMP synthase, interferon gene stimulator protein, TANK binding kinase 1, phosphorylated TANK binding kinase 1, interferon regulatory factor 3, phosphorylated interferon regulatory factor 3, p65 protein and p-p65 protein.

[0012] The present invention also provides the use of exosome-like nanovesicles extracted by the above extraction method in preparing a reagent for reducing the expression of inflammatory factors.

[0013] In a preferred embodiment of the present invention, the inflammatory factors include at least one of the following: IL-6, IL-1β and TNF-α.

[0014] The present invention also provides the use of exosome-like nanovesicles extracted by the above extraction method in the preparation of a drug for treating acute lung injury.

[0015] The present invention also provides a drug for treating acute lung injury, the active ingredients of which include exosome-like nanovesicles extracted using the above-mentioned extraction method, or purified exosome-like nanovesicles, and also include pharmaceutically acceptable excipients.

[0016] In a preferred embodiment of the present invention, the dosage of the exosome-like nanovesicles is not less than 25 mg / kg per mouse.

[0017] Beneficial Effects: The present invention provides a method for extracting garlic-derived exosome-like nanovesicles. This method further improves existing methods by adjusting the centrifugation cycle to five times, with the centrifugal force gradually increasing. After these five centrifugations, the precipitate contains the garlic-derived exosome-like nanovesicles. The garlic-derived exosome-like nanovesicles have a zeta potential of -7.8 mA and a particle size of 140 to 160 nm.

[0018] In the embodiment of the present invention, LPS was used to construct an acute lung injury model in mice, and it was confirmed that the use of garlic-derived exosome-like nanovesicles can reduce the content of IL-6 and TNF-α inflammatory factors in the alveolar lavage fluid of mice; and garlic-derived exosome-like nanovesicles can reduce the IL-1β and TNF-α inflammatory factors in the lung tissue of mice; reduce the expression of IL-6, IL-1β and TNF-α at the mRNA level in the lung tissue of mice; reduce the expression of cGAS (cyclic GMP-AMP synthase), Sting (interferon gene stimulating protein), TBK1 (TANK binding kinase 1), p-TBK1 (phosphorylated TANK binding kinase 1), IRF3 (interferon regulatory factor 3), p-IRF3 (phosphorylated interferon regulatory factor 3), p65, and p-p65 proteins in the lung tissue of mice. The present invention reveals for the first time that garlic-derived exosome-like nanovesicles can effectively reduce LPS-induced lung tissue damage in mice, regulate the cGAS / Sting / NF-κB signaling pathway, and effectively slow down the occurrence and development of acute lung injury. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Schematic diagram of the isolation and purification process of garlic-derived exosome-like nanovesicles;

[0020] Figure 2 Figure 1 shows the characterization results of garlic-derived exosome-like nanovesicles. A is a transmission electron microscopy image, B is the Zeta potential, C is a statistical diagram of the particle size of the exosome-like nanovesicles, and D is a diagram of the miRNA content composition.

[0021] Figure 3 Figure 2 shows the effect of garlic-derived exosome-like nanovesicles on the pathological damage of lung tissue in mice with LPS-induced acute lung injury and the corresponding scoring diagram. Figure A shows HE staining of lung tissue, and Figure B shows the statistical results of the acute lung injury score.

[0022] Figure 4 This figure shows the effect of garlic-derived exosome-like nanovesicles on the levels of inflammatory factors in the bronchoalveolar lavage fluid of mice with LPS-induced acute lung injury. In the figure, A is the level of IL-6 and B is the level of TNF-α.

[0023] Figure 5 This figure shows the effect of garlic-derived exosome-like nanovesicles on inflammatory factor proteins in the lung tissue of mice with acute lung injury induced by LPS. In the figure, A is TNF-α protein and B is IL-1β protein.

[0024] Figure 6 This figure shows the effect of garlic-derived exosome-like nanovesicles on the mRNA expression of inflammatory factors in mouse lung tissue induced by LPS;

[0025] Figure 7This figure shows the effect of garlic-derived exosome-like nanovesicles on the expression of cGAS, Sting, TBK1, p-TBK1, IRF3, and p-IRF3 proteins in LPS-induced mouse lung tissue;

[0026] Figure 8 This figure shows the effect of garlic-derived exosome-like nanovesicles on the expression of p65 and p-p65 proteins in LPS-induced mouse lung tissue. DETAILED DESCRIPTION

[0027] The present invention provides a method for extracting garlic-derived exosome-like nanovesicles, comprising: using garlic juice as a raw material, sequentially performing a first centrifugation, a second centrifugation, a third centrifugation, and a fourth centrifugation; performing a fifth centrifugation on the supernatant obtained by the fourth centrifugation; wherein the precipitate obtained by the fifth centrifugation contains the garlic-derived exosome-like nanovesicles;

[0028] The centrifugal force of the first centrifugation is 1500-2500g, the centrifugal force of the second centrifugation is 3000-4000g, the centrifugal force of the third centrifugation is 4500-5500g, the centrifugal force of the fourth centrifugation is 9500-10500g, and the centrifugal force of the fifth centrifugation is 110000-130000g.

[0029] The garlic juice of the present invention is obtained by squeezing fresh garlic. For example, in one embodiment, 300 g of fresh garlic is washed three times and then juiced, and 80 ml of PBS is added to dilute the juice.

[0030] The present invention centrifuges garlic juice diluted with PBS under low temperature conditions. The low temperature can be 0-4°C, such as 0°C, 1°C, 2°C, 3°C or 4°C. In one embodiment, 4°C is used as an example for illustration, but it cannot be considered as the entire protection scope of the present invention.

[0031] The centrifugation of the present invention is to perform centrifugation in sequence, and use the supernatant after centrifugation for the next centrifugation, and finally collect the precipitate during the fifth centrifugation, wherein the centrifugal force of the first centrifugation is 1500-2500g, such as 1500g, 1600g, 1700g, 1800g, 1900g, 2000g, 2100g, 2200g, 2300g, 2400g or 2500g; the time is 15-25min, such as 15min, 16min, 17min, 18min, 19min, 20min, 21min, 22min, 23min, 24min or 25min. In one embodiment, the first centrifugation is performed at 2000g for 20min to remove large cell debris, nuclear fragments, fibers or starch particles.

[0032] The centrifugal force of the second centrifugation of the present invention is 3000-4000g, such as 3000g, 3100g, 3200g, 3300g, 3400g, 3500g, 3600g, 3700g, 3800g, 3900g or 4000g; the time is 35-45min, such as 35min, 36min, 37min, 38min, 39min, 40min, 41min, 42min, 43min, 44min or 45min. In one embodiment, the second centrifugation is performed at 3500g for 40min to remove nuclear fragments, large organelles, large vesicles or membrane fragments.

[0033] The centrifugal force of the third centrifugation of the present invention is 4500-5500g, such as 4500g, 4600g, 4700g, 4800g, 4900g, 5000g, 5100g, 5200g, 5300g, 5400g or 5500g, and the time is 35-45min, such as 35min, 36min, 37min, 38min, 39min, 40min, 41min, 42min, 43min, 44min or 45min. In one embodiment, the third centrifugation is performed at 5000g for 40min to remove mitochondria, chloroplast fragments, lysosomes, peroxisomes, and large vesicles.

[0034] The centrifugal force of the fourth centrifugation of the present invention is 9500-10500g, such as 9500g, 9600g, 9700g, 9800g, 9900g, 10000g, 10100g, 10200g, 10300g, 10400g or 10500g, and the time is 35-45min, such as 35min, 36min, 37min, 38min, 39min, 40min, 41min, 42min, 43min, 44min or 45min. In one embodiment, the fourth centrifugation is performed at 10000g for 40min to remove residual organelle fragments, large lipoprotein complexes, and some microvesicles.

[0035] The centrifugal force of the fifth centrifugation of the present invention is 110000~130000g, such as 110000g, 120000g or 130000g, and the time is 115~125min, such as 115min, 116min, 117min, 118min, 119min, 120min, 121min, 122min, 123min, 124min or 125min. In one embodiment, the fifth centrifugation is performed at 120000g for 120min to obtain the final exosome-like nanovesicles.

[0036] After obtaining the garlic-derived exosome-like nanovesicle precipitate, the present invention can further perform purification. The purification comprises resuspending the garlic-derived exosome-like nanovesicles with PBS and then purifying them using a sucrose density gradient (8%, 30%, 45%, 60%). The purification comprises centrifuging at 150,000 g for 120 minutes, collecting the sedimentation bands between the 30% and 45% interfaces, diluting with PBS, and centrifuging at 150,000 g for 120 minutes in an ultracentrifuge. The supernatant is discarded, and the bottom precipitate is resuspended in PBS, and filtered through a 0.22 μm microporous membrane to obtain a purified garlic-derived exosome-like nanovesicle suspension.

[0037] The present invention also provides the use of exosome-like nanovesicles extracted by the above extraction method in preparing a reagent for regulating the cGAS / Sting / NF-κB signaling pathway.

[0038] In a preferred embodiment of the present invention, the zeta potential of the exosome-like nanovesicles is -7.8 mA, the particle size is 140 to 160 nm, and the exosome-like nanovesicles are rich in multiple miRNAs, especially osa-miR166g-3p, with a content of up to 50.22%.

[0039] In a preferred embodiment of the present invention, the regulation of the cGAS / Sting / NF-κB signaling pathway includes reducing the expression of at least one of the following proteins: cGAS (cyclic GMP-AMP synthase), Sting (interferon gene stimulator protein), TBK1 (TANK binding kinase 1), p-TBK1 (phosphorylated TANK binding kinase 1), IRF3 (interferon regulatory factor 3), p-IRF3 (phosphorylated interferon regulatory factor 3), p65, and p-p65 protein.

[0040] The present invention also provides the use of exosome-like nanovesicles extracted by the above extraction method in preparing a reagent for reducing the expression of inflammatory factors.

[0041] In a preferred embodiment of the present invention, the inflammatory factors include at least one of the following: IL-6, IL-1β, and TNF-α. In one embodiment of the present invention, the garlic-derived exosome-like nanovesicles can reduce the levels of IL-6 and TNF-α in mouse bronchoalveolar lavage fluid; reduce the levels of IL-1β and TNF-α in mouse lung tissue; and reduce the mRNA expression of IL-6, IL-1β, and TNF-α in mouse lung tissue.

[0042] The present invention also provides the use of exosome-like nanovesicles extracted by the above extraction method in the preparation of a drug for treating acute lung injury.

[0043] The present invention discloses for the first time in the examples that the garlic-derived exosome-like nanovesicles can effectively reduce LPS-induced lung tissue damage in mice, regulate the cGAS / Sting / NF-κB signaling pathway, and thus effectively slow down the occurrence and development of acute lung injury. Therefore, they can be used to prepare drugs for the treatment of acute lung injury.

[0044] The present invention also provides a drug for treating acute lung injury, the active ingredients of which include exosome-like nanovesicles extracted using the above-mentioned extraction method, or purified exosome-like nanovesicles, and also include pharmaceutically acceptable excipients.

[0045] In a preferred embodiment of the present invention, the dosage of the exosome-like nanovesicles is not less than 25 mg / kg in mice. The present invention does not specifically limit the dosage form of the drug, and conventional dosage forms can be prepared using conventional excipients in the art.

[0046] To further illustrate the present invention, the garlic-derived exosome-like nanovesicles, their extraction method, and their application in acute lung injury provided by the present invention are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0047] Example 1 Extraction of garlic-derived exosome-like nanovesicles (GAELNs)

[0048] according to Figure 1 The following process was used to extract and purify garlic-derived exosome-like nanovesicles: 300 g of fresh garlic was washed three times, juiced, diluted with 80 ml of PBS, and mixed thoroughly. The collected diluted garlic juice was centrifuged at 4°C for 20 minutes at 2000 g, 40 minutes at 3500 g, 40 minutes at 5000 g, and 40 minutes at 10,000 g to remove large particles and cellular debris. The resulting mixture was then centrifuged in an ultracentrifuge at 120,000 g for 120 minutes to obtain a pellet of garlic-derived exosome-like nanovesicles.

[0049] Resuspend the garlic-derived exosome-like nanovesicle pellet in PBS buffer. Transfer 2 mL of the resuspension to a sucrose density gradient (8%, 30%, 45%, and 60%) and centrifuge at 150,000 g for 120 minutes. Sedimentation bands between the 30% and 45% gradients were collected, diluted with PBS, and centrifuged at 150,000 g for 120 minutes in an ultracentrifuge. Discard the supernatant, resuspend the pellet in an appropriate amount of PBS, and filter through a 0.22 μm microporous membrane to obtain the purified garlic-derived exosome-like nanovesicle suspension.

[0050] The morphology, particle size and Zeta potential of garlic-derived exosome-like nanovesicles are shown in Figure 2. Figure 2 As shown. Under transmission electron microscopy, the morphology of exosome-like vesicles can be visually seen. Garlic-derived exosome-like nanovesicles are basically round or saucer-shaped vesicles with non-uniform shapes ( Figure 2 The zeta potential of garlic-derived exosome-like nanovesicles in aqueous solution is -7.8 mV, indicating that GAELNs are stable ( Figure 2 The particle size of the prepared GAELNs is about 150 nm ( Figure 2 GAELNs were enriched in a variety of miRNAs, with the top five miRNAs being osa-miR166g-3p (SEQ ID No.9:TCTCGGACCAGGCTTCATTCC), osa-miR159a.1 (SEQ ID No.10:TTTGGATTGAAGGGAGCTCT), osa-miR396c-5p (SEQ ID No.11:TTCCACGGCTTTCTTGAACTG), osa-miR396a-5p (SEQ ID No.12:TTCCACGGCTTTCTTGAACTG), and osa-miR167d-5p (SEQ ID No.13:TGAAGCTGCCAGCATGATCTGA), accounting for 88.50% of the total miRNA content, of which the content of osa-miR166g-3p was as high as 50.22% ( Figure 2 In addition, the protein concentration of garlic-derived exosome-like nanovesicles was measured to be 1.7 mg / mL using BCA protein quantification method with bovine serum albumin as the standard. The concentration of garlic-derived exosome-like nanovesicles was detected to be 3.4×10 10 particles / mL.

[0051] Example 2: Experimental study on garlic-derived exosome-like nanovesicles (GAELNs) extracted from Example 1

[0052] 1. Establishing a mouse acute lung injury model using LPS

[0053] Four- to six-week-old ICR male mice weighing 18-22 g were purchased from the Experimental Animal Center of Ningxia Medical University. They were housed for 7 days before the experiment to acclimate to the environment. The mice were maintained at a room temperature of 22 ± 1°C, a relative humidity of 50 ± 5%, and a 12-h light-dark cycle. Food and water were available ad libitum.

[0054] ICR mice were randomly divided into four groups: control, model (LPS), DXM (positive control), and drug-treated (LPS + GAELNs) groups. The drug-treated groups also included LPS + L-GAELNs (25 mg / kg), LPS + M-GAELNs (50 mg / kg), and LPS + H-GAELNs (100 mg / kg), with 12 mice in each group. Drug-treated groups were given GAELNs and dexamethasone (positive control) by gavage at the beginning of the experiment. The blank and model groups received the same dose of PBS.

[0055] On day 7 of the experiment, an acute lung injury model was established in mice by intratracheal instillation of LPS (5 mg / kg) one hour after oral gavage. LPS was dissolved in saline to prepare a 5 mg / kg solution, which was administered to all mice except the blank control group. The blank control group was also given an intraperitoneal injection of 0.1 mL / 10 g of saline. Twenty-four hours after modeling, the animals were sacrificed, and bronchoalveolar lavage fluid and lung tissue samples were collected.

[0056] 2. Use kits to detect the effects of IL-6 and TNF-α levels in mouse bronchoalveolar lavage fluid (BALF). The tissues were collected according to the kit instructions, and the BALF was centrifuged at 1500 rpm for 10 minutes at 4°C. The supernatant was then collected and the IL-6 and TNF-α levels in the mouse BALF were determined according to the kit instructions.

[0057] 3. Detect the effects of IL-1β and TNF-α levels on lung inflammation in mice using test kits. Tissues were added to 9x normal saline according to the kit instructions and ground into a 10% tissue homogenate. The supernatant was centrifuged and the IL-1β and TNF-α levels in mouse lung tissue were determined according to the kit instructions.

[0058] 3. RT-PCR was used to detect the mRNA levels of IL-1β, IL-6, and TNF-α, indicators of lung inflammation in mice. The primer sequences are shown in Table 1. Total RNA was extracted from the tissue according to the requirements of the RNA extraction kit. Based on the measured RNA concentration, the amount of total RNA in the system was determined to be 1 μg. After the system was prepared, it was mixed and placed in the PCR for reverse transcription. The reverse transcription product was then subjected to real-time fluorescence PCR experiments according to the system specified in the kit. The expression of IL-1β, IL-6, and TNF-α mRNA in the lung tissues of each experimental group of mice was detected by RT-PCR, with GAPDH as the internal reference.

[0059] Table 1 Primer sequences

[0060]

[0061] 4. The lung tissues of mice were collected and the expression of cGAS, Sting, TBK1, p-TBK1, IRF3, p-IRF3, p65, and p-p65 proteins in the lung tissues of each group of mice was detected by Western blot.

[0062] 5. Data processing: SPSS was used for data analysis and statistics in this study, and the results were expressed as mean ± standard deviation. The differences among the groups were compared using one-way ANOVA, and the difference was considered statistically significant when p < 0.05 was used as the standard.

[0063] 6. Experimental Results

[0064] 6.1 HE staining

[0065] The lung tissues of mice were collected and stained with HE to observe the effects of drug administration on lung tissues. Figure 3 As shown, the alveolar structure of the mice in the Control group was intact, with a small amount of inflammatory cell infiltration in the pulmonary interstitium and alveolar cavity, very little bleeding in the alveolar cavity, no congestion, and no hyaline membrane formation. Compared with the Control group, the mice in the LPS group showed typical pathological manifestations of mice with acute lung injury, with destruction and collapse of the alveolar structure of the lung tissue, thickening of the pulmonary interstitium accompanied by congestion of the alveolar cavity, and a large number of inflammatory cells such as neutrophils and macrophages infiltrating and gathering in the alveolar space. Compared with the LPS group, GAELNs and dexamethasone in each dose group significantly reduced the pathological damage of the lung tissue in LPS-induced acute lung injury, significantly improved the inflammatory infiltration in the pulmonary interstitium and alveolar space, reduced the degree of pulmonary edema and the congestion of the alveolar wall, and the most significant reduction in lung tissue pathological damage was observed when GAELNs was 100 mg / kg ( Figure 3 Middle A).

[0066] After HE staining of lung tissue sections, the lung injury scoring system (Table 2) was used to score the lung tissues of the animals in each group and evaluate the severity of lung tissue injury. Figure 3 As shown in Figure B, the lung tissue damage in the LPS group was more severe, with a significantly higher pathological score than in the control group (p < 0.05), demonstrating that tracheal instillation of LPS in mice can successfully induce acute lung injury. Compared with the LPS group, increasing the dose of GAELNs resulted in a dose-dependent decrease in lung injury scores, demonstrating a statistically significant improvement in acute lung injury. These results demonstrate that GAELNs can mitigate lung tissue damage in mice with LPS-induced acute lung injury.

[0067] Table 2 Scoring criteria for mouse lung tissue pathology sections

[0068] score Lung tissue damage degree 0 Normal lung tissue No minor injuries or minor 1 Less than 25% lung tissue damage Minor injury 2 Lung tissue damage 25% to 50% Moderate injury 3 Lung tissue damage 50% to 75% severe injury 4 Lung tissue damage greater than 75% Extremely severe injury

[0069] Effects of garlic-derived exosome-like nanovesicles (GAELNs) on the levels of inflammatory factors in bronchoalveolar lavage fluid of mice with LPS-induced acute lung injury

[0070] The results are as follows Figure 4 As shown in the results, GAELNs can reduce the levels of IL-6 and TNF-α in the lung tissue of mice. The levels of IL-6 and TNF-α in the bronchoalveolar lavage fluid of mice in each group were detected. Compared with the control group, the LPS group significantly increased the levels of IL-6 (p<0.001) and TNF-α (p<0.001) in the bronchoalveolar lavage fluid, and the difference was statistically significant. Compared with the LPS group, garlic-derived exosome-like nanovesicles effectively reduced the increase in the levels of IL-6 (p<0.01), (p<0.001) and TNF-α (p<0.05), (p<0.001) in the bronchoalveolar lavage fluid of mice with acute lung injury induced by LPS, and the inhibition was dose-dependent.

[0071] Effects of garlic-derived exosome-like nanovesicles (GAELNs) on related inflammatory factor proteins in lung tissue of mice with LPS-induced acute lung injury

[0072] The results are as follows Figure 5 As shown in the results, GAELNs can reduce the expression of IL-6 and TNF-α proteins in the lung tissues of mice. The expression of TNF-α and IL-1β proteins in the lung tissues of mice in each group was detected. Compared with the control group, the expression of TNF-α (p<0.05) and IL-1β (p<0.05) proteins in the lung tissues of mice in the LPS group were significantly increased; compared with the LPS group, the expression of TNF-α (p<0.05), (p<0.01), and IL-1β (p<0.05) proteins in the GAELNs-treated group were significantly decreased.

[0073] 6.4 RT-PCR detection of IL-1β, IL-6 and TNF-α gene expression in mouse lung tissue

[0074] The results are as follows Figure 6 As shown in the results, GAELNs can significantly reduce the mRNA levels of TNF-α, IL-6, and IL-1β in the lung tissues of mice. Compared with the control group, the levels of TNF-α (p<0.01), IL-6 (p<0.001), and IL-1β (p<0.01) in the LPS group were significantly increased; compared with the LPS group, GAELNs reduced the mRNA levels of TNF-α (p<0.01), IL-6 (p<0.001), and IL-1β (p<0.05) in the lung tissues of mice.

[0075] 6.5 Protein Expression in Mouse Lung Tissue

[0076] Western-blot was used to detect the protein expressions of cGAS, Sting, TBK1, p-TBK1, IRF3, p-IRF3, p65 and p-p65 in the lung tissues of mice in each group. Figure 7 As shown in the results, GAELNs administration could inhibit the expression of cGAS, Sting, TBK1, p-TBK1, IRF3, and p-IRF3 proteins. Compared with the control group, the LPS group showed a significant increase in cGAS (p<0.05), Sting (p<0.05), p-TBK1 (p<0.001), TBK1 (p<0.01), p-IRF3 (p<0.05), and IRF3 (p<0.001); compared with the LPS group, GAELNs reduced the levels of cGAS (p<0.05), Sting (p<0.05), p-TBK1 (p<0.001), TBK1 (p<0.05), p-IRF3 (p<0.05), and IRF3 (p<0.001) proteins in the lung tissues of mice.

[0077] Then, Western-blot was used to detect the protein expression of p65 and p-p65 in the lung tissues of mice in each group. Figure 8 As shown in the data, compared with the control group, the expression of p65 (p<0.05) and p-p65 (p<0.05) proteins in the lung tissues of mice in the LPS group were upregulated. Compared with the LPS group, the expression of p65 (p<0.05) and p-p65 (p<0.05) proteins in the lung tissues of mice were downregulated after administration of GAELNs. The differences were statistically significant.

[0078] In summary, this study demonstrates for the first time that GAELNs can effectively reduce LPS-induced lung injury in mice, modulating the cGAS / Sting / NF-κB signaling pathway and significantly reducing inflammatory factors such as IL-6, IL-1β, and TNF-α. By alleviating the inflammatory response, GAELNs can mitigate the onset and progression of acute lung injury. Therefore, GAELNs have promising applications in the preparation of drugs for the treatment or prevention of acute lung injury.

[0079] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A method for extracting garlic-derived exosome-like nanovesicles, characterized in that: The method comprises using garlic juice as a raw material, sequentially performing a first centrifugation, a second centrifugation, a third centrifugation, and a fourth centrifugation, performing a fifth centrifugation on the supernatant obtained by the fourth centrifugation, wherein the precipitate obtained by the fifth centrifugation contains the garlic-derived exosome-like nanovesicles; The centrifugal force of the first centrifugation is 1500-2500g, the centrifugal force of the second centrifugation is 3000-4000g, the centrifugal force of the third centrifugation is 4500-5500g, the centrifugal force of the fourth centrifugation is 9500-10500g, and the centrifugal force of the fifth centrifugation is 110000-130000g.

2. The extraction method according to claim 1, wherein The first centrifugation time is 15 to 25 minutes, the second centrifugation time is 35 to 45 minutes, the third centrifugation time is 35 to 45 minutes, the fourth centrifugation time is 35 to 45 minutes, and the fifth centrifugation time is 115 to 125 minutes.

3. Use of the exosome-like nanovesicles extracted by the extraction method according to claim 1 or 2 in the preparation of a reagent for regulating the cGAS / Sting / NF-κB signaling pathway.

4. The application according to claim 3, characterized in that The exosome-like nanovesicles have a Zeta potential of -7.8 mA and a particle size of 140 to 160 nm.

5. The application according to claim 3, characterized in that: The regulation of the cGAS / Sting / NF-κB signaling pathway includes reducing the expression of at least one of the following proteins: cyclic GMP-AMP synthase, interferon gene stimulator protein, TANK binding kinase 1, phosphorylated TANK binding kinase 1, interferon regulatory factor 3, phosphorylated interferon regulatory factor 3, p65 protein and p-p65 protein.

6. Use of the exosome-like nanovesicles extracted by the extraction method according to claim 1 or 2 in the preparation of a reagent for reducing the expression of inflammatory factors.

7. The application according to claim 6, characterized in that The inflammatory factors include at least one of the following: IL-6, IL-1β and TNF-α.

8. Use of the exosome-like nanovesicles extracted by the extraction method according to claim 1 or 2 in the preparation of a drug for treating acute lung injury.

9. A drug for treating acute lung injury, characterized in that: The active ingredient includes the exosome-like nanovesicles extracted by the extraction method according to claim 1 or 2, or the purified exosome-like nanovesicles, and also includes pharmaceutically acceptable excipients.

10. The drug according to claim 9, characterized in that The dosage of the exosome-like nanovesicles is not less than 25 mg / kg in mice.

Images