D-allulose 3-epimerase mutants, methods of making and use thereof

Abstract

The application discloses a D-allulose 3-epimerase mutant, a preparation method and application thereof, and relates to the fields of genetic engineering and enzyme engineering. The amino acid sequence of the D-allulose 3-epimerase mutant is shown as SEQ ID NO. 1. The specific enzyme activity of the D-allulose 3-epimerase mutant provided by the application is increased from 10.21 U / mg of a control (before mutation) to 15.29 U / mg at 80 DEG C and pH 6.0; and the equilibrium conversion rate is increased from 29.98% of the control (before mutation) to 36.26% when the substrate is 700 g / L of fructose. The D-allulose 3-epimerase mutant provided by the application has higher catalytic activity, and has a very broad application prospect in the efficient production and preparation of D-allulose.

Description

TECHNICAL FIELD

[0001] The present application relates to the fields of genetic engineering and enzyme engineering, in particular to a D-psicose 3-epimerase mutant and a preparation method and application thereof. BACKGROUND

[0002] D-psicose is a low-calorie, rare ketohexose, which has 70% of the sweetness of sucrose and only 10% of the calories of sucrose, and is an ideal low-energy sweetener substitute. In addition, D-psicose also has various beneficial physiological activities, such as enhancing glucose tolerance, reducing fat accumulation, scavenging active oxygen, protecting neuronal function, etc. These beneficial functions make it a natural functional ingredient, and it has a wide application prospect in the fields of food processing and medical health.

[0003] D-psicose is rare in nature and its direct extraction cost is high. D-psicose can be obtained by chemical synthesis, but there are many disadvantages such as high price of substrate, catalytic product mixture, environmental pollution, etc. Compared with chemical synthesis, enzyme biosynthesis of D-psicose has the characteristics of high synthesis efficiency, strong substrate specificity, mild reaction conditions, and no environmental pollution. The enzyme biosynthesis of D-psicose mainly uses D-psicose 3-epimerase to catalyze D-fructose to generate D-psicose. At present, further improving the catalytic activity of D-psicose 3-epimerase has become the research focus of large-scale synthesis of D-psicose by biological enzyme method. SUMMARY

[0004] The present application provides a D-psicose 3-epimerase mutant and a preparation method and application thereof to solve the problems existing in the prior art. The D-psicose 3-epimerase mutant has high catalytic activity and has a very broad application prospect in the efficient production of D-psicose.

[0005] To achieve the above-mentioned purpose, the present application provides the following solutions.

[0006] The present application provides a D-psicose 3-epimerase mutant, and the amino acid sequence is shown in SEQ ID NO. 1.

[0007] The present application also provides a coding gene of the above-mentioned D-psicose 3-epimerase mutant.

[0008] Further, the nucleotide sequence of the coding gene is shown in SEQ ID NO. 2.

[0009] The present application also provides a recombinant expression vector comprising the above-mentioned coding gene.

[0010] The application also provides a recombinant microbial strain comprising the recombinant expression vector.

[0011] The application also provides use of the coding gene, the recombinant expression vector or the recombinant microbial strain in the preparation of the D-allulose 3-epimerase mutant.

[0012] The application also provides a preparation method of the D-allulose 3-epimerase mutant, comprising the following steps: inducing expression culture of the recombinant microbial strain, and then extracting and purifying the D-allulose 3-epimerase mutant.

[0013] The application also provides use of the D-allulose 3-epimerase mutant in the preparation of D-allulose.

[0014] The application also provides a preparation method of D-allulose, comprising the following step: catalyzing D-fructose to generate D-allulose by using the D-allulose 3-epimerase mutant.

[0015] The application also provides a method for improving the catalytic activity of D-allulose 3-epimerase, wherein the amino acid sequence of the D-allulose 3-epimerase is shown in SEQ ID NO. 3.

[0016] The method comprises the following steps: mutating the 66th amino acid of the D-allulose 3-epimerase into glycine and mutating the 108th amino acid into alanine.

[0017] The application discloses the following technical effects:

[0018] The application discloses the following technical effects:

[0019] The specific activity of the D-allulose 3-epimerase mutant C66G / I108A provided by the application is increased from 10.21 U / mg of the control (before mutation) to 15.29 U / mg at 80℃ and pH 6.0; and the equilibrium conversion rate is increased from 29.98% of the control (before mutation) to 36.26% when the substrate is 700 g / L of fructose. The D-allulose 3-epimerase mutant C66G / I108A provided by the application has a very broad application prospect in the efficient production and preparation of D-allulose. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 SDS-PAGE images of D-allulose 3-epimerase TaDAEase and mutant C66G / I108A;

[0022] Figure 2 HPLC chromatogram of the standard and the product of the enzymatic reaction of D-allulose 3-epimerase TaDAEase;

[0023] Figure 3 HPLC chromatogram of the reaction products of the standard and the D-allulose 3-epimerase mutant C66G / I108A;

[0024] Figure 4 The equilibrium conversion rate of D-allulose catalyzed by the D-allulose 3-epimerase TaDAEase and the mutant C66G / I108A for the synthesis of D-allulose. Detailed Implementation

[0025] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0026] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0027] All technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains unless clearly indicated otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned in this specification are herein incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any reference is not an admission that it is prior art with respect to the present application. All literature and similar materials cited in this application, including but not limited to, patents, genetic code, scientific and / or technical articles, are expressly incorporated by reference.

[0028] Many modifications and variations of this application of the application can be made without departing from its spirit or scope, which will be apparent to those skilled in the art. Other embodiments of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only.

[0029] As used herein, the terms "comprise", "comprising", "include", "including", "have", "having" and the like are open-ended and do not exclude additional, unrecited elements or method steps.

[0030] The experimental materials involved in the following examples are as follows:

[0031] 1. Strains and vectors

[0032] Escherichia coli JM109, Escherichia coli BL21-CodonPlus(DE3)-RIL and Escherichia coli expression vector pET28a were purchased from Shengong Bioengineering (Shanghai) Co., Ltd.

[0033] 2. Enzymes and other biochemical reagents

[0034] KOD DNA polymerase and KOD-Plus-neo DNA polymerase were purchased from Toyobo Co., Ltd., DNA restriction endonuclease and T4 DNA ligase were purchased from Fermentase Co., Ltd., DNA gel recovery kit and plasmid extraction kit E.Z.N.A. were purchased from Omega Bio-tek Co., Ltd., QuickMutation TM Gene site-directed mutagenesis kit was purchased from Shanghai Biyun Tian Biotechnology Co., Ltd., Chelating Sepharose TM Fast Flow was purchased from GE Healthcare, USA, Bradford method protein concentration determination kit was purchased from Shanghai Shengong Bioengineering Co., Ltd., gene synthesis was completed by Shanghai Boyi Biotechnology Co., Ltd., polymerase chain reaction primer synthesis and sequencing were completed by Shanghai Shengong Bioengineering Co., Ltd., and other chemical reagents were domestic or imported analytical pure.

[0035] 3. Culture medium

[0036] LB medium: tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH 7.0. The screening medium was LB medium containing 50 μg / mL kanamycin.

[0037] The molecular cloning techniques and protein detection techniques used in the present application are conventional techniques in the art. In the following examples, the techniques not described in detail are performed according to the relevant parts in the following laboratory manual: Green MR, Sambrook J. Molecular cloning: a laboratory manual [M]. New York: Cold Spring Harbor Laboratory Press, 2012.

[0038] 4. Amino acid and nucleotide sequences

[0039] The amino acid sequence of mutant C66G / I108A is shown as SEQ ID NO. 1, and the nucleotide sequence of the encoding gene is shown as SEQ ID NO. 2. The amino acid sequence of D-arabino-ketose 3-epimerase TaDAEase derived from Thermofilaceae family thermophilic archaea is shown as SEQ ID NO. 3, and the nucleotide sequence of the encoding gene is shown as SEQ ID NO. 4. The gene sequence of ribitol dehydrogenase KpRD derived from Klebsiella pneumoniae MGH 48 is shown as SEQ ID NO. 5.

[0040] SEQ ID NO. 1:

[0041] MNKIGIYYAYWEHNWAADLLSYPQRVARLGFEILEIKLSVVLAMTERQRRKLKHEAQAHGIGLTFGEALDSQIDISSPRPATRKRGIEYLKRGLDTVHKMGGYLLGGALYGAWNLPAVEGMHKAERLMWSVESMRHVLKTAEDVGVICAIEPVNRFEHFMLNTCAEALEYIKMVESPNLGILLDTFHMNIEEDDIYKAIVSAGKNLVHMHVGEPNRKLPGQGRFPWQELLRALRFINYEGAIVMEPFVQVGGEIGLDIKVWRDLARGQDLDEAAQQSLRFLRALLKLSEF.

[0042] SEQ ID NO. 2:

[0043] ATGAACAAAATAGGAATTTATTATGCTTATTGGGAACATAATTGGGCAGCTGACTTACTTTCTTACCCACAACGTGTTGCACGATTGGGGTTTGAAATATTGGAAATCAAGTTAAGCGTAGTTCTTGCTATGACCGAACGACAGCGGAGAAAGTTGAAACACGAAGCGCAAGCTCATGGCATTGGACTCACTTTTGGTGAAGCTCTTGATTCACAAATAGACATATCTTCGCCGCGTCCTGCTACACGGAAACGTGGTATTGAATATCTAAAAAGAGGTTTAGATACGGTTCATAAAATGGGCGGGTATCTTTTGGGCGGAGCTTTATATGGTGCCTGGAATCTCCCAGCTGTTGAAGGCATGCATAAAGCAGAACGGCTTATGTGGAGTGTGGAAAGTATGCGTCACGTGCTTAAAACGGCTGAAGATGTTGGTGTTATATGTGCTATAGAACCTGTTAATCGGTTTGAGCACTTTATGCTTAACACATGTGCTGAAGCGCTTGAATATATAAAGATGGTGGAAAGCCCAAATCTGGGGATTTTGCTTGATACTTTCCACATGAACATCGAGGAAGATGATATATACAAAGCTATTGTATCTGCCGGTAAAAATTTGGTACACATGCACGTAGGGGAACCTAACAGAAAACTGCCAGGGCAAGGGAGATTTCCATGGCAAGAATTGCTAAGAGCACTACGTTTTATAAATTATGAGGGTGCAATCGTCATGGAGCCGTTCGTTCAAGTGGGAGGAGAAATCGGTCTTGATATTAAAGTTTGGAGGGACCTAGCGCGCGGGCAAGATCTGGACGAGGCAGCGCAACAGTCCCTCCGGTTTCTCCGAGCGTTGCTCAAGCTGTCAGAGTTTTGA.

[0044] SEQ ID NO. 3:

[0045] MNKIGIYYAYWEHNWAADLLSYPQRVARLGFEILEIKLSVVLAMTERQRRKLKHEAQAHGIGLTFCEALDSQIDISSPRPATRKRGIEYLKRGLDTVHKMGGYLLGGILYGAWNLPAVEGMHKAERLMWSVESMRHVLKTAEDVGVICAIEPVNRFEHFMLNTCAEALEYIKMVESPNLGILLDTFHMNIEEDDIYKAIVSAGKNLVHMHVGEPNRKLPGQGRFPWQELLRALRFINYEGAIVMEPFVQVGGEIGLDIKVWRDLARGQDLDEAAQQSLRFLRALLKLSEF.

[0046] SEQ ID NO. 4:

[0047] ATGAACAAAATAGGAATTTATTATGCTTATTGGGAACATAATTGGGCAGCTGACTTACTTTCTTACCCACAACGTGTTGCACGATTGGGGTTTGAAATATTGGAAATCAAGTTAAGCGTAGTTCTTGCTATGACCGAACGACAGCGGAGAAAGTTGAAACACGAAGCGCAAGCTCATGGCATTGGACTCACTTTTTGCGAAGCTCTTGATTCACAAATAGACATATCTTCGCCGCGTCCTGCTACACGGAAACGTGGTATTGAATATCTAAAAAGAGGTTTAGATACGGTTCATAAAATGGGCGGGTATCTTTTGGGCGGAATTTTATATGGTGCCTGGAATCTCCCAGCTGTTGAAGGCATGCATAAAGCAGAACGGCTTATGTGGAGTGTGGAAAGTATGCGTCACGTGCTTAAAACGGCTGAAGATGTTGGTGTTATATGTGCTATAGAACCTGTTAATCGGTTTGAGCACTTTATGCTTAACACATGTGCTGAAGCGCTTGAATATATAAAGATGGTGGAAAGCCCAAATCTGGGGATTTTGCTTGATACTTTCCACATGAACATCGAGGAAGATGATATATACAAAGCTATTGTATCTGCCGGTAAAAATTTGGTACACATGCACGTAGGGGAACCTAACAGAAAACTGCCAGGGCAAGGGAGATTTCCATGGCAAGAATTGCTAAGAGCACTACGTTTTATAAATTATGAGGGTGCAATCGTCATGGAGCCGTTCGTTCAAGTGGGAGGAGAAATCGGTCTTGATATTAAAGTTTGGAGGGACCTAGCGCGCGGGCAAGATCTGGACGAGGCAGCGCAACAGTCCCTCCGGTTTCTCCGAGCGTTGCTCAAGCTGTCAGAGTTTTGA.

[0048] SEQ ID NO. 5:

[0049] ATGAAGCACTCTGTCTCCTCTATGAATACTTCCCTCAGCGGTAAAGTCGCCGCGATCACCGGCGCGGCGTCCGGTATCGGCCTCGAGTGCGCGAGGACCCTGCTGGGAGCTGGCGCAAAAGTGGTACTGATCGACCGCGAAGGCGAAAAGCTCAACAAACTGGTCGCCGAACTTGGCGAAAACGCCTTCGCCCTGCAGGTCGACCTGATGCAGGCGGACCAGGTCGATAACCTACTGCAGGGCATTTTGCAGCTTACCGGGCGTCTCGATATCTTCCACGCCAACGCCGGCGCCTATATCGGCGGGCCGGTGGCCGAGGGCGACCCGGACGTCTGGGACCGCGTGCTGCACCTCAATATCAACGCCGCCTTCCGCTGCGTGCGCAGCGTCCTGCCGCATCTGATCGCGCAAAAATCCGGGGATATTATCTTCACCAGCTCGATCGCGGGCGTGGTGCCGGTGATCTGGGAGCCTGTCTATACCGCGTCGAAATTCGCGGTGCAGGCATTTGTGCACACCACTCGTCGCCAGGTGGCGCAGTATGGCGTGCGCGTCGGCGCCGTACTGCCGGGCCCGGTGGTTACCGCTCTGCTGGACGACTGGCCAAAAGCCAAAATGGACGAAGCGCTGGCCAACGGCAGCCTGATGCAGCCGATTGAAGTGGCGGAGTCGGTGCTGTTTATGGTGACGCGTTCGAAAAACGTCACCGTACGCGACATTGTGATCCTGCCGAACAGCGTGGATCTCTGA.

[0050] Example 1D - Construction and screening of allulose 3-epimerase site-directed mutants

[0051] 1) Synthesis of genes

[0052] According to the gene sequence of D-allulose 3-epimerase TaDAEase derived from Thermofilaceae family thermophilic archaea, as shown in SEQ ID NO. 4, the full gene synthesis of D-allulose 3-epimerase TaDAEase was entrusted to Shanghai Boyi Biotechnology Co., Ltd., and the tadaease gene was obtained.

[0053] According to the gene sequence of ribitol dehydrogenase KpRD derived from Klebsiella pneumoniae MGH 48, as shown in SEQ ID NO. 5, the full gene synthesis of ribitol dehydrogenase KpRD was performed by Shanghai Boyi Biotechnology Co., Ltd., and the kprd gene was obtained.

[0054] 2) Construction of expression vector

[0055] According to the gene sequence of D-allulose 3-epimerase TaDAEase, PCR primers F1 and R1 (Table 1) were designed, and the synthesized gene tadaease was used as a template, and F1 and R1 were used as primers for PCR amplification. The PCR amplification conditions were: 98℃ for 5 min; 98℃ for 20 sec, 58℃ for 40 sec, 74℃ for 1 min, 30 cycles; 74℃ for 10 min. The amplification product was double-digested with BamH I and Xho I, and ligated to the vector pET28a to construct the recombinant plasmid pET28a-tadaease.

[0056] According to the gene sequence of ribitol dehydrogenase KpRD, PCR primers F2 and R2 (Table 1) were designed, and the synthesized gene kprd was used as a template, and F2 and R2 were used as primers for PCR amplification. The PCR amplification conditions were: 98℃ for 5 min; 98℃ for 20 sec, 56℃ for 40 sec, 74℃ for 40 sec, 30 cycles; 74℃ for 10 min. The amplification product was double-digested with Nco I and Not I, and ligated to the vector pET28a to construct the recombinant plasmid pET28a-kprd.

[0057] Table 1 Primers used for construction of recombinant plasmid

[0058]

[0059] Note: The underlined part is the restriction enzyme cleavage site.

[0060] 3) Construction of D-allulose 3-epimerase TaDAEase mutant

[0061] Selection of mutation sites: The tertiary structure of D-allulose 3-epimerase derived from Agrobacterium tumefaciens (PDB ID: 2HK1) was used as a template to model the three-dimensional structure of the protein molecule of D-allulose 3-epimerase TaDAEase using Swiss-Model (http: / / swissmodel.expasy.org). The AutoDock 4.2 software was used to dock TaDAEase with the substrate D-fructose to determine the amino acid residues in TaDAEase that participate in binding the substrate D-fructose, and the non-conserved amino acid residues Y7, C66, and I108 were selected for site-directed saturation mutagenesis to construct saturation mutants.

[0062] Construction of site-directed saturation mutants: According to the instructions of the QuickMutation TM Gene Site-Directed Mutagenesis Kit, the base sequence of the gene tadaease, and the amino acid sites to be mutated were used to design primers, as shown in Table 2. The specific steps for constructing the saturation mutants were as follows: (1) Taking the construction of mutant Y7G as an example, the recombinant plasmid pET28a-tadaease was used as a template, and the primers Y7G-F and Y7G-R were used for PCR amplification according to the instructions of the QuickMutation TM Gene Site-Directed Mutagenesis Kit. The amplification product was treated with Dpn I enzyme, and then transformed into E. coli JM109. The transformants were screened on kanamycin-resistant plates, and the recombinant plasmid was extracted. The recombinant plasmid was sent to Shanghai Sangon Biological Engineering Co., Ltd. for sequencing and comparison with the corresponding gene sequence to confirm that the recombinant plasmid pET28a-tadaeaseY7G was successfully constructed. The construction of the site-directed mutants shown in Table 2 was performed according to the construction method of mutant Y7G.

[0063] Table 2 Primers for constructing site-directed mutants

[0064]

[0065]

[0066]

[0067]

[0068] Note: The boxed part is the mutated base.

[0069] 4) Screening of D-allulose 3-epimerase TaDAEase mutants

[0070] Mutant expression: The mutant expression plasmid was transformed into *E. coli* BL21-CodonPlus(DE3)-RIL. Single mutant clones were picked from fresh transformation plates and transferred to 48-well microplates containing 300 μL LB medium (50 μg / mL kanamycin) per well. The microplates were incubated at 37°C with shaking at 200 rpm for 12 h to obtain seed culture. The seed culture was then transferred at a 1% inoculum to fresh 48-well microplates containing 300 μL LB medium (50 μg / mL kanamycin) and incubated at 37°C with shaking at 200 rpm for 3 h. IPTG was added to each well to a final concentration of 0.25 mmol / L, and the plates were incubated at 16°C with shaking at 200 rpm for 18 h. After the culture was completed, the microplate was centrifuged at 4000 rpm for 15 min to collect the bacterial cells. 300 μL of 50 mmol / L LMES buffer (pH 6.0) was added to each well to resuspend the cells, followed by 20 μL of lysozyme at a concentration of 20 mg / mL. The microplate was then incubated at 37°C and 200 rpm for 2 h to lyse the cells and release the recombinant enzyme. After the reaction was complete, the microplate was centrifuged at 4000 rpm for 15 min. The supernatant obtained after centrifugation was the crude enzyme solution of the mutant.

[0071] Expression of ribitol dehydrogenase KpRD: The expression vector pET28a-kprd for ribitol dehydrogenase KpRD was transformed into *Escherichia coli* BL21-CodonPlus(DE3)-RIL and plated on LB solid medium containing 50 μg / mL kanamycin. Single colonies were picked from the transformation plates and inoculated into 10 mL of LB liquid medium containing 50 μg / mL kanamycin, and cultured at 37°C with shaking at 200 rpm for 12 h. The activated bacterial culture was then transferred to 100 mL of LB liquid medium containing 50 μg / mL kanamycin at a 1% inoculation rate and cultured at 37°C with shaking at 200 rpm until the bacterial culture reached OD500. 600nm The concentration was 0.6, and IPTG was added to bring the final concentration to 0.5 mmol / L. The mixture was then incubated at 30°C and 200 rpm for 6 hours with shaking. After expression was complete, the bacterial suspension was centrifuged at 4°C and 4000 rpm for 10 minutes, and the cell pellet was collected. The pellet was washed with 50 mmol / L MES buffer (pH 6.0). The collected cells were resuspended in 50 mmol / L MES buffer (pH 6.0) and placed on ice for sonication. The sonication cell disruptor was set as follows: ultrasonic power 25%, sonication time 3 seconds, interval 6 seconds. The cells were sonicated until the suspension became homogeneous. The cell disruption solution was centrifuged at 4°C and 8000 rpm for 10 minutes, and the supernatant was collected. Impurities were removed by passing the supernatant through a 0.45 μm aqueous filter to obtain the crude enzyme solution. Ni2+ The affinity chromatography column was used to purify the target protein in the crude enzyme solution, and elution was performed using 200 mM imidazole elution buffer to obtain the purified KpRD enzyme solution. The purified KpRD enzyme solution was subjected to dialysis treatment using 50 mmol / L MES buffer (pH 6.0) as the dialysis solution, and the KpRD enzyme solution after dialysis treatment was diluted to 0.5 mg / mL using 50 mmol / L MES buffer (pH 6.0).

[0072] Screening of mutants: 96-well microplates were taken, 20 μL of mutant crude enzyme solution and 100 μL of D-fructose with a mass concentration of 24 g / L were added to each well, and CoCl2 solution was added to a final concentration of 1 mmol / L, and the microplates were reacted at 80°C for 30 min. Then 120 μL of KpRD enzyme solution with a mass concentration of 0.5 mg / mL was immediately added to each well, and NADH was added to a final concentration of 5 mmol / L. The microplates were placed at 30°C, and the change in absorbance value at 340 nm with time was monitored at 0 min and 30 min. The change in absorbance value at 340 nm with time at 0 min and 30 min was proportional to the yield of D-psicose in the reaction system, and the greater the △A 340nm value at 0 min and 30 min, the higher the yield of D-psicose and the higher the enzyme activity of the mutant.

[0073] The change in absorbance value at 340 nm with time at 0 min and 30 min of the reaction system corresponding to the D-psicose 3-epimerase mutant was determined. 340nm The results are shown in Table 3. As shown in Table 3, the enzyme activity of the Y7-related site-directed mutant in the D-psicose 3-epimerase TaDAEase was lower than that of TaDAEase; the enzyme activity of the C66G mutant related to the 66th cysteine (C66) in TaDAEase was higher than that of TaDAEase; the enzyme activity of the I108A, I108P, and I108F mutants related to the 108th isoleucine (I108) in TaDAEase was higher than that of TaDAEase, and the enzyme activity of the mutant I108A was the highest.

[0074] Table 3: Determination results of the change in absorbance value at 340 nm with time at 0 min and 30 min of the reaction system 340nm

[0075]

[0076]

[0077] Example 2: Construction and enzyme activity determination of mutant C66G / I108A

[0078] 1) Construction of mutant C66G / I108A​

[0079] The recombinant plasmid pET28a-tadaeaseC66G was used as a template, and primers I108A-F and I108A-R were used to perform PCR amplification according to the QuickMutation TM Gene Site-directed Mutagenesis Kit. The amplification product was treated with Dpn I enzyme, and then transformed into E. coli JM109. The transformants were screened on kanamycin-resistant plates, and the recombinant plasmid was extracted. The recombinant plasmid was sent to Shanghai Sangon Biological Engineering Co., Ltd. for sequencing and comparison with the corresponding gene sequence to confirm that the recombinant plasmid pET28a-tadaeaseC66G / I108A was successfully constructed.

[0080] 2) Expression and purification of D-psicose 3-epimerase TaDAEase and mutant C66G / I108A

[0081] The recombinant plasmids pET28a-tadaease and pET28a-tadaeaseC66G / I108A were transformed into E. coli BL21-CodonPlus(DE3)-RIL, respectively, and spread on LB solid medium containing 50 μg / mL kanamycin. Single colonies were picked from the transformation plate and inoculated into 10 mL of LB liquid medium containing 50 μg / mL kanamycin, and incubated at 37°C with shaking at 200 r / min for 12 h. The activated culture was inoculated into 100 mL of LB liquid medium containing 50 μg / mL kanamycin at an inoculation amount of 1%, and incubated at 37°C with shaking at 200 r / min until the OD 600nm of the bacterial solution was 0.4. IPTG was added to a final concentration of 0.25 mM, and then the culture was further incubated at 16°C with shaking at 200 r / min for 12 h.

[0082] After the expression was completed, the bacterial solution was centrifuged at 4°C and 4000 r / min for 10 min, and the bacterial pellet was collected. The bacterial pellet was washed with 50 mmol / L MES buffer (pH 6.0). The bacterial pellet collected by centrifugation was resuspended in 50 mmol / L MES buffer (pH 6.0) and placed on ice for ultrasonic cell disruption. The parameters of the ultrasonic cell disruptor were set as follows: ultrasonic power was 25%, ultrasonic disruption time was 3 sec, and the interval was 6 sec. The bacterial cells were treated with ultrasonic waves until the bacterial suspension became a uniform solution. The cell disruption solution was centrifuged at 4°C and 8000 r / min for 10 min, and the supernatant was collected. The impurities were removed through a 0.45 μm water filter membrane to obtain a crude enzyme solution. The crude enzyme solution was loaded onto a Ni-NTA column for purification. 2+The affinity chromatography column was used to purify the target protein in the crude enzyme solution, and the purified enzyme solution was obtained by elution with 250 mM imidazole elution buffer. The purified enzyme solution was dialyzed using 50 mmol / L MES buffer (pH 6.0) as the dialysis solution. The purity of the enzyme was detected by SDS-PAGE. The SDS-PAGE detection diagram of D-allulose 3-epimerase TaDAEase and mutant C66G / I108A is shown in FIG. Figure 1

[0083] 3) Enzyme activity determination of D-allulose 3-epimerase TaDAEase and mutant C66G / I108A

[0084] 10 μL of the purified enzyme solution was mixed with 990 μL of 50 mmol / L MES buffer (pH 6.0) containing 50 g / L D-fructose and 1 mmol / L CoCl2, and after reaction at 80°C for 30 min, it was quickly placed in a boiling water bath for 5 min to terminate the enzyme reaction. The reaction solution was centrifuged at 12000 r / min for 10 min, and the supernatant was taken and filtered through a water-based 0.22 μm filter to prepare a high-performance liquid sample. The concentration of the product D-allulose was determined by high-performance liquid chromatography.

[0085] The chromatographic column used in high-performance liquid chromatography was a carbohydrate ES column-w (5 μm, 4.6 x 250 mm), and the detector was a 1260 Infinity evaporative light scattering detector. The high-performance liquid chromatography conditions were as follows: 75% acetonitrile and 25% deionized water as the mobile phase, the flow rate was set to 1.0 mL / min, the column temperature was set to 40°C, the carrier gas pressure was 30 psi, the drift tube temperature was 55°C, the injection volume was 10 μL, and the running time for each sample was 22 min.

[0086] Enzyme activity unit (U) definition: the amount of enzyme required to convert 1 μM D-fructose to D-allulose per minute is one enzyme activity unit (U).

[0087] The enzyme activity determination results of D-allulose 3-epimerase TaDAEase and mutant C66G / I108A are shown in Table 4. The enzyme activity of D-allulose 3-epimerase TaDAEase was 10.21 U / mg, and the enzyme activity of mutant C66G / I108A was 15.29 U / mg. Compared with TaDAEase, the enzyme activity of mutant C66G / I108A was increased by 0.50 times.

[0088] Table 4 Enzyme activity determination results of TaDAEase and mutant C66G / I108A

[0089]

[0090] ​Example 3D- Psicose 3-epimerase TaDAEase and C66G / I108A application for preparing D- psicose

[0091] A 1 mL reaction system containing enzyme solution (purified D- psicose 3-epimerase TaDAEase and mutant C66G / I108A enzyme solution prepared in Example 2), substrate D-fructose and CoCl2 was prepared. The enzyme solution was added in an amount of 10 U / mL, the final concentration of D-fructose was 100 g / L, the final concentration of CoCl2 was 1 mmol / L, and the buffer system was 50 mmol / L MES buffer (pH 6.0). After the reaction solution was reacted at 80°C for 5 h, it was quickly placed in a boiling water bath for 5 min to terminate the enzyme reaction. Then the reaction solution was centrifuged at 12000 r / min for 10 min, the supernatant was taken, and impurities were removed by filtering through a water-based 0.22 μm filter membrane to prepare a high performance liquid chromatography detection sample. The concentration of the product D-psicose was determined by high performance liquid chromatography, and the determination method was the same as that in Example 2.

[0092] The HPLC detection chart of the standard and the product of the enzymatic reaction of D- psicose 3-epimerase TaDAEase is shown in FIG. 2A; and the HPLC detection chart of the standard and the product of the enzymatic reaction of mutant C66G / I108A is shown in FIG. 2B. Figure 2 Figure 3 The concentration of D-psicose in the product of the enzymatic reaction of D- psicose 3-epimerase TaDAEase was 30.09 mg / mL; and the concentration of D-psicose in the product of the enzymatic reaction of mutant C66G / I108A was 39.63 mg / mL. The yield of mutant C66G / I108A catalyzing the conversion of D-fructose to D-psicose was higher.

[0093] Example 4 Equilibrium conversion rate of high concentration D-fructose by D- psicose 3-epimerase TaDAEase and mutant C66G / I108A

[0094] A 50 mL reaction system containing enzyme solution (purified D- psicose 3-epimerase TaDAEase and mutant C66G / I108A enzyme solution prepared in Example 2), substrate D-fructose and CoCl2 was prepared. The enzyme solution was added in an amount of 10 U / mL, the final concentration of D-fructose was 700 g / L, the final concentration of CoCl2 was 1 mmol / L, and the buffer system was 50 mmol / L MES buffer (pH 6.0). The reaction solution was reacted at 80°C, and samples were taken at certain time intervals. The concentration of the product D-psicose was determined by high performance liquid chromatography (determination method same as Example 2), and the equilibrium conversion rate of D-psicose was calculated.

[0095] ​The equilibrium conversion rate was calculated by dividing the concentration of D-psicose in the sample at different time points by the concentration of substrate D-fructose added before the reaction started: equilibrium conversion rate (%) = (concentration of D-psicose) / (concentration of substrate D-fructose) x 100%.

[0096] The results of equilibrium conversion rate determination of D-psicose 3-epimerase TaDAEase and mutant C66G / I108A on 700 g / L D-fructose are shown in Table 2. Figure 4 The equilibrium conversion rate of D-psicose 3-epimerase TaDAEase on 700 g / L D-fructose was 29.98%; the equilibrium conversion rate of mutant C66G / I108A on 700 g / L D-fructose was 36.26%, which was increased by 20.94% compared with TaDAEase.

[0097] The above-described embodiments are merely preferred modes of the present application and are not intended to limit the scope of the present application. Various modifications and improvements to the technical solutions of the present application made by those of ordinary skill in the art without departing from the design spirit of the present application shall fall within the protection scope of the present application as defined by the claims.

Claims

1. A D-allulose 3-epimerase mutant, characterized in that, The amino acid sequence is shown in SEQ ID NO.

1.

2. A gene encoding the D-allulose 3-epimerase mutant as described in claim 1.

3. The encoding gene according to claim 2, characterized in that, The nucleotide sequence of the encoding gene is shown in SEQ ID NO.

2.

4. A recombinant expression vector, characterized in that, Includes the coding gene as described in claim 2 or 3.

5. A recombinant microbial strain, characterized in that, Includes the recombinant expression vector as described in claim 4.

6. The use of the encoding gene as described in claim 2 or 3, the recombinant expression vector as described in claim 4, or the recombinant microbial strain as described in claim 5 in the preparation of the D-allulose 3-epimerase mutant as described in claim 1.

7. A method for preparing the D-allulose 3-epimerase mutant as described in claim 1, characterized in that, The method includes the steps of inducing expression culture of the recombinant microbial strain described in claim 5, and then extracting and purifying the D-allulose 3-epimerase mutant.

8. The use of the D-allulose 3-epimerase mutant as described in claim 1 in the preparation of D-allulose.

9. A method for preparing D-allulose, characterized in that, The method includes the step of using the D-allulose 3-epimerase mutant of claim 1 to catalyze the production of D-allulose from D-fructose.

10. A method for improving the catalytic activity of D-allulose 3-epimerase, characterized in that, The amino acid sequence of the D-allulose 3-epimerase is shown in SEQ ID NO.3; The method includes the step of mutating the 66th amino acid of the D-allulose 3-epimerase to glycine and the 108th amino acid to alanine.

Images