CircZFX expression inhibitor and application thereof
By synthesizing and delivering siRNA inhibitors, the circZFX expression in cholangiocarcinoma cells is significantly inhibited and the HDGF/YAP1 signaling axis is regulated, which solves the problem of lack of effective therapeutic targets for cholangiocarcinoma, and effectively inhibits the proliferation, migration and invasion of cholangiocarcinoma cells, reducing tumor volume and weight.
Patent Information
- Application Number
- CN202510653936.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-21
- Publication Date
- 2025-08-15
AI Technical Summary
The pathogenesis of cholangiocarcinoma is complex and the clinical lack of effective therapeutic targets has led to a five-year survival rate of less than 20%. The prior art has failed to effectively inhibit the expression and biological behavior of circZFX in cholangiocarcinoma cells.
SiRNA-1, siRNA-2, and siRNA-3 were designed and synthesized as expression inhibitors of circZFX, and delivered to cholangiocarcinoma cells through chemical synthesis and delivery systems, significantly inhibiting the expression of circZFX, regulating the HDGF/YAP1 signaling axis, and inhibiting the proliferation, migration and invasion of cholangiocarcinoma cells.
It significantly reduces the expression level of circZFX in cholangiocarcinoma cells, inhibits the proliferation, migration and invasion of cholangiocarcinoma cells, provides a new target for cholangiocarcinoma treatment, and significantly reduces tumor volume and weight.
Smart Images

Figure CN120485185A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of molecular biology and biomedicine technology, and in particular to a circZFX
[0002] (hsa_circ_0007108) expression inhibitor and its application. Background Art
[0003] Cholangiocarcinoma (CCA) is a highly malignant hepatobiliary tumor with a very poor prognosis. Its pathogenesis is complex and there is a lack of effective therapeutic targets in clinical practice, resulting in a five-year survival rate of less than 20% for patients.
[0004] In recent years, circular RNA (circRNA), as an important member of the non-coding RNA family, has been shown to participate in cancer progression by regulating key tumor signaling pathways, but there is still a huge research gap in its functional network and molecular mechanism in cholangiocarcinoma. Summary of the Invention
[0005] The present invention provides a circZFX expression inhibitor and its application. The circZFX expression inhibitor can effectively inhibit the expression of circZFX in cholangiocarcinoma cells, inhibit the proliferation of cholangiocarcinoma cells, and inhibit the migration and invasion of cholangiocarcinoma cells, and can serve as a new target for the treatment of cholangiocarcinoma.
[0006] The technical solutions provided by the present invention are as follows:
[0007] The present invention provides an expression inhibitor of circZFX, wherein the expression inhibitor of circZFX is selected from at least one of a to c:
[0008] a. siRNA-1 whose nucleotide sequence is shown in SEQ ID NO: 1;
[0009] b. siRNA-2 whose nucleotide sequence is shown in SEQ ID NO: 2;
[0010] c. siRNA-3 whose nucleotide sequence is shown in SEQ ID NO: 3.
[0011] siRNA-1:5'-CCTTATGATTTCCTGAGCT-3' (SEQ ID NO: 1);
[0012] siRNA-2:5'-TCCTGAGCTGTGACTGATG-3' (SEQ ID NO: 2);
[0013] siRNA-3:5'-ATGATTTCCTGAGCTGTGA-3' (SEQ ID NO: 3);
[0014] In some embodiments, the circZFX expression inhibitor is chemically synthesized.
[0015] The present invention also provides a delivery system for a circZFX expression inhibitor, comprising the circZFX expression inhibitor and a vector.
[0016] The present invention also provides a pharmaceutical composition comprising the circZFX expression inhibitor or the delivery system, and pharmaceutically acceptable excipients.
[0017] The present invention also provides use of the circZFX expression inhibitor, the delivery system, and the pharmaceutical composition in preparing a drug for preventing and / or treating bile duct cancer.
[0018] More specifically, the circZFX expression inhibitor can significantly inhibit the proliferation of cholangiocarcinoma cells;
[0019] The circZFX expression inhibitor can significantly inhibit the migration and invasion of cholangiocarcinoma cells.
[0020] On this basis, the circZFX expression inhibitor can significantly reduce the expression level of circZFX in cholangiocarcinoma cells.
[0021] Experiments have also found that circZFX plays an important role in regulating the malignant biological behavior of cholangiocarcinoma. circZFX targets and regulates HDGF expression through the ceRNA mechanism. At the same time, circZFX may affect the proliferation activity of tumor cells by regulating the HDGF / YAP1 signaling axis.
[0022] Beneficial effects: The present invention designs and synthesizes a circZFX expression inhibitor (e.g., siRNA), which can significantly reduce the expression level of circZFX in cholangiocarcinoma cells, inhibit the proliferation of cholangiocarcinoma cells, and inhibit the migration and invasion of cholangiocarcinoma cells, and can serve as a new target for the treatment of cholangiocarcinoma. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 Figure 4: CircZFX knockdown efficiency assay. A and B: RT-PCR relative expression levels of circZFX in HuCCT1 and QBC939 cells after transfection with three specific siRNAs (siRNA-1, siRNA-2, and siRNA-3). C: RT-PCR assay for circZFX knockdown in a cell line stably knocked down by the sh-circZFX lentivirus.
[0024] Figure 2Knockdown of circZFX inhibits the proliferation of cholangiocarcinoma cells. AB: CCK-8 assays to assess the proliferation of HuCCT1 and QBC939 cells expressing sh-circZFX. C: EdU imaging assay results. D: EdU imaging assays to assess the proliferation of HuCCT1 and QBC939 cells. HuCCT1 and QBC939 cell proliferation was observed under a fluorescence microscope. Hoechst 33342: blue fluorescence; EdU: red fluorescence.
[0025] Figure 3 Knockdown of circZFX inhibits the migration and invasion of cholangiocarcinoma cells. A: Representative images and quantitative analysis of the HuCCT1 cell scratch assay. B: Scratch healing rate of QBC939 cells. C: Transwell migration assay cell staining (crystal violet staining) and cell number statistics. D: Transwell invasion assay cell staining and cell number statistics.
[0026] Figure 4 Molecular validation of the circZFX / miR-654-3p axis in regulating HDGF. A: Venn diagram of candidate target genes for miR-654-3p screened using multiple databases. B: Experimental evidence for the interaction between HDGF and miR-654-3p as documented in the miRTarBase database. C: Starbase2.0 analysis of the correlation between candidate gene expression and circZFX in cholangiocarcinoma tissues. D: RT-PCR analysis of the effect of circZFX knockdown on candidate gene mRNA levels in cholangiocarcinoma tissues. E: Comparison of HDGF mRNA expression in cholangiocarcinoma cell lines and normal epithelial cells. F: The RMethyMD database shows HDGF expression in various cancers. G: Binding sites and mutations of miR-654-3p in the HDGF 3'UTR. H: Dual-luciferase reporter assay results demonstrate targeted regulation of the HDGF 3'UTR by miR-654-3p. I: Western blot analysis of the effects of miR-654-3p mimics / inhibitors on HDGF protein expression. J: Grayscale analysis of HDGF protein in HuCCT1 and QBC939 cells.
[0027] Figure 5Figure 3. Changes in tumor volume growth rate and weight in a xenograft model after knockdown of circZFX. A: Tumors were removed from nude mice. The mice were grouped and photographed using a mobile phone. B: Tumor xenograft volume was measured every four days in the mice with tumors, and a line graph of tumor volume was plotted using Origin. The results showed that the tumor volume growth rate in the circZFX knockdown group was significantly lower than that in the control group. C: Finally, the removed tumors were grouped and weighed, and a tumor weight graph was plotted using Origin. D: The removed tumors were stained with HE and photographed.
[0028] Figure 6 The molecular mechanism by which circZFX promotes tumor growth by activating the HDGF / YAP1 signaling pathway. A: Representative immunohistochemistry (IHC) images of HDGF, YAP1, and the proliferation marker Ki67 in nude mouse xenograft tumor tissue. B: Quantitative statistics of the percentage of HDGF-, YAP1-, and Ki67-positive cells.
[0029] Figure 7 Schematic diagram of interference carrier map. DETAILED DESCRIPTION
[0030] Unless otherwise defined, all scientific and technical terms used in the present invention have the same meanings as commonly understood by one of ordinary skill in the art to which this invention relates.
[0031] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present application.
[0032] Based on bioinformatics analysis, this application preliminarily predicts that circZFX shows significantly upregulated expression in cholangiocarcinoma. To verify this prediction, this application first designed specific primers for RT-PCR detection, and combined Sanger sequencing to perform sequence analysis on the reverse splicing junction, and simultaneously confirmed the circular RNA characteristics of circZFX using RNase R tolerance experiments. Subsequently, this application used RT-PCR technology to systematically detect the expression level of circZFX in multiple cholangiocarcinoma cell lines (including HuCCT1, QBC939, HCCC9810 and RBE) and 20 pairs of clinical cholangiocarcinoma tissue samples. Data analysis showed that compared with the control group, circZFX showed significantly upregulated expression in both cholangiocarcinoma cell lines and clinical tissue samples. This finding suggests that circZFX may play an important role in regulating the development of cholangiocarcinoma and provides an experimental basis for in-depth revelation of the molecular mechanism.
[0033] Example 1: Synthesis of siRNA-1, siRNA-2, and siRNA-3 - Phosphoramidite Solid-Phase Synthesis
[0034] 1. Target Sequence Design and Verification
[0035] 1. Backsplicing site locking
[0036] (1) Obtain the reverse splicing sequence of circRNA through the circBase database.
[0037] 2. Specificity Verification
[0038] (1) Use the siDirect 2.0 tool to predict off-target effects (threshold: ≤6 mismatches in the seed region);
[0039] (2) Homology with linear mRNA or other circRNA was excluded by BLAST comparison (E-value < 1e-5).
[0040] The final designed nucleotide sequences are shown as siTNIK-1 in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3.
[0041] 2. Phosphoramidite Solid Phase Synthesis Steps
[0042] 1. Carrier activation
[0043] (1) Using controlled pore glass (CPG) solid phase carrier, pore size (suitable for 20-25nt synthesis);
[0044] (2) The support was washed with anhydrous acetonitrile three times (5 mL / g support each time) and activated for 30 min.
[0045] 2. Nucleotide Coupling
[0046] Cycling steps (per base addition):
[0047]
[0048] 3. Cleavage and deprotection
[0049] Cutting reagent: ammonia / ethanol (3:1, v / v), 55°C for 16 h;
[0050] Deprotection: Treatment with 1 M DTT for 1 h (to reduce possible disulfide byproducts).
[0051] 4.HPLC purification and quality control
[0052]
[0053] 5. Double-strand annealing and stability optimization
[0054] 1) Annealing buffer system
[0055] (1)10mM Tris-HCl (pH7.5), 50mM NaCl, 1mM EDTA;
[0056] (2) Final concentration: 20 μM each of the sense chain and the antisense chain.
[0057] 2) Annealing procedure:
[0058]
[0059] 6. Stability enhancement processing
[0060] Lyoprotectant: Add 5% trehalose (to improve long-term storage stability);
[0061] Sterile filtration: Filter through a 0.22 μm PVDF membrane (to reduce endotoxin contamination).
[0062] Example 2: siRNA-1, siRNA-2, and siRNA-3 prepared in Example 1 were used to silence the expression of circZFX and inhibit the development of cholangiocarcinoma.
[0063] 1 Experimental Materials
[0064] 1.1 Preparation of Cholangiocarcinoma Cells
[0065] The cell lines used in this study include four cholangiocarcinoma cell lines (RBE, HuCCT1, HCCC9810, and QBC939) and one human normal bile duct epithelial cell line (HIBEC).
[0066] The Sh-circZFX lentiviral vector was packaged in 293T cells, and the viral solution was used to infect QBC939 and HuCCT1 cells to obtain circZFX stable knockdown cell lines of QBC939 and HuCCT1 cells.
[0067] 1.2 Main Reagents
[0068]
[0069]
[0070] 2 Experimental methods
[0071] 2.1 Human cholangiocarcinoma cell culture
[0072] (1) Preparation of reagents for cell culture
[0073] 1) 10% FBS RPMI-1640 complete culture medium: 90% RPMI-1640 (Keygen), 10% FBS.
[0074] 2) Prepare phosphate buffered saline (PBS):
[0075] 1. Weigh 8.0 g NaCl, 1.44 g Na2HPO4, 0.2 g KCl, and 0.24 g KH2PO4 into a 1 L beaker.
[0076] 2. Add 900mL of ddH2O and stir until completely dissolved.
[0077] 3. Adjust the solution pH to 7.2-7.4.
[0078] 4. Adjust the volume to 1 L and sterilize by high pressure.
[0079] 5. Use a 0.22 μm microporous filter membrane to filter in the cell workbench, then divide into 200 mL glass bottles and store at 4°C for later use.
[0080] 3) Preparation of 0.25% Trypsin:
[0081] 1. Weigh 0.25 g trypsin and 0.02 g EDTA into a 100 mL beaker.
[0082] 2. Add 100 mL of autoclaved PBS and stir magnetically until completely dissolved.
[0083] 3. Use a 0.22 μm microporous filter membrane for filtration in the cell workbench.
[0084] 4) Preparation of cell freezing solution:
[0085] 1. Add 200 μL fetal bovine serum (FBS) and 100 μL dimethyl sulfoxide (DMSO) to 700 μL RPMI-1640 medium.
[0086] 2. Use a pipette to mix.
[0087] (2) Cell recovery
[0088] 1) Preparation: Open the clean bench 30 minutes in advance and keep RPMI-1640 complete medium at room temperature.
[0089] 2) Cell recovery steps:
[0090] 1. In a clean bench, pipette 7 mL of RPMI-1640 complete medium into a 10 cm culture dish.
[0091] 2. Remove the frozen cells and thaw them quickly in a 37°C water bath.
[0092] 3. Transfer the cell freezing mixture to a 10 cm culture dish.
[0093] 4. Place in a normal constant temperature incubator and culture for 6 hours.
[0094] 5. After the cells adhere, discard the original culture medium and replace with fresh culture medium to continue culturing.
[0095] (3) Cell passage
[0096] 1) Cell passaging conditions:
[0097] When the cell density reaches 85%-90%, the cells are passaged.
[0098] 2) Passaging steps:
[0099] 1. Washing: Discard the original culture medium and wash the cells three times with sterile PBS restored to room temperature, 1 mL each time.
[0100] 2. Digestion: Slowly add 1 mL of 0.25% trypsin along the wall, shake gently, and place in the incubator for 3 minutes.
[0101] 3. Terminate digestion: When obvious changes in cell morphology are observed under a microscope, terminate the digestion process by adding 3 times the volume of complete culture medium.
[0102] 4. Collect cells: Use a pipette to gently blow off the adherent cells until the cell clusters are evenly dispersed, and transfer them into a sterile 5 mL centrifuge tube.
[0103] 5. Centrifugation: room temperature, 800 rpm, centrifuge for 5 minutes to collect cells.
[0104] 6. Resuspension and Passaging: Discard the supernatant, add culture medium, resuspend the cells, and gently pipette until the cell clumps are evenly dispersed. Passage the cell suspension evenly into two new culture dishes.
[0105] (4) Cell cryopreservation
[0106] 1) Cryopreservation conditions:
[0107] When the cell density reaches 80%-90%, freeze the cells.
[0108] 2) Freezing steps:
[0109] 1. Washing and digestion: As with the cell passaging procedure, wash the cells with PBS, digest with trypsin, and collect the cells.
[0110] 2. Resuspend: After centrifugation, discard the supernatant, add 1 mL of freshly prepared cell freezing solution, and gently pipette until the cell clumps are evenly dispersed.
[0111] 3. Aliquoting and freezing: Transfer the cell suspension into 2 mL cryovials, quickly place in a cryovial, and freeze overnight at -80°C. After 24 hours, transfer to a liquid nitrogen tank for long-term storage.
[0112] 2.2 Cell Counting
[0113] 1. Cell resuspension: Resuspend the trypsin-digested cells in 1 mL of complete culture medium and gently pipette to mix.
[0114] 2. Dilution: Pipette an appropriate amount of cell suspension and slowly add complete culture medium to dilute to 1 mL.
[0115] 3. Counting: Take 20 μL of the diluted cell suspension and add it to a hemocytometer. Cover with a coverslip and let it stand before counting under an inverted microscope.
[0116] 4. Calculation: Number of cells / mL = Total number of cells in eight large squares / 8×10 4 .
[0117] 2.3 Cell transfection: Take each well of a six-well plate as an example:
[0118] 1. Cell starvation: When the cell density reaches 60%-70%, starve the cells using serum-free medium for 4-6 hours.
[0119] 2. Prepare transfection mixture:
[0120] Solution A: 50 μL serum-free and dual-antibody-free medium + 1 μg empty plasmid or 4 μL si-NC / si-RNA (20 μM). (The final transfection concentration of siRNA is 100 nM, the final transfection concentration of mimic is 50 nM, and the final transfection concentration of miRNA inhibitor is 100 nM. The required volume is determined based on the final concentration.)
[0121] Solution B: 50 μL serum-free and double antibody-free culture medium + 2 μL Lipo2000.
[0122] After mixing, let it stand at room temperature for 5 minutes.
[0123] 3. Mixing and transfection:
[0124] Transfer solution A to solution B, mix thoroughly by pipetting gently, let stand at room temperature for 20 minutes, and then add dropwise to the six-well plate.
[0125] 4. Incubation: Incubate at 37°C for 5 minutes, then add 700 μL of serum-free and double-antibody-free culture medium.
[0126] 5. Medium change: After 6-8 hours, replace with RPMI-1640 medium containing 10% FBS and continue culturing for 48 hours.
[0127] 2.4 Construction of circZFX Stable Knockdown Cell Line
[0128] (1) Preparation of circZFX stable knockdown plasmid. The interference vector map selected is as follows Figure 7 shown.
[0129] 2. Interference target design and primer synthesis:
[0130] Target gene siRNA sequence and shRNA sequence:
[0131] siRNA3 sequence: ATGATTTCCTGAGCTGTGA (SEQ ID NO: 3);
[0132] Upstream primer:
[0133] GATCCGATGATTTCCTGAGCTGTGATTCAAGAGATCACAGCTCAGGAAATCATTTTTTTG Downstream primer:
[0134] AATTCAAAAAAATGATTTCCTGAGCTGTGATCTCTTGAATCACAGCTCAGGAAATCATCG 3. Obtaining the target gene fragment
[0135] The target gene and upstream and downstream sequences were queried from circBase, and primers were designed using VectorNTI software.
[0136] PCR amplification of target gene: Use high-fidelity PrimeSTAR enzyme to amplify the target gene. The reaction system and conditions are as follows:
[0137] The system is as follows (50uL):
[0138]
[0139] PCR reaction (30 cycles):
[0140]
[0141] The PCR products were subjected to agarose gel electrophoresis to detect the amplification effect, and the target gene band was cut out from the gel after agarose gel electrophoresis for gel recovery.
[0142] 4. Preparation of linearized expression vector:
[0143] Add each reagent in the order listed in the table below, gently pipette to mix, and incubate in a 37°C water bath for 2 hours. Detect the digestion effect by agarose gel electrophoresis, and excise the target vector band from the gel after agarose gel electrophoresis. Recover the DNA using the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver. 3.0.
[0144] The vector enzyme digestion system is as follows:
[0145]
[0146] 5. Connecting the interference fragment to the vector:
[0147] Add the target gene fragment and linearized vector to a centrifuge tube at a molar ratio of 3:1 for ligation. Generally, 100 ng of linearized expression vector is added, and the target gene fragment is added in an amount equal to 300 x the number of base pairs of the target gene / the number of base pairs of the linearized expression vector (in ng). The ligation reaction system (20 uL) is as follows:
[0148]
[0149] The above ligation solution was ligated at 16°C overnight.
[0150] 6. Conversion
[0151] 1) After taking the DH5α competent cells out of the -80℃ freezer, they should be immediately placed on ice to thaw. The competent cells should be packaged gently to minimize mechanical damage.
[0152] 2) After the competent medium has thawed, aliquot the aliquots into 50 μL aliquots per tube (20 μL is sufficient for plasmid transformation). Add the ligation product to the aliquots at a volume no greater than 1 / 10 of the competent medium volume (currently add 5 μL of ligation product) and place on ice for 20-30 minutes.
[0153] 3) Heat shock at 42°C for 90 seconds (this time must be very strict), and immediately incubate on ice for 2-3 minutes.
[0154] In a clean bench, add 500 μL LB medium (note that it must be antibiotic-free LB medium) and gently invert it 3-5 times;
[0155] 5) Incubate at 37°C, 230 rpm, shaking for 45-60 min;
[0156] 6) Apply the bacterial solution evenly to a solid plate of the corresponding resistance, then incubate the plate upside down at 37°C for 12-16 hours;
[0157] 7. PCR Identification of Bacterial Liquid
[0158] Pick the transformants grown on the plate and resuspend them in 10 μl of LB culture medium. Take 1 μl as template for colony PCR identification. The reaction system and PCR cycling conditions are as follows:
[0159] 1) Bacterial liquid PCR identification system:
[0160]
[0161] 2) Bacterial liquid PCR identification procedure
[0162]
[0163] 8. Sequencing
[0164] The sequencing results show that the sequencing results are consistent with the target sequence, and the target plasmid is successfully constructed.
[0165] 9. Plasmid Extraction
[0166] After successful sequencing, bacterial culture amplification was performed, and plasmid extraction and purification was performed using the Novezan FastPure EndoFreePlasmid MiniPlus Kit.
[0167] 1. Pick the colonies that are positive clones verified by colony PCR, place them in LB medium with ampicillin added, and culture them in a 37°C constant temperature incubator with shaking for 16 hours;
[0168] 2. After the bacterial solution has grown sufficiently, centrifuge at 4500 rpm for 10 minutes at room temperature to collect the cells;
[0169] 3. Take 5-15 ml of overnight culture solution and centrifuge at 12,000 rpm (13,400 × g) for 1 min to collect the bacteria. Aspirate as much of the remaining supernatant as possible.
[0170] 4. Add 500 μl of Buffer P1 (please check whether RNase A Solution has been added first) and vortex until the bacteria are completely resuspended.
[0171] 5. Immediately add 500 μl of Buffer P2, gently mix by inverting up and down 8-10 times, and let it stand at room temperature for 3 minutes.
[0172] 4. Add 500 μl of Buffer N3 and immediately and gently invert the tube 12-15 times until the blue color disappears completely and a white flocculent precipitate appears. Incubate at room temperature for 10 minutes and centrifuge at 12,000 rpm (13,400 × g) for 10 minutes.
[0173] 5. Transfer the supernatant (about 1.5 ml) to a 5 ml centrifuge tube (self-prepared), add 0.3 times the volume of supernatant (about 450 μl) of isopropanol, and mix thoroughly by inverting 10-15 times.
[0174] 6. Column Equilibration: Place FastPure DNA Mini Columns III in 2ml Collection Tubes.
[0175] Add 200 μl of Buffer QB to Columns III, centrifuge at 12,000 rpm (13,400 × g) for 1 min, discard the filtrate and set aside.
[0176] 7. Transfer the mixed solution from step 5 to the adsorption column, centrifuge at 12,000 rpm (13,400 × g) for 1 min, and discard the filtrate.
[0177] 8. Repeat step 7 until all the mixed solution is loaded onto the column.
[0178] 9. Add 500 μl of Buffer PW1 to the adsorption column, centrifuge at 12,000 rpm (13,400 × g) for 1 min, and discard the filtrate.
[0179] 10. Add 600 μl of Buffer PW2 (please check whether anhydrous ethanol has been added) to the adsorption column, centrifuge at 12,000 rpm (13,400 × g) for 1 min, and discard the filtrate.
[0180] 11. Repeat step 10.
[0181] 12. Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm (13,400 × g) for 2 minutes to dry the adsorption column.
[0182] 13. Place the adsorption column in a new 1.5ml centrifuge tube (prepare your own) and add 60-200μl of Endotoxin-free Elution Buffer to the center of the adsorption column membrane. Let stand at room temperature for 1 minute, centrifuge at 12,000 rpm (13,400 × g) for 1 minute, and discard the adsorption column.
[0183] 14. The extracted plasmid DNA should be stored at -30 to -15°C.
[0184] (2) Packaging
[0185] 1) HEK293T cells were revived in a 10 cm culture dish and cultured in RPMI-1640 complete cell culture medium containing 10% FBS. When the HEK293T cells in the culture dish grew to 90%, they were subcultured into a 6-well plate and continued to be cultured.
[0186] 2) When HEK293T cells in a 6-well plate reach 60% growth, starve them for 6 hours in serum-free RPMI-1640 medium. Prepare the packaging system containing Lipo2000, Sh-circZFX, psPAX2, pMD2G, and serum-free RPMI-1640. For each well of a 6-well plate, the packaging system is as follows:
[0187]
[0188] 3) Transfection: For one well of a six-well plate, sterilize in a biosafety cabinet under UV for 30 minutes. Prepare a liposome and DNA mixture in separate 1 mL RNase-free centrifuge tubes. Add 50 μL of serum-free, antibody-free RPMI-1640 medium to tube A. Add 50 μL of serum-free, antibody-free RPMI-1640 medium, knockdown plasmid (1000 ng), psPAX2 (750 ng), pMD2G (250 ng), and 2 μL of Lipo2000 to tube B. Gently pipette to mix. Transfer the mixture from tube B to tube A, mix gently with a pipette, and let stand at room temperature for 20 minutes.
[0189] 4) Add the transfection mixture dropwise to HEK293T cells and incubate in a 37°C incubator for 5 minutes to enhance transfection efficiency. After 5 minutes, add 700 μL of serum-free and antibody-free RPMI-1640 medium to the dish and continue incubating in a virus-specific incubator for 6-8 hours. After 6-8 hours, replace the medium with RPMI-1640 supplemented with 10% FBS and continue incubating for 48 hours.
[0190] 5) Collect the 48-hour cell culture medium (the lentivirus will be released into the culture medium after HEK293T cell packaging is completed), store it in a 4°C refrigerator, add RPMI-1640 medium containing 10% FBS, and continue culturing for 72 hours.
[0191] 6) Collect the 72-hour cell culture fluid, centrifuge the collected 48-hour and 72-hour cell culture fluids at 1000 rpm for 5 minutes, filter the virus solution through a 0.48 μm microporous filter membrane, aliquot, and store in a -80°C refrigerator for later use.
[0192] (3) Viral fluid infection
[0193] 1) Virus infection was performed in 12-well plates. When cholangiocarcinoma QBC939 and HuCCT1 cells reached 60% density, the virus solution was removed from the -80°C freezer and slowly thawed on ice. The thawed virus solution was mixed with freshly prepared complete medium containing 10% FBS at a 1:1 ratio.
[0194] 2) Remove the QBC939 and HuCCT1 cells to be infected, discard the old culture medium, wash with PBS, and add 1 ml of the above mixture to each well of a 12-well plate.
[0195] 3) 48 h after viral infection, the expression of green fluorescent protein (the circZFX knockdown plasmid carries a green fluorescent protein tag) can be observed under a fluorescence microscope to observe the infection efficiency.
[0196] (4) Puromycin killing curve detection
[0197] 1) HuCCT1 and QBC939 cells were prepared into cell suspensions in serum-free medium without anti-antibodies, seeded into 12-well plates, and cultured for 24 hours;
[0198] 2) Design gradient concentration of puromycin: 0μg / mL, 0.5μg / mL, 1μg / mL, 1.5μg / mL, 2μg / mL,
[0199] 2.5μg / mL, 3μg / mL, 3.5μg / mL, 4μg / mL, 4.5μg / mL, 5μg / mL;
[0200] 3) After 3 days of culture, the cells were cultured once, and the culture medium was changed for another 4 days. On the 7th day, cells were observed to survive at a puromycin concentration of 0-2 μg / mL, while cells at a puromycin concentration of 2.5-3 μg / mL were partially dead.
[0201] 4) Select a puromycin concentration of 2.5 μg / mL as the stable transfectant screening concentration.
[0202] (5) Puromycin screening of stable knockdown cell lines
[0203] 1) After viral infection, discard the old culture medium containing the virus solution, wash the cells with PBS, and screen them continuously for 7 days with a culture medium containing 2.5 μg / mL puromycin. During the screening period, replace the culture medium containing 2.5 μg / mL puromycin every day.
[0204] 2) The cells that survived the 12-well plate after 7 days of screening were digested and inoculated into 6 cm medium dishes for further culture. When the cells reached 90% density, they were digested and passaged. One portion was frozen and the other portion was continued to be cultured.
[0205] 3) Verify the knockdown efficiency of the cell line: extract RNA from the cells successfully screened above, verify the knockdown efficiency by real-time fluorescence quantitative PCR (qRT-PCR), and continue to culture the successfully knocked-down QBC939 and HuCCT1 cells for subsequent experiments.
[0206] 2.5 CCK-8 Experiment
[0207] (1) Cell seeding: 5000 cells / well were seeded in a 96-well plate and cultured for 24 h.
[0208] (2) Detection: After cells have adhered or been cultured in an incubator for 24 h, perform the assay. Remove the old culture medium and, protected from light, add 100 μL of serum-free culture medium containing 10% CCK-8 reagent to each well. Incubate for 1 h and measure the OD value at 450 nm. The OD value at this time is recorded as the OD value at 0 h.
[0209] (3) Data analysis: The OD values at 24 h, 48 h, 72 h, and 96 h were measured, and two-way ANOVA was used to analyze the differences in cell growth.
[0210] 2.6 EdU Experiment
[0211] Using BeyoClick TM EdU-555 cell proliferation detection kit is used for detection:
[0212] 1. Cell seeding: 1×10 5 Cells / well were seeded in 24-well plates and cultured for 24 h.
[0213] 2. EdU labeling: Add 20 μM EdU culture medium (RPMI-1640 culture medium and EdU stock solution diluted at a ratio of 500:1) and incubate at room temperature for 4 hours.
[0214] 3. Fixation and staining: Fix, wash, permeabilize, wash the cells and then add Click reaction solution and Hoechst 33342 for staining.
[0215] 4. Observation and calculation: Observe under a fluorescence microscope, take photos, and calculate the cell proliferation rate.
[0216] 2.7 Cell scratch assay
[0217] (1) Use a marker pen to draw three horizontal lines evenly on the back of the 6-well plate
[0218] (2) The desired experimental cells were digested and subcultured into 6-well plates. When the cell density reached 90%-100%, a straight line was drawn perpendicular to the bottom of the plate using a 200 μL sterile pipette tip. The original culture medium was then discarded and the cells were washed 2-3 times with PBS to remove floating dead cells.
[0219] (3) Add 1.5 ml of serum-free culture medium and take pictures under an inverted microscope, which is regarded as the 0 h of cell migration.
[0220] (4) After culturing for 48 h, take photos under an inverted microscope at the same location as before.
[0221] (5) Use ImageJ software to analyze the scratch area at different times and analyze the results.
[0222] 2.8 Transwell migration assay
[0223] (1) Cell preparation: Digest the required experimental cells, stop the complete culture medium, centrifuge, wash with sterile PBS once, resuspend the cells in serum-free culture medium, and count the cells to make the final cell concentration 1×10 5 pcs / ml.
[0224] (2) Cell culture: Slowly add 600 μL of complete culture medium containing 10% FBS to the lower chamber and shake well. Then slowly vertically add 100 μL of the cell suspension from step (1) to the lower chamber. Carefully and steadily place the chamber in the incubator and culture for 48 hours. Note: After 2 hours of culture, remove the chamber and observe under a microscope for bubbles. If any bubbles are present, remove them immediately. Do not allow bubbles to form between the chamber and the culture medium, otherwise they will affect cell migration.
[0225] (3) Fixation: Use forceps to carefully remove the chamber, discard the original culture medium, rinse with PBS three times, add 100 μl of 4% paraformaldehyde to the upper chamber and 600 μl of 4% paraformaldehyde to the lower chamber respectively, and fix at room temperature for 30-40 minutes.
[0226] (4) Staining: Aspirate the fixative, rinse the cells 2-3 times with PBS, slowly add 600 μl of 1% crystal violet staining solution, and incubate at room temperature in the dark for 15-20 minutes.
[0227] (5) Observation: Wash the chamber with PBS and gently wipe off the cells in the upper chamber with a cotton swab. Take photos and observe under an inverted microscope for statistics.
[0228] 2.9 Transwell invasion assay
[0229] (1) Matrigel treatment: The night before the invasion experiment, seal the pre-packaged Matrigel (10 mg / ml) centrifuge tube with sealing film, take it out from -20°C and slowly thaw it at 4°C.
[0230] (2) Dilute Matrigel to a final concentration of 1 mg / ml using serum-free medium pre-cooled at 4°C. Add 80 μL of Matrigel dilution vertically to the center of the upper chamber of the cell and incubate in a cell culture incubator for 2-4 h to allow the gel to solidify.
[0231] (3) The subsequent steps were the same as those in the Transwell migration assay (1)-(5), except that 200 μl of the cell resuspension in (1) was added to the upper chamber of the cell culture chamber (2).
[0232] 2.10 Total Cell Protein Extraction
[0233] (1) Reagent preparation
[0234] 1) The 6× sample buffer was prepared as follows:
[0235]
[0236] (2) Protein extraction (taking QBC939 cells cultured in 6-well plates as an example)
[0237] 1) Discard the original culture medium and wash the cells three times with pre-chilled PBS. Pat the cell culture dish dry with absorbent paper on the laboratory bench and place it on ice. Add 120 μL of RIPA Lysis Buffer to each well of the culture dish.
[0238] 2) Use a cell scraper to scrape the cells from the bottom of the culture dish and transfer the RIPA lysis buffer-cell mixture into a 1.5 mL RNase-free centrifuge tube on ice.
[0239] 3) Place the centrifuge tube in a liquid nitrogen container and freeze and thaw repeatedly three times. Vortex mix after each freeze and thaw.
[0240] 4) Centrifuge the mixture from the previous step at 4°C, 13,000 rpm for 10 min. The total cellular protein is now distributed in the supernatant.
[0241] 5) Aspirate the supernatant containing total cell protein and transfer it to a new 1.5 mL RNase-free centrifuge tube. Take 10 μL of the protein solution and determine the concentration.
[0242] 6) Add 6× Sample Buffer to the supernatant collected in the previous step at a volume of 1 / 5 of the supernatant. Mix thoroughly by pipetting on ice. Centrifuge briefly and heat the protein sample at 100°C for 7 minutes in a metal heater to denature the protein. Aliquot the sample into 1.5 mL RNase-free centrifuge tubes and store in a -80°C freezer until needed.
[0243] (3) BCA protein content determination
[0244] 1) Follow the BCA protein assay instructions, measure the absorbance using a standard, and plot a standard curve.
[0245] 2) Dilute the sample to be tested to an appropriate concentration and use an enzyme-labeled instrument to detect the absorbance of the sample.
[0246] 3) Calculate the concentration of the protein sample based on the standard curve obtained from the standard.
[0247] 2.11 Western blot experiment
[0248] (1) Reagent preparation
[0249] 1) 1× Running buffer: Weigh 3.03 g Tris, 14.4 g glycine, and 1 g SDS separately into a 1 L beaker. Add 800 mL ddH2O and stir until dissolved. Make up to 1 L with ddH2O. Prepare running buffer immediately.
[0250] 2) 1× Transfer Buffer: Weigh 3.03 g Tris and 14.4 g glycine separately into a 1 L beaker, add 600 mL ddH2O, and stir until dissolved. Make up to 800 mL with ddH2O. Pre-chill the transfer buffer at 4°C. Add 200 mL of pre-chilled methanol to make up to 1 L before transfer. Prepare the transfer buffer freshly for use.
[0251] 3) TBST buffered saline solution: Add 500 μL of Tween-20 to 500 mL of TBS, shake well, and store at 4°C until use.
[0252] 4) Blocking solution: Weigh 2 g of skim milk powder into a 50 mL centrifuge tube, add TBST buffered saline to 50 mL, and store at 4°C until ready for use.
[0253] 5) Primary Antibody Diluent 5% BSA: Weigh 2.5 g of bovine serum albumin (BSA) and add it to 40 mL of TBST. Dissolve the BSA and dilute to 50 mL.
[0254] 6) SDS-PAGE gel preparation (prepare according to the instructions)
[0255] a. Mix each component by inverting 6-8 times before use.
[0256] b. Preparation of the lower gel layer: Take equal volumes of Resolver A and Resolver B, 4.0 ml each, and mix well.
[0257] c. Preparation of the top layer: Take equal volumes of Stacker A and Stacker B, 1.0 ml each, and mix well.
[0258] d. Add 80 μl of APS to the mixed solution in step b, mix thoroughly immediately, and then inject into the glass plate so that the liquid level is about 1.5 cm from the upper edge of the short glass plate.
[0259] e. Add 20 μl of APS to the mixed solution in step c, mix thoroughly immediately, and slowly add it to the glass plate along the long glass plate, then gently insert the comb teeth.
[0260] f. Place at room temperature for 25 minutes to solidify, and slowly remove the comb teeth in the electrophoresis solution.
[0261] (2) Western blot experimental steps
[0262] 1) Preparation before electrophoresis
[0263] 1. Gel plate treatment: Rinse the gel plate with ddH2O and blow dry, then place it in the electrophoresis tank; add an appropriate amount of 1× electrophoresis buffer, remove the comb, and use a 1mL pipette to blow clean the gel holes.
[0264] 2. Pre-electrophoresis: 80V, constant voltage, empty run, 30min, to remove impurities in the gel.
[0265] 2) Sample loading and electrophoresis
[0266] 1. Sample loading: After the dry run, load the protein sample and protein marker into the center well of the gel. Add an equal volume of 1× Sample Buffer to the edge wells to balance the sample weight.
[0267] 2. Electrophoresis: Run at a constant voltage of 80V until the sample enters the separating gel. Then adjust the voltage to 120V and continue electrophoresis. The time is determined by the molecular weight of the target protein.
[0268] 3) Transfer
[0269] 1. PVDF membrane preparation: Cut the PVDF membrane according to the size of the target protein band and activate it by soaking in methanol.
[0270] 2. Transfer operation: Remove the electrophoresis gel plate, cut off the concentrated gel, and gently peel off the separation gel; cover the activated PVDF membrane on the separation gel and clamp the transfer splint; place the splint in the electrophoresis tank and cover it with ice to cool it down.
[0271] 3. Transfer conditions: Constant current 350mA transfer, time adjusted according to the molecular weight of the target protein.
[0272] 4) Closed
[0273] 1. Blocking: After transfer, mark the front and back of the PVDF membrane. Place the membrane in blocking solution and block on a shaker at room temperature for 1.5 hours.
[0274] 5) Primary antibody incubation
[0275] 1. Primary antibody preparation: Dilute the primary antibody in 5% BSA containing 0.5% Tween 20.
[0276] 2. Incubation conditions: Place the PVDF membrane in the primary antibody dilution buffer and incubate overnight at 4°C on a slow shaker.
[0277] 6) Washing the membrane
[0278] 1. Primary antibody recovery: After incubation, recover the primary antibody and store at -20°C. Reuse no more than three times.
[0279] 2. Washing: Wash the membrane quickly with TBST at room temperature for 10 min each time, 3 times.
[0280] 7) Secondary antibody incubation
[0281] 1. Secondary antibody preparation: Dilute the secondary antibody in TBST.
[0282] 2. Incubation conditions: Place the PVDF membrane in the secondary antibody dilution solution and incubate at room temperature on a slow shaker for 1.5 hours.
[0283] 8) Washing the membrane
[0284] 1. Secondary antibody recovery: After incubation, recover the secondary antibody and reuse it no more than 5 times.
[0285] 2. Washing: Wash the membrane quickly with TBST at room temperature three times, 10 min each time.
[0286] 9) Color development
[0287] 1. Preparation of color development solution: Mix equal volumes of ECL color development solution and diluent.
[0288] 2. Color development: Soak the PVDF membrane in diluted color development solution for 10-30 seconds (adjust the time according to the protein expression level); use a Tanon 5200 membrane scanner to expose and develop the color and take pictures.
[0289] 10) Data Analysis
[0290] 1. Grayscale analysis: Use Image J software to analyze the grayscale value of the bands.
[0291] 2. Results presentation: Draw a histogram of protein expression and perform statistical analysis.
[0292] 2.12 Data Statistical Analysis
[0293] All results were independently repeated three times, and all experimental data are expressed as mean ± standard deviation. Differences between two samples were analyzed using a two-tailed t-test, and comparisons between multiple groups were performed using one-way analysis of variance (ANOVA). * indicates p < 0.05, ** indicates p < 0.01, and *** indicates p < 0.001.
[0294] 3 Experimental results
[0295] 3.1 Silencing circZFX significantly inhibits the proliferation of cholangiocarcinoma cells
[0296] Cancer is a highly heterogeneous disease characterized by uncontrolled cell growth, abnormal proliferation, resistance to apoptosis, acquired invasiveness, and abnormal cell survival. Unrestrained, abnormal proliferation of cancer cells is one of the most prominent features of malignant tumors. Based on this characteristic, this study first focused on the effect of circZFX on the proliferation of cholangiocarcinoma cells.
[0297] To explore the function of circZFX, this application knocked down the expression level of circZFX by transfecting specific siRNA. RT-PCR test results showed that compared with the negative control group (siNC), the three siRNAs (siRNA-1, siRNA-2, siRNA-3) could significantly reduce the expression level of circZFX in the bile duct cancer cell lines HuCCT1 and QBC939. Specifically, after siRNA-1 transfection, the relative expression of circZFX in HuCCT1 and QBC939 cells decreased by 44% and 49%, respectively; after siRNA-2 transfection, the expression levels decreased by 51% and 50%, respectively; after siRNA-3 transfection, the expression levels decreased by 70% and 66%, respectively. Figure 1 Based on the above results, the present application selected siRNA-3 with the best interference efficiency to construct the sh-circZFX lentiviral vector.
[0298] Subsequently, the constructed sh-circZFX lentiviral vector was packaged in HEK293T cells and infected two cholangiocarcinoma cells, successfully establishing a cell line with stable knockdown of circZFX. RT-PCR verification results showed that the expression of circZFX in QBC939 cells was inhibited by more than 80%, and the expression of circZFX in HuCCT1 cells was inhibited by more than 60% ( Figure 1 Middle C), showing that circZFX was significantly knocked down in both cell lines.
[0299] To evaluate the effect of circZFX on cell proliferation, this application used CCK-8 assay and EdU imaging assay to detect the proliferation capacity of sh-circZFX stable knockdown cell lines. The results showed that compared with the control group, the proliferation rate of HuCCT1 cells with sh-circZFX stable knockdown significantly decreased over time ( Figure 2 EdU experiments further confirmed that the cell proliferation rate was significantly decreased; in QBC939 cells with sh-circZFX stably knocked down, the present application also observed a significant slowdown in cell proliferation rate and a significant decrease in the percentage of EdU-positive cells ( Figure 2These experimental results consistently showed that the inhibition of circZFX expression significantly reduced the proliferation ability of cholangiocarcinoma cells, suggesting that circZFX plays an important regulatory role in the proliferation of cholangiocarcinoma cells.
[0300] Silencing circZFX inhibits migration and invasion of cholangiocarcinoma cells
[0301] A wealth of clinical evidence indicates that the lethality of malignant tumors is primarily due to their invasive and metastatic properties, rather than the growth of the primary tumor. Statistics show that over 90% of solid tumor-related deaths are caused by metastatic disease, making elucidating the mechanisms regulating tumor metastasis a key scientific issue for improving cancer prognosis. This study, based on a previously discovered circular RNA molecule, circZFX, systematically investigated its regulatory effects on the migration and invasion of cholangiocarcinoma cells and the underlying mechanisms.
[0302] To evaluate the effect of circZFX on cell motility phenotype, this application used a cell scratch assay to quantitatively analyze the changes in migration dynamics after gene silencing. The results showed that in the HuCCT1 cell line, the relative healing rate of the circZFX shRNA transfection group decreased from 45.68% of the control group to 32.10% after 48 hours ( Figure 3 In the QBC939 cell line, the relative healing rate decreased significantly from 21.29% to 15.62% ( Figure 3 To further verify this, we established a three-dimensional motility model through Transwell migration assay and found that after circZFX knockdown for 48 hours, the number of cells passing through the 0.8 μm pore size polycarbonate membrane decreased by 64.86% in HuCCT1 and 84.00% in QBC939 ( Figure 3 Middle C). The consistency of two independent experiments confirmed that circZFX is a key regulatory factor in maintaining the migration ability of cholangiocarcinoma cells.
[0303] To analyze the regulatory effect of circZFX on the invasion process, this application constructed a Matrigel-simulated in vivo microenvironment model. Transwell invasion assays showed that circZFX knockdown significantly inhibited the degradation of extracellular matrix: the number of HuCCT1 cells penetrating the Matrigel layer decreased by 94.42%, and the number of QBC939 cells decreased by 77.31% ( Figure 3 Middle D). These results suggest that circZFX affects the invasive phenotype of tumor cells by regulating protease secretion or cytoskeleton remodeling.
[0304] This study, using a three-pronged approach involving a wound healing assay, a Transwell migration model, and a Matrigel invasion system, revealed for the first time the critical role of circZFX in cholangiocarcinoma metastasis. Gene silencing experiments confirmed that downregulating circZFX expression significantly inhibited tumor cell directional migration and matrix penetration, suggesting that it may affect cell motility by regulating epithelial-mesenchymal transition (EMT) or integrin signaling pathways. These findings provide direct experimental evidence for circZFX as a predictive marker and therapeutic target for cholangiocarcinoma metastasis and lay the theoretical foundation for the development of precise intervention strategies based on circular RNAs.
[0305] This chapter mainly studies the effects of circZFX on the biological functions of cholangiocarcinoma cells. By specifically inhibiting the expression of circZFX in cholangiocarcinoma cell lines HuCCT1 and QBC939, this application systematically evaluated the functional role of circZFX in the occurrence and development of cholangiocarcinoma. First, the CCK-8 assay and EdU imaging assay were used to detect cell proliferation ability. The results showed that the inhibition of circZFX significantly reduced the proliferation activity of cholangiocarcinoma cells. In addition, through cell scratch assay and Transwell migration / invasion assay, this application found that the inhibition of circZFX significantly weakened the migration and invasion ability of cholangiocarcinoma cells. Based on the above experimental results, this application confirmed that circZFX plays the role of an oncogene in cholangiocarcinoma and participates in the malignant progression of cholangiocarcinoma by promoting cell proliferation, migration and invasion. These findings provide important experimental basis for a deeper understanding of the molecular mechanism of circZFX in cholangiocarcinoma, and also provide theoretical support for the practice of precision medicine for cholangiocarcinoma.
[0306] 4.3.4circZFX Targets and Regulates HDGF Expression via ceRNA Mechanism
[0307] Based on the competitive endogenous RNA (ceRNA) characteristics of circZFX, this study integrated the miRDB, TargetScan, MicroT-CDS and miRTarBase databases to perform multi-source prediction of potential target genes of miR-654-3p, and screened out six intersection candidate genes including HDGF ( Figure 4 Middle A). Verification by the miRTarBase (v9.0) database revealed that the interaction between HDGF and miR-654-3p had the highest confidence (supporting evidence included dual luciferase reporter, RT-PCR and CLIP-seq data) ( Figure 4B), suggesting that HDGF may be the core target of the circZFX / miR-654-3p axis. Further analysis combined with the Starbase2.0 database revealed that HDGF was significantly overexpressed in cholangiocarcinoma tissues, and its expression level was significantly positively correlated with circZFX, while no significant correlation was found between FBXO47 and TMPRSS15 ( Figure 4 RT-PCR validation experiments showed that after knockdown of circZFX in QBC939 cells, HDGF mRNA expression decreased by 80% compared with the control group, while ERGIC2 expression was upregulated by 1.2-fold ( Figure 4 Cross-cell line analysis showed that HDGF mRNA was upregulated 1.8-fold and 5.7-fold in HuCCT1 and QBC939 cancer cells, respectively, compared with normal bile duct epithelial cells ( Figure 4 Middle E). GEPIA pan-cancer analysis further confirmed that HDGF expression levels were among the highest in cholangiocarcinoma ( Figure 4 F), suggesting its important potential as a therapeutic target for cholangiocarcinoma.
[0308] RNAhybrid prediction showed that miR-654-3p and HDGF 3'UTR region have highly conserved complementary binding sites ( Figure 4 To verify its binding specificity, HDGF wild-type and mutant luciferase reporter plasmids were constructed. The dual luciferase assay showed that after transfection with miR-654-3p mimics, the luciferase activity of the WT group decreased to 64%, while the activity of the MUT group did not change significantly ( Figure 4 Western blot results showed that overexpression of miR-654-3p in HuCCT1 cells downregulated HDGF protein levels by 68%, while inhibitor treatment upregulated it by 1.69-fold; a similar trend was observed in QBC939 cells (downregulated by 58%; upregulated by 2.79-fold) ( Figure 4 The above results systematically verified the molecular mechanism by which miR-654-3p negatively regulates HDGF expression by directly binding to its 3'UTR.
[0309] Effects of circZFX on the weight and volume of subcutaneous tumor tissue in nude mice
[0310] By establishing a nude mouse subcutaneous transplant tumor model, this application systematically evaluated the role of circZFX in cholangiocarcinoma tumorigenesis in vivo. The experimental results showed that HuCCT1 cells with stable circZFX knockdown could still form solid tumors under the skin of nude mice, but their growth characteristics were significantly different from those of the control group ( Figure 5Specifically, in the dynamic monitoring of tumor volume, it was found that the slope of the tumor growth curve in the circZFX silencing group was significantly lower than that in the control group, suggesting that circZFX knockdown can effectively inhibit tumor proliferation activity ( Figure 5 Anatomical measurements at the experimental endpoint showed that the tumor volume in the circZFX silencing group was reduced by approximately 57% compared with the control group, and the tumor wet weight decreased by approximately 81.42% ( Figure 5 It is worth noting that H&E staining showed that both groups of tumors maintained the typical morphological characteristics of solid tumors ( Figure 5 Middle (D), excluding the possibility that circZFX knockdown leads to changes in tumor differentiation status, further confirming that the growth inhibitory effect is mainly due to changes in cell proliferation ability rather than abnormal differentiation.
[0311] 4.3.7 Expression Characteristics of HDGF / YAP1 / Ki67 Signaling and Proliferation Markers in Nude Mouse Xenografts
[0312] To further analyze the molecular mechanism of circZFX regulating tumor growth, this application used immunohistochemistry to detect the expression characteristics of key signaling molecules in transplanted tumor tissues. The results showed that ( Figure 6 In Figures AB and AB, compared with the control group, the signal intensity of the oncogenic factor HDGF decreased by approximately 18%, and the expression of YAP1, a core effector molecule of the Hippo pathway, decreased by approximately 21%. Importantly, the positive rate of the cell proliferation marker Ki67 in the experimental group was only 19% of that in the control group, highly consistent with the proliferation inhibition phenotype observed in vitro and in vivo. These findings suggest that circZFX may affect the proliferation activity of tumor cells by regulating the HDGF / YAP1 signaling axis.
[0313] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. A circZFX expression inhibitor, wherein the circZFX expression inhibitor is selected from at least one of a to c: a. siRNA-1 whose nucleotide sequence is shown in SEQ ID NO: 1; b. siRNA-2 whose nucleotide sequence is shown in SEQ ID NO: 2; c. siRNA-3 whose nucleotide sequence is shown in SEQ ID NO:
3.
2. The circZFX expression inhibitor according to claim 1, characterized in that The circZFX expression inhibitor is chemically synthesized.
3. A delivery system for a circZFX expression inhibitor, comprising the circZFX expression inhibitor according to any one of claims 1-2 and a vector.
4. A pharmaceutical composition comprising the circZFX expression inhibitor according to any one of claims 1-2 or the delivery system according to claim 3, and a pharmaceutically acceptable excipient.
5. Use of the circZFX expression inhibitor according to any one of claims 1 to 2 in the preparation of a medicament for preventing and / or treating bile duct cancer.
6. Use of the delivery system according to claim 3 in the preparation of a medicament for preventing and / or treating bile duct cancer.
7. Use of the pharmaceutical composition according to claim 4 in the preparation of a medicament for preventing and / or treating bile duct cancer.
8. The use according to any one of claims 5 to 7, characterized in that: The circZFX expression inhibitor can significantly inhibit the proliferation of cholangiocarcinoma cells.
9. The use according to any one of claims 5 to 7, characterized in that: The circZFX expression inhibitor can significantly inhibit the migration and invasion of cholangiocarcinoma.
10. The use according to any one of claims 5 to 7, characterized in that: The circZFX expression inhibitor can significantly reduce the expression level of circZFX in cholangiocarcinoma cells.