Lentinus edodes MAPK gene Le-10004182 and application thereof in regulation and control of mycelium biomass

By constructing and transferring the overexpression and interference vector of the shiitake MAPK gene Le-10004182, the problem of slow growth of shiitake mushroom mycelium was solved, the mycelium biomass was increased, the production cycle was shortened and the cost was reduced, and new methods were provided for the improvement of shiitake mushroom variety.

CN120485219APending Publication Date: 2025-08-15SHANGHAI ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510489600.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-17
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

In the existing mushroom production, the mycelium grows slowly, has a long production cycle and is costly, the traditional breeding methods are cumbersome and inefficient, and there is a lack of effective biological breeding methods to improve mycelium yield and biomass.

Method used

By constructing the overexpression vector and interference vector of the shiitake MAPK gene Le-10004182, it was transferred to the shiitake mycelium by using Agrobacterium-mediated genetic transformation method to achieve regulation of mycelium growth.

Benefits of technology

It significantly increases the mycelium mycelium biomass of shiitake mushrooms, shortens the cultivation cycle, reduces production costs, and provides new ideas for improving mushroom varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485219A_ABST
    Figure CN120485219A_ABST
Patent Text Reader

Abstract

The invention discloses a lentinus edodes MAPK family gene Le-10004182, and the sequence of the lentinus edodes MAPK family gene Le-10004182 is shown as SEQ ID NO. 1. An overexpression vector or an interference vector of the gene Le-10004182 is constructed through a cDNA (complementary deoxyribonucleic acid) sequence of the gene Le-10004182, and the overexpression vector or the interference vector is transferred into mushroom mycelia through an agrobacterium tumefaciens-mediated genetic transformation method, so that the biomass of the mushroom mycelia is regulated and controlled. The lentinus edodes MAPK family gene Le-10004182 and the regulation and control of the lentinus edodes MAPK family gene Le-10004182 on the growth of lentinus edodes mycelia provide a new solution thought for further analysis of the growth and development of the lentinus edodes mycelia and variety improvement.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of fungal genetic engineering, and specifically discloses a Lentinus edodes MAPK family gene Le-10004182 and its application in regulating hyphae growth. Background Art

[0002] Lentinula edodes has a delicious flavor and unique aroma, rich in protein, amino acids, lentinan, and minerals. Widely cultivated in my country, it has long ranked first among edible fungi in terms of production output. Mycelial growth rate and biomass are key factors influencing the cultivation cycle and yield of Lentinula edodes. Currently, Lentinula edodes can be produced in two ways: traditional workshop production and factory-based production. Factory-based production faces challenges such as slow mycelial growth, long production cycles, and high costs. Traditional breeding methods are cumbersome, time-consuming, costly, and inefficient. In recent years, advances in molecular biology techniques have provided new approaches for improving the traits of edible fungi. Biobreeding methods can achieve rapid, targeted, and efficient variety improvement, yielding superior varieties with specific traits.

[0003] Therefore, it is necessary to research and develop biotechnological methods to increase the mycelial yield and biomass of Lentinus edodes. Summary of the Invention

[0004] The present invention first provides a Lentinus edodes MAPK gene Le-10004182, the gene sequence of which is shown as SEQ ID NO.1, with a full length of 1122 bp, and the amino acid sequence encoded by the gene is shown as SEQ ID NO.2.

[0005] The present invention also provides an application of the Lentinus edodes MAPK gene Le-10004182 in regulating mycelial growth, which comprises the following steps:

[0006] Extracting RNA from Lentinus edodes mycelia, reverse-transcribing to obtain cDNA, amplifying the cDNA sequence of the Le-10004182 gene, constructing an overexpression vector or interference vector of the gene Le-10004182, and transferring it into Lentinus edodes mycelia through Agrobacterium-mediated genetic transformation;

[0007] Specifically, the application of Lentinus edodes MAPK gene Le-10004182 in regulating mycelial growth includes the following steps:

[0008] (1) Gene cloning

[0009] RNA was extracted from Lentinus edodes mycelium and reverse transcribed to obtain cDNA. Gene cDNA primers were designed: MAPK-F: ATGTCTCGCAAAGCTCCCTC and MAPK-R: CTAGGATGCGGCTGTCTTGA. Using the cDNA of Lentinus edodes cultivated strain 4606 as a template, the cDNA sequence of the Le-10004182 gene (SEQ ID NO. 1) was amplified.

[0010] (2) Construction of overexpression vector or interference vector

[0011] The overexpression vector was constructed as follows: the amplified Le-10004182 gene cDNA sequence (SEQ ID NO.1) was used as a template, and the stop codon was removed to obtain the overexpression fragment SEQ ID NO.3; primers MAPK-egfp-BF: CTCTTCATCCCCCTCTCAACATGTCTCGCAAAGCTCCCTC and MAPK-egfp-BR: GATGCAGGACTCACGGGCATGGATGCGGCTGTCTTGAGAG with vector homology arms were designed to amplify the overexpression Le-10004182 gene linear target fragment with homology arms; vector GPIE-OE was used as the vector backbone, and Bam HI was used for single enzyme digestion and gel recovery to obtain a linear vector; the linear target fragment and the linearized vector were homologously recombined by the one-step cloning method and transformed into Escherichia coli competent cells DH5α. The positive clones were sequenced using primers MAPK-egfp-yzF: CCTCTCAACATGTCTCGCAAAGCTC and MAPK-egfp-yzR: GCCAAACGATGAGGTGAATACGGT; the vector plasmid of the positive clone was extracted, which was the recombinant overexpression vector MAPK-OE;

[0012] The interference vector, i.e., the RNAi vector, was constructed as follows: the amplified Le-10004182 gene cDNA sequence (SEQ ID NO. 1) was used as a template, and primers MAPK-BcuI-F with restriction enzyme cleavage sites: GCaCTAGTATGCAAACTGATCTCCACCG and MAPK-MluI-RATacgcgTGTCATGGTAAGCAGCGACAT were designed to amplify the interference fragment (SEQ ID NO. 4); the bidirectional interference vector GPIE-DpV was used as the vector backbone, and the vector and the target fragment were double-digested with Bcu I and Mlu I, respectively. The target fragment with sticky ends obtained by gel recovery was ligated with the linearized vector using T4 ligase, and the recombinant vector was transformed into Escherichia coli competent cells DH5α, and the primers MAPK-RNAi-yzF:

[0013] AGTTGTGTTTTTCGTCCGCATCTTTTCCT and MAPK-RNAi-yzR: AAGGAAGTTCATTTCATTTGGAGAGGACA were sequenced for positive clone detection; the vector plasmid of the positive clone was extracted, which was the recombinant interference vector MAPK-RNAi;

[0014] (3) Genetic transformation and phenotypic analysis of Lentinus edodes

[0015] The shiitake mushroom strain is transformed by Agrobacterium-mediated genetic transformation, and stable overexpression transformants or RNAi-interference positive transformants are obtained by hygromycin screening; positive transformants are identified by PCR and real-time fluorescence quantitative PCR, and the desired overexpression transformants and RNAi transformants are finally obtained;

[0016] Specifically, there are three overexpression transformants (OE-1, OE-2, OE-3) and two RNAi transformants (RNA i-R1 and RNA i-R2).

[0017] The overexpression transformants or RNAi transformants were inoculated into PDB liquid culture medium, cultured in a shaker at 25°C in the dark for 7 days at a rotation speed of 150 rpm / min. The mycelium was collected by filtration, dried at a constant temperature of 50°C to constant weight, and the mycelium weight was measured. The mycelial biomass of Lentinus edodes strains OE-1, OE-2, and OE-3, in which the Le-10004182 gene was overexpressed, was significantly higher than that of the wild type, while the mycelial biomass of Lentinus edodes strains RNA i-R1 and RNA i-R2, in which the Le-10004182 gene was interfered with, was significantly lower than that of the wild type, indicating that the Le-10004182 gene positively regulates the growth of Lentinus edodes mycelium.

[0018] The present invention also provides an application of the Lentinus edodes MAPK gene Le-10004182 in improving the growth of Lentinus edodes mycelium, which comprises the following steps:

[0019] Extracting RNA from Lentinus edodes mycelia, reverse-transcribed to obtain cDNA, amplifying the cDNA sequence of the Le-10004182 gene without the stop codon, constructing a Le-10004182 gene overexpression vector, and transferring it into Lentinus edodes mycelia via Agrobacterium-mediated genetic transformation.

[0020] Specifically, the application of Lentinus edodes MAPK gene Le-10004182 in increasing Lentinus edodes mycelial biomass includes the following steps:

[0021] (1) Extract RNA from Lentinus edodes mycelium, reverse transcribe to obtain cDNA, and amplify the cDNA sequence of the Le-10004182 gene; design gene cDNA primers: MAPK-F: ATGTCTCGCAAAGCTCCCTC and MAPK-R: CTAGGATGCGGCTGTCTTGA; use the cDNA of Lentinus edodes cultivation strain 4606 as a template to amplify the cDNA sequence of the Le-10004182 gene (SEQ ID NO. 1)

[0022] (2) Construction of overexpression vector

[0023] The amplified Le-10004182 gene cDNA sequence (SEQ ID NO.1) was used as a template to remove the stop codon to obtain the overexpression fragment SEQ ID NO.3; primers MAPK-egfp-BF with vector homology arms: CTCTTCATCCCCCTCTCAACATGTCTCGCAAAGCTCCCTC and MAPK-egfp-BR:

[0024] GATGCAGGACTCACGGGCATGGATGCGGCTGTCTTGAGAG, amplify and obtain the linear target fragment of the overexpressed Le-10004182 gene with homology arms; use the vector GPIE-OE as the vector backbone, use Bam HI for single enzyme digestion, and recover the linear vector on gel; homologous recombination is carried out between the linear target fragment and the linearized vector by one-step cloning method, and the cells are transformed into Escherichia coli competent cells DH5α, and the positive clones are sequenced and tested using primers MAPK-egfp-yzF: CCTCTCAACATGTCTCGCAAAGCTC and MAPK-egfp-yzR: GCCAAACGATGAGGTGAATACGGT; the vector plasmid of the positive clone is extracted, which is the recombinant overexpression vector MAPK-OE;

[0025] (3) Genetic transformation and phenotypic analysis of Lentinus edodes

[0026] The shiitake mushroom strain was transformed using Agrobacterium-mediated genetic transformation, and stable overexpression transformants were obtained by hygromycin screening. Positive transformants were identified by PCR and real-time fluorescence quantitative PCR, and the desired overexpression transformants were finally obtained.

[0027] Specifically, there are three overexpression transformants (OE-1, OE-2, and OE-3).

[0028] The overexpressed transformants and the wild type were inoculated into PDB liquid culture medium, respectively, and cultured in a shaker at 25°C in the dark for 7 days at a rotation speed of 150 rpm / min. The mycelium was collected by filtration, dried at a constant temperature of 50°C to a constant weight, and the mycelium weight was measured. The mycelial biomass of the Lentinus edodes strains OE-1, OE-2, and OE-3 overexpressing the Le-10004182 gene was significantly higher than that of the wild type, indicating that the Le-10004182 gene positively regulates the growth of Lentinus edodes mycelium.

[0029] The present invention also provides a recombinant overexpression vector MAPK-OE and a recombinant interference vector MAPK-RNAi prepared by the above method.

[0030] The present invention further provides genetically engineered strains (OE-1, OE-2, OE-3) with overexpression of the Le-10004182 gene and genetically engineered strains (RNA i-R1 and RNA i-R2) with interference of the Le-10004182 gene, prepared by the above method.

[0031] A method for increasing the biomass of Lentinus edodes mycelium, the method comprising the following steps:

[0032] Extracting RNA from Lentinus edodes mycelia, reverse-transcribed to obtain cDNA, amplifying the cDNA sequence of the Le-10004182 gene without the stop codon, constructing a Le-10004182 gene overexpression vector, and transferring it into Lentinus edodes mycelia via Agrobacterium-mediated genetic transformation.

[0033] Specifically, a method for increasing the biomass of Lentinus edodes mycelium comprises the following steps:

[0034] (1) Extract RNA from Lentinus edodes mycelium, reverse transcribe to obtain cDNA, and amplify the cDNA sequence of the Le-10004182 gene; design gene cDNA primers: MAPK-F: ATGTCTCGCAAAGCTCCCTC and MAPK-R: CTAGGATGCGGCTGTCTTGA; use the cDNA of Lentinus edodes cultivation strain 4606 as a template to amplify the cDNA sequence of the Le-10004182 gene (SEQ ID NO. 1)

[0035] (2) Construction of overexpression vector

[0036] The amplified Le-10004182 gene cDNA sequence (SEQ ID NO.1) was used as a template to remove the stop codon to obtain the overexpression fragment SEQ ID NO.3; primers MAPK-egfp-BF with vector homology arms: CTCTTCATCCCCCTCTCAACATGTCTCGCAAAGCTCCCTC and MAPK-egfp-BR:

[0037] GATGCAGGACTCACGGGCATGGATGCGGCTGTCTTGAGAG, amplify and obtain the linear target fragment of the overexpressed Le-10004182 gene with homology arms; use the vector GPIE-OE as the vector backbone, use Bam HI for single enzyme digestion, and recover the linear vector on gel; homologous recombination is carried out between the linear target fragment and the linearized vector by one-step cloning method, and the cells are transformed into Escherichia coli competent cells DH5α, and the positive clones are sequenced and tested using primers MAPK-egfp-yzF: CCTCTCAACATGTCTCGCAAAGCTC and MAPK-egfp-yzR: GCCAAACGATGAGGTGAATACGGT; the vector plasmid of the positive clone is extracted, which is the recombinant overexpression vector MAPK-OE;

[0038] (3) Genetic transformation and phenotypic analysis of Lentinus edodes

[0039] The Lentinus edodes strains were transformed using Agrobacterium-mediated genetic transformation. Stable overexpression transformants were obtained by hygromycin selection. Positive transformants were identified by PCR and real-time fluorescence quantitative PCR, ultimately yielding the desired overexpression transformants, specifically three overexpression transformants (OE-1, OE-2, and OE-3). The overexpression transformants and the wild type were inoculated into PDB liquid medium and incubated in a shaker at 25°C in the dark for 7 days at 150 rpm / min. Mycelia were collected by filtration and dried at 50°C to constant weight, and mycelial weight was measured. The mycelial biomass of Lentinus edodes strains OE-1, OE-2, and OE-3 overexpressing the Le-10004182 gene was significantly higher than that of the wild type, indicating that the Le-10004182 gene positively regulates mycelial growth.

[0040] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0041] This invention discloses for the first time the MAPK family gene Le-10004182 of Lentinus edodes and its application in regulating mycelial growth. The MAPK family gene Le-10004182 was overexpressed and interfered with in a Lentinus edodes strain. Wild-type strains and overexpressed and interfered transformants were inoculated into PDB liquid culture medium. Mycelial biomass was measured after 7 days of culture. The results showed that mycelial biomass was significantly higher after overexpression of the gene than after interference with the gene, while mycelial biomass was significantly lower after interference with the gene than after the wild-type strain, indicating that the Le-10004182 gene positively regulates mycelial growth. These results provide new solutions for further analyzing mycelial growth and development of Lentinus edodes and for variety improvement.

[0042] This invention reveals for the first time the function of Le-10004182 in regulating the growth and development of Lentinus edodes mycelium, providing a new approach for achieving biological breeding through targeted modification of this gene, thereby increasing mycelium growth rate, shortening cultivation cycle, and reducing production costs, and has important scientific and application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 Overexpression vector MAPK-OE plasmid map

[0044] Figure 2 MAPK-RNAi plasmid map for interference vector

[0045] Figure 3 qRT-PCR was used to detect the gene expression levels of Lentinus edodes wild-type strain 4606, overexpression transformant and interference transformant Le-10004182.

[0046] Figure 4 The growth conditions (A) and mycelial biomass (B) of wild-type strain 4606, overexpression transformants and interference transformants in PDB liquid medium.

[0047] in, Figure 3 and Figure 4 In the data, WT-4606 is the wild-type strain, OE-1, OE-2, and OE-3 are three overexpression transformants, and RNAi-R1 and RNAi-R2 are two interference transformants. DETAILED DESCRIPTION

[0048] Unless otherwise specified, the methods used in the following examples are all conventional biological experimental methods. The primers and sequencing used were all completed by Sangon Biotech (Shanghai) Co., Ltd.; RNA extraction kit, T4 DNA Ligase, kanamycin (kan), rifampicin (rif), LB powder, cefotaxime (cef), and acetosyringone (AS) were purchased from Sangon Biotech (Shanghai) Co., Ltd.; restriction endonucleases BcuⅠ, MluⅠ, and Bam HI were purchased from Thermo Fisher Scientific; vector GPIE-OE and bidirectional interference vector GPIE-DpV, and Lentinus edodes 4606 strain were obtained from the Edible Fungi Research Institute of the Shanghai Academy of Agricultural Sciences. Escherichia coli competent cells DH5α and Agrobacterium competent cells EHA105 were obtained from Beijing Qingke Biotechnology Co., Ltd.

[0049] The remaining reagents and materials are common commercial products.

[0050] Example 1 Application of Lentinus edodes MAPK gene Le-10004182 in regulating mycelial growth includes the following steps:

[0051] (1) Extract genomic RNA from Lentinus edodes mycelium, obtain cDNA through reverse transcription, and amplify the cDNA sequence of the Le-10004182 gene

[0052] Design gene cDNA primers: MAPK-F: ATGTCTCGCAAAGCTCCCTC and MAPK-R: CTAGGATGCGGCTGTCTTGA.

[0053] The genomic RNA of Lentinus edodes 4606 strain was extracted using an RNA extraction kit, and cDNA was obtained by reverse transcription. The cDNA of Lentinus edodes 4606 strain was used as a template to amplify the cDNA sequence of the Le-10004182 gene (SEQ ID NO.1).

[0054] Reaction system 1-5 TM 2× High Fideity MasterMix 25ul, cDNA 3ul, primers 2ul each, ddH2O 18ul;

[0055] Reaction parameters: pre-denaturation at 98°C for 2 min; denaturation at 98°C for 10 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, 30 cycles; complete extension at 72°C for 5 min.

[0056] The basic physicochemical properties of Le-10004182 protein were analyzed. The results showed that the Le-10004182 gene encodes 373 amino acids, and the amino acid sequence is shown in SEQ ID NO.2. The online prediction results showed that the gene encoding product is 230aa in size, with a molecular weight of 25.48kDa and a protein formula of C 1076 H 1713 N 347 O 347 S 13 The theoretical isoelectric point is 9.81, the instability coefficient is 36.26, and it is a stable protein.

[0057] (2) Construction of overexpression vector or interference vector

[0058] ① Overexpression vector construction

[0059] The cDNA sequence of the Le-10004182 gene (SEQ ID NO. 1) amplified in the above step was used as a template, and the stop codon was removed to obtain the overexpression fragment SEQ ID NO. 3.

[0060] Design primers with vector homology arms:

[0061] MAPK-egfp-BF: CTCTTCATCCCCTCTCAACATGTCTCGCAAAGCTCCCTC and MAPK-egfp-BR: GATGCAGGACTCACGGGCATGGATGCGGCTGTCTTGAGAG.

[0062] Amplify the linear target fragment of the overexpressed Le-10004182 gene with homology arms, reaction system 1-5 TM 2× High Fideity MasterMix 25ul, cDNA 3ul, primers 2ul each, ddH2O 18ul; reaction parameters: 98℃ pre-denaturation 2min; 98℃ denaturation 10s, 58℃ annealing 30s, 72℃ extension 30s, 30 cycles; 72℃ full extension 5min.

[0063] Using the GPIE-OE vector as the vector backbone, single enzyme digestion was performed using Bam HI. The reaction system was as follows: 5 μl Fast DigestGreen Buffer; 2.5 μl Bam HI; 1 ng of plasmid (GPIE-OE vector); ddH2O was added to 50 μl, and the linear vector was recovered by gel recovery.

[0064] The linear target fragment and the linear vector were homologously recombined by one-step cloning method and transformed into E. coli competent cells DH5α. The positive clones were sequenced using primers MAPK-egfp-yzF: CCTCTCAACATGTCTCGCAAAGCTC and MAPK-egfp-yzR: GCCAAACGATGAGGTGAATACGGT. The vector plasmid of the positive clone was extracted, which was the recombinant overexpression vector MAPK-OE( Figure 1 ).

[0065] ② Construction of RNAi vector

[0066] The cDNA sequence of Le-10004182 gene (SEQ ID NO. 1) amplified in the above steps was used as a template, and primers MAPK-BcuI-F with restriction enzyme sites: GCaCTAGTATGCAAACTGATCTCCACCG and MAPK-MluI-RATacgcgTGTCATGGTAAGCAGCGACAT were designed to amplify the interference fragment (SEQ ID NO. 4). TM2× High Fideity MasterMix 25ul, cDNA 3ul, primers 2ul each, ddH2O 18ul; reaction parameters: 98°C pre-denaturation 2min; 98°C denaturation 10s, 58°C annealing 30s, 72°C extension 30s, 30 cycles; 72°C full extension 5min;

[0067] The bidirectional interference vector GPIE-DpV was used as the vector backbone. The vector and target fragment were double-digested with Bcu I and Mlu I, respectively. The reaction system was as follows: Fast Digest Green Buffer 5μl; Bcu I and Mlu I 2.5μl each; plasmid / target fragment 1ng; ddH2O was added to 50μl; the target fragment with sticky ends obtained by gel recovery was ligated with the linearized vector using T4 ligase. The recombinant vector was transformed into Escherichia coli competent cells DH5α, and the primers MAPK-RNAi-yzF: AGTTGTGTTTTTCGTCCGCATCTTTTCCT and MAPK-RNAi-yzR: AAGGAAGTTCATTTCATTTGGAGAGGACA were used for sequencing of positive clones. The vector plasmid of the positive clone was extracted, which was the recombinant interference vector MAPK-RNAi ( Figure 2 ).

[0068] (3) Genetic transformation and phenotypic analysis of Lentinus edodes

[0069] ① Overexpression and interference vectors are transferred into Agrobacterium

[0070] The recombinant vectors MAPK-OE and MAPK-RNAi constructed above were respectively transformed into Agrobacterium competent cells EHA105 using the freeze-thaw method.

[0071] The steps are as follows: take Agrobacterium competent cells stored at -80°C, wait for them to thaw and be in an ice-water mixture, insert them into ice; add 5 μL of plasmid DNA for every 100 μL of competent cells, stir the bottom of the tube to mix, and let it stand on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes; add 900 μL of antibiotic-free LB medium, and culture on a shaker at 28°C for 3.5 hours; centrifuge at 5000 rpm for 3 minutes, retain about 100 μL of supernatant, pipette to resuspend the bacteria, and spread it onto an LB medium plate containing 50 μg / mL kan and 20 μg / mL rif; incubate the plate upside down in a 28°C incubator for 2-3 days, about 60 hours;

[0072] Positive clones expressing the overexpression vector MAPK-OE were sequenced using primers MAPK-egfp-yzF and MAPK-egfp-yzR. Positive clones expressing the interference vector MAPK-RNAi were sequenced using primers MAPK-RNAi-yzF and MAPK-RNAi-yzR. Positive monoclonal strains were cultured to an OD600 of 1.8-2.0, added to an equal volume of 50% glycerol, and stored at -80°C for future research.

[0073] ② Agrobacterium-mediated genetic transformation of Lentinus edodes millet

[0074] (1) Inoculate shiitake mycelium with millet culture medium. Select shiitake 4606 strain that has been cultured on a PDA plate for about 15 days and has just grown all over the plate. Use a sterile scalpel to cut off the central inoculation area. Transfer the remaining mycelium and culture medium to a homogenizer and pour in 100 mL of PDB culture medium (cooled to room temperature). Break for 6 seconds, rest for 3 seconds, and repeat the cycle 4 times. Take 8 mL of the broken culture medium and inoculate it into the millet culture medium. Incubate in a constant temperature culture room at 25℃ in the dark until white fuzzy shiitake mycelium grows on the surface of the millet. Starting from the 5th day, shake it once in the morning and once in the evening.

[0075] (2) Take 20 μL of Agrobacterium bacterial solution and spread it on LB plate (containing kan 50 mg / L, rif 20 mg / L), and incubate it at 28℃ for 2 days. Pick a single colony and transfer it to 1 mL of LB liquid medium (containing kan 50 mg / L, rif 20 mg / L), and shake it at 28℃ at 200 rpm / min until the bacterial solution OD reaches 0. 600 Take 500 μL of the shaken bacterial solution and transfer it to a small triangular flask containing 5 mL of LB liquid medium (containing kan 50 mg / L, rif 20 mg / L) and continue to culture until the OD 600 It is 0.5-0.6.

[0076] (3) Take 1 mL of the shaken Agrobacterium culture solution, centrifuge at 3000 rpm / min at room temperature for 1 min, resuspend the precipitate in 5 mL of induction medium (containing AS 200 μmol / L, AS is added as needed), and continue to culture until the culture OD 600 The activated Agrobacterium culture was used for transformation immediately.

[0077] (4) Take 1 g of millet-L. edodes mycelium complex and place it in a sterilized and dried small test tube. Add 1.5 mL of induction medium (without AS) and immerse the millet in the induction medium. Ultrasound at 35 kHz and 160 W for 1 min. After standing for 10 min, remove the excess supernatant.

[0078] (5) Add 1.5 mL of activated Agrobacterium culture to each tube and sonicate at 35 kHz for 2 minutes. Allow to infect for 20 minutes, then discard the supernatant and aspirate as much excess culture as possible. Pour the culture into a sterile disposable Petri dish, spread evenly, and incubate in a 25°C constant temperature incubator in the dark for 72 hours to allow the shiitake mycelium to germinate. Gently shake the tube twice daily during this period.

[0079] (6) Use sterile tweezers to pick up millet grains that have been infected and cultured for 3 days and inoculate them into the primary screening PDA plates (hyg 6 mg / L, Cef 400 mg / L), with about 25 grains per plate. Place an uninfected millet grain-Shiitake mushroom mycelium complex in the middle as a control and culture in a constant temperature culture room at 25°C in the dark for 15 days.

[0080] (7) The colonies that can grow normally on the primary screening plate were inoculated into a PDA plate (hyg 8 mg / L, Cef 400 mg / L), and the bacterial blocks of strain 4606 were inoculated on the plate as a negative control. The plates were placed in a constant temperature culture room at 25°C and cultured in the dark for 15 days.

[0081] (8) For the bacterial masses that can survive normally on the rescreening plate, a second rescreening (hyg 8 mg / L, Cef 400 mg / L) is performed. The strains that can still grow after three screenings are regarded as presumptive positive transformants, and their DNA and RNA are extracted for the next experiment.

[0082] ③PCR and real-time fluorescence quantitative PCR identification of positive transformants

[0083] Strains that remained viable after three rounds of screening were considered presumptive positive transformants and were transferred to non-resistant PDA plates covered with cellophane. 0.1 g of mycelium was scraped and total DNA was extracted using the CTAB method. Transformants were verified by PCR amplification using primers hyg1300-F: GATGTTGGCGACCTCGTATT and hyg1300-R: TCGTTATGTTTATCGGCACTTT. The corresponding recombinant vectors MAPK-OE and MAPK-RNAi served as positive controls, respectively, while 4606 wild-type and water served as negative controls. Reaction parameters included pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 56°C for 30 seconds, and extension at 72°C for 30 seconds for 30 cycles, followed by complete extension at 72°C for 5 minutes. Transformants that amplified the 517 bp target fragment were preliminarily identified as positive.

[0084] Positive transformants and strain 4606 were transferred to PDA plates. After 10 days of culture, ten uniform inocula were inoculated using a microporator into 100 mL of PDB liquid medium and incubated at 25°C in the dark for 7 days at a rotation speed of 150 rpm / min. The culture was then homogenized again and inoculated into a fresh 100 mL of PDB liquid medium at 25°C in the dark for 7 days at a rotation speed of 150 rpm / min. On the 7th day, the mycelium was harvested, the PDB liquid medium was filtered through a non-woven fabric, and the culture was rinsed with 100 mL of Watson's water (filtration must be completed quickly), dried, and then snap-frozen in liquid nitrogen.

[0085] Total RNA was extracted using the FastPure Universal Plant Total RNA Isolation Kit and reverse-transcribed into cDNA using the ABScript Neo RT Master Mix for qPCR with gDNA Remover Kit. SYBR Green fluorescence quantitative analysis was performed using the BrightCycle Universal SYBR Green qPCR Mix with UDG Kit, using cDNA as a template, Lentinus edodes actin as an internal reference gene, and the original Lentinus edodes 4606 strain as a control. Gene expression in transformants was verified using primers QMAPK1-F: CGGAACACCTACCTTGGACG and QMAPK1-R: TCTTGATTGGCAGGGAACGG. The qRT-PCR reaction system was as follows: BrightCycle Universal SYBR Green qPCR Mix with UDG 10 μL, cDNA 2 μL, QMAPK1-F / QMAPK1-R 0.4 μL each, and ddH2O to 20 μL; reaction parameters: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 5 s, annealing at 60°C for 30 s, extension at 95°C for 15 s, and 40 cycles; the melting curve temperature was set between 60°C and 95°C.

[0086] According to the quantitative results ( Figure 3 ), and finally obtained three overexpression transformants (OE-1, OE-2, OE-3) and two RNAi transformants (RNA i-R1 and RNA i-R2). The three overexpression transformants and two RNAi interference transformants were used in subsequent phenotypic experiments with the 4606 wild-type strain.

[0087] Example 2 Determination of transformant mycelial biomass

[0088] The wild-type 4606 strain, overexpression transformants, and RNAi transformants were transferred to PDA plates. After 10 days of culture, 10 uniform inoculation blocks were inoculated using a microporator into 100 mL of PDB liquid medium and incubated at 25°C in the dark for 7 days at a speed of 150 rpm / min. The cultured bacteria were then homogenized and inoculated into a new 100 mL of PDB liquid medium and incubated at 25°C in the dark for 7 days at a speed of 150 rpm / min. The growth of the three phenotypes is compared in Figure 2. Figure 4 On the 7th day, the mycelia were collected, the PDB liquid culture medium was filtered through a non-woven fabric, and the mycelia were rinsed with 100 ml of Watson's water. After absorbing the water, the mycelia were dried at 50°C to a constant weight, and the mycelial weight was measured.

[0089] It has been confirmed by experiments ( Figure 4 -B), the mycelial biomass of the three strains OE-1, OE-2, and OE-3 after overexpression of the Le-10004182 gene was significantly higher than that of the wild type, and the mycelial biomass of the two strains RNA i-R1 and RNA i-R2 after interference was significantly lower than that of the wild type, indicating that the Le-10004182 gene positively regulates the mycelial growth (biomass) of Lentinus edodes.

Claims

1. Lentinus edodes MAPK gene Le-10004182, the gene sequence of which is shown in SEQ ID NO.

1.

2. The amino acid sequence encoded by the Lentinus edodes MAPK gene Le-10004182 according to claim 1, wherein the amino acid sequence is shown as SEQ ID NO.

2.

3. Use of the Lentinus edodes MAPK gene Le-10004182 according to claim 1 in regulating mycelial growth, comprising the following steps: Extract RNA from Lentinus edodes mycelium, reverse transcribe to obtain cDNA, amplify the cDNA sequence of Le-10004182 gene, construct the gene Le-10004182 overexpression vector or interference vector, and transfer it into Lentinus edodes mycelium through Agrobacterium-mediated genetic transformation.

4. The use of the Lentinus edodes MAPK gene Le-10004182 in regulating mycelial growth according to claim 3, specifically comprising the following steps: (1) Gene cloning Extract RNA from Lentinus edodes mycelium and reverse transcribe to obtain cDNA; design gene cDNA primers: MAPK-F: ATGTCTCGCAAAGCTCCCTC and MAPK-R: CTAGGATGCGGCTGTCTTGA; use cDNA of Lentinus edodes cultivated strain as template to amplify the cDNA sequence of Le-10004182 gene of SEQ ID NO.1; (2) Construction of overexpression vector or interference vector The overexpression vector was constructed by using the amplified Le-10004182 gene cDNA sequence as a template and removing the stop codon to obtain the overexpression fragment SEQ ID NO.3; the primer MAPK-egfp-BF with the vector homology arm was designed: CTCTTCATCCCCCTCTCAACATGTCTCGCAAAGCTCCCTC and MAPK-egfp-BR: GATGCAGGACTCACGGGCATGGATGCGGCTGTCTTGAGAG, amplify and obtain the linear target fragment of the overexpressed Le-10004182 gene with homology arms; use the vector GPIE-OE as the vector backbone, use Bam HI for single enzyme digestion, and recover the linear vector on gel; homologous recombination is performed between the linear target fragment and the linearized vector by the one-step cloning method, and the cells are transformed into Escherichia coli competent cells DH5α, and the positive clones are sequenced and tested using the primers MAPK-egfp-yzF: CCTCTCAACATGTCTCGCAAAGCTC and MAPK-egfp-yzR: GCCAAACGATGAGGTGAATACGGT; the vector plasmid of the positive clone is extracted, which is the recombinant overexpression vector MAPK-OE; The interference vector, i.e., the RNAi vector, was constructed as follows: the amplified Le-10004182 gene cDNA sequence was used as a template, and primers MAPK-BcuI-F with restriction enzyme cutting sites: GCaCTAGTATGCAAACTGATCTCCACCG and MAPK-MluI-RATacgcgTGTCATGGTAAGCAGCGACAT were designed to amplify the interference fragment of SEQ ID NO. 4; the bidirectional interference vector GPIE-DpV was used as the vector backbone, and the vector and the target fragment were double-digested with Bcu I and Mlu I, respectively. The target fragment with sticky ends obtained by gel recovery was ligated with the linearized vector using T4 ligase, and the recombinant vector was transformed into Escherichia coli competent cells DH5α, and the primers MAPK-RNAi-yzF: AGTTGTGTTTTTCGTCCGCATCTTTTCCT and MAPK-RNAi-yzR: AAGGAAGTTCATTTCATTTGGAGAGGACA were sequenced for positive clone detection; the vector plasmid of the positive clone was extracted, which was the recombinant interference vector MAPK-RNAi; (3) Genetic transformation and phenotypic analysis of Lentinus edodes The shiitake mushroom strain was transformed by Agrobacterium-mediated genetic transformation, and stable overexpression transformants or RNAi-interfering positive transformants were obtained by hygromycin screening. The positive transformants were identified by PCR and real-time fluorescence quantitative PCR, and the desired overexpression transformants and RNAi transformants were finally obtained.

5. Use of the Lentinus edodes MAPK gene Le-10004182 according to claim 1 in increasing mycelial biomass, comprising the following steps: RNA was extracted from Lentinus edodes mycelium and reverse transcribed to obtain cDNA. The cDNA sequence of Le-10004182 gene without the stop codon was amplified, and an overexpression vector of gene Le-10004182 was constructed. The vector was then transferred into Lentinus edodes mycelium through Agrobacterium-mediated genetic transformation.

6. Use of the Lentinus edodes MAPK gene Le-10004182 according to claim 5 in increasing Lentinus edodes mycelial biomass, comprising the following steps: (1) RNA was extracted from Lentinus edodes mycelium, reverse transcribed to obtain cDNA, and the cDNA sequence of the Le-10004182 gene was amplified; gene cDNA primers were designed: MAPK-F: ATGTCTCGCAAAGCTCCCTC and MAPK-R: CTAGGATGCGGCTGTCTTGA; Using the cDNA of a cultivated Lentinus edodes strain as a template, the cDNA sequence of the Le-10004182 gene as SEQ ID NO.1 was amplified; (2) Construction of overexpression vector Using the amplified Le-10004182 gene cDNA sequence as a template, the stop codon was removed to obtain the overexpression fragment SEQ ID NO.3; primers MAPK-egfp-BF with vector homology arms were designed: CTCTTCATCCCCCTCTCAACATGTCTCGCAAAGCTCCCTC and MAPK-egfp-BR: GATGCAGGACTCACGGGCATGGATGCGGCTGTCTTGAGAG, amplify and obtain the linear target fragment of the overexpressed Le-10004182 gene with homology arms; use the vector GPIE-OE as the vector backbone, use Bam HI for single enzyme digestion, and recover the linear vector on gel; homologous recombination is carried out between the linear target fragment and the linearized vector by one-step cloning method, and the cells are transformed into Escherichia coli competent cells DH5α, and the positive clones are sequenced and tested using primers MAPK-egfp-yzF: CCTCTCAACATGTCTCGCAAAGCTC and MAPK-egfp-yzR: GCCAAACGATGAGGTGAATACGGT; the vector plasmid of the positive clone is extracted, which is the recombinant overexpression vector MAPK-OE; (3) Genetic transformation and phenotypic analysis of Lentinus edodes The shiitake mushroom strain was transformed using Agrobacterium-mediated genetic transformation, and stable overexpression transformants were obtained by hygromycin screening. Positive transformants were identified by PCR and real-time fluorescence quantitative PCR, and the desired overexpression transformants were finally obtained.

7. The recombinant overexpression vector MAPK-OE or the recombinant interference vector MAPK-RNAi prepared in the use according to claim 3 or 4.

8. The genetically engineered strain with overexpression of the Le-10004182 gene and the genetically engineered strain with interference of the Le-10004182 gene prepared in the application according to claim 3 or 4.

9. A method for increasing the biomass of Lentinus edodes mycelium, the method comprising the following steps: RNA was extracted from Lentinus edodes mycelium and reverse transcribed to obtain cDNA. The cDNA sequence of Le-10004182 gene without the stop codon was amplified, and an overexpression vector of gene Le-10004182 was constructed. The vector was then transferred into Lentinus edodes mycelium through Agrobacterium-mediated genetic transformation.

10. The method for increasing the biomass of Lentinus edodes mycelium according to claim 9, comprising the following steps: (1) RNA was extracted from Lentinus edodes mycelium, reverse transcribed to obtain cDNA, and the cDNA sequence of the Le-10004182 gene was amplified; gene cDNA primers were designed: MAPK-F: ATGTCTCGCAAAGCTCCCTC and MAPK-R: CTAGGATGCGGCTGTCTTGA; Using the cDNA of a cultivated Lentinus edodes strain as a template, the cDNA sequence of the Le-10004182 gene as SEQ ID NO.1 was amplified; (2) Construction of overexpression vector Using the amplified Le-10004182 gene cDNA sequence as a template, the stop codon was removed to obtain the overexpression fragment SEQ ID NO.3; primers MAPK-egfp-BF with vector homology arms were designed: CTCTTCATCCCCCTCTCAACATGTCTCGCAAAGCTCCCTC and MAPK-egfp-BR: GATGCAGGACTCACGGGCATGGATGCGGCTGTCTTGAGAG, amplify and obtain the linear target fragment of the overexpressed Le-10004182 gene with homology arms; use the vector GPIE-OE as the vector backbone, use Bam HI for single enzyme digestion, and recover the linear vector on gel; homologous recombination is carried out between the linear target fragment and the linearized vector by one-step cloning method, and the cells are transformed into Escherichia coli competent cells DH5α, and the positive clones are sequenced and tested using primers MAPK-egfp-yzF: CCTCTCAACATGTCTCGCAAAGCTC and MAPK-egfp-yzR: GCCAAACGATGAGGTGAATACGGT; the vector plasmid of the positive clone is extracted, which is the recombinant overexpression vector MAPK-OE; (3) Genetic transformation and phenotypic analysis of Lentinus edodes The shiitake mushroom strain was transformed using Agrobacterium-mediated genetic transformation, and stable overexpression transformants were obtained by hygromycin screening. Positive transformants were identified by PCR and real-time fluorescence quantitative PCR, and the desired overexpression transformants were finally obtained.