Method for constructing pepper plant mutant through visual marker gene editing

By applying CRISPR/Cas9 technology and the RUBY reporter gene system in chili, combined with the regeneration factor REF1, the problems of difficulty in observing and low regeneration ability of chili peppers are solved, and efficient genetic transformation and regeneration are achieved.

CN120485243APending Publication Date: 2025-08-15HUNAN AGRI UNIV
View PDF 9 Cites 0 Cited by

Patent Information

Application Number
CN202510514978.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-23
Publication Date
2025-08-15

AI Technical Summary

Technical Problem

Observation of pepper gene editing technology is difficult, and the traditional reporting system is not suitable for large-scale samples under conventional natural environments. The plant's in vitro regeneration ability shows high resilience and genotype specificity, resulting in low genetic transformation efficiency.

Method used

The CaHEC3 gene target was designed using CRISPR/Cas9 technology, combined with the RUBY reporter gene and the regeneration factor REF1, and genetic transformation of pepper was achieved by visually screening marks and optimizing the regeneration medium.

Benefits of technology

It improves the efficiency and stability of genetic transformation of peppers, reduces the cost of positive explant identification, improves the efficiency of regeneration bud generation, and establishes a stable and effective pepper regeneration system.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485243A_ABST
    Figure CN120485243A_ABST
Patent Text Reader

Abstract

The invention provides a method for constructing a pepper plant mutant by visual marker gene editing, the gene editing adopts a CRISPR / Cas9 technology, two gene targets designed on a CaHEC3 gene are involved, and the nucleotide sequence of the CaHEC3 gene is shown as SEQ ID No: 1; wherein the nucleotide sequence of the target spot I is as shown in SEQ ID No: 2; 2 ', 5'-GAACCAACCATGTCCAATA-3 ', 5'- The nucleotide sequence of the target spot II is as shown in SEQ ID No: 3; according to the present invention, the visual selection marker RUBY reporter gene and the signal molecule REF1 for inducing the plant regeneration are jointly applied to the pepper genetic transformation experiment, the visual RUBY label can substantially reduce the cost and the efficiency of the positive explant identification, and the regeneration factor improves the generation efficiency of the regenerated bud of the explant on the other hand.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic transformation, and in particular relates to a method for constructing pepper plant mutants through visual marker gene editing. Background Art

[0002] Pepper (Chili pepper) is an important economic crop, occupying a crucial position in the global agricultural and food industries. Chili pepper is not only a core element of the culinary culture of many regions but also possesses significant health and medical value (Antonio et al., 2018; Baenas et al., 2019; Fayos et al., 2019). Therefore, improving pepper yield and quality not only meets market demand but also promotes economic development and advances in medical technology. However, several biotic and abiotic stresses severely impact pepper yield and quality. Currently, pepper breeding faces a shortage of disease-resistant, high-yielding, and high-quality varieties. Conventional breeding, with its long timescales and low efficiency, severely hinders the development of superior pepper varieties. Molecular breeding is currently one of the most efficient approaches for genetically improving pepper germplasm, and transgenic engineering is also a necessary and routine procedure for functional genomic validation. Improving plants with superior genes for high yield, quality, and stress tolerance is an important approach for efficiently obtaining high-quality, multi-resistant, high-yielding, and high-efficiency plant varieties suitable for labor-saving production (Yuan Jingping, 2025).

[0003] Plant genetic transformation technology holds significant importance in agricultural production, biotechnology, and basic research. However, the efficiency of pepper (Capsicum annuum) genetic transformation is low, primarily due to the high recalcitrance and genotype-specificity of plant regeneration in vitro, particularly the production of numerous leaf structures (rather than buds) or failure of bud elongation (Ashwani et al., 2017; Venkataiah and Subhash, 2001). Since Gunay and Rao published the first study on pepper plant regeneration in 1978, subsequent experiments have demonstrated difficulties in pepper regeneration in vitro, including the recalcitrance of natural morphogenesis, rosette bud formation, ethylene sensitivity, and genotypic variability (García-Fortea, 2021). A recent study suggests that viral delivery systems can overcome the bottleneck of pepper gene editing technology, but technical stability and long experimental cycles remain unresolved (Chenglu Zhao et al., 2024). Therefore, to address the challenges of genotype dependence, regeneration difficulties, and low efficiency in pepper genetic transformation, a stable and reliable transgenic system is urgently needed.

[0004] In recent years, various genetic transformation reporter systems have been developed to monitor gene expression, protein localization and stability, hormone signaling, and the effects of environmental signals. Green fluorescent protein (GFP) and its derivatives (such as RFP, mCherry, and YFP) have been widely used in many fields as gene expression reporter genes or fusion proteins (A et al., 1987; Chalfie et al., 1994). Traditional reporter systems have limitations. They can usually only be observed under a microscope and are not suitable for observing large samples under normal natural conditions. In addition, plants can produce a variety of colored compounds, and their potential as reporter systems is worthy of research and development. The RUBY reporter system, for example, involves introducing exogenous betalain synthase into plants, which converts endogenous tyrosine into betalain, resulting in a bright red color in tissues (He et al., 2020). The RUBY reporter system has been successfully applied in species such as Arabidopsis, tobacco, and tomato (Wang et al., 2023). Therefore, the development of a RUBY-based visible marker system could accelerate the screening and identification of gene-edited materials in pepper.

[0005] In addition to screening reporter systems, the rational use of regeneration factors during plant tissue culture can also significantly improve the efficiency of gene editing. Plant regeneration factors refer to key regulatory factors (such as plant hormones, transcription factors, and signaling molecules) that promote cell division, differentiation, and organ formation during plant tissue culture and regeneration. Recently, Li Chuanyou's team identified for the first time the primary wound-inducing signaling molecule, REF1 (REGENERATION FACTOR1), which triggers plant regeneration. This discovery demonstrates the enormous application value of REF1 in plant transgenics and gene editing (Yang et al., 2024). Therefore, exploring whether the RUBY visual screening system and REF1 in pepper can effectively improve the efficiency of genetic transformation is of great significance, potentially leading to the development of a new method for efficient genetic transformation in pepper. Summary of the Invention

[0006] The technical problem to be solved by the present invention is the difficulty in observing pepper gene editing technology. It overcomes the deficiencies and defects mentioned in the above background technology and provides a method for constructing pepper plant mutants through visual marker gene editing.

[0007] In order to solve the above technical problems, the technical solution proposed by the present invention is: A method for constructing pepper plant mutants by visual marker gene editing, wherein the gene editing uses CRISPR / Cas9 technology and includes two gene target sites designed on the CaHEC3 gene, the nucleotide sequence of which is shown in SEQ ID No. 1; Wherein, the nucleotide sequence of target one is shown as SEQ ID No. 2; 5′-GAACCAACCATGTCCAATA-3′; The nucleotide sequence of target 2 is shown in SEQ ID No. 3; 5′-GAGGAGCTAGGAGCTATGA-3′. Preferably, the PCR amplification primers for target one include: SEQ ID No: 4: CaHEC3-DT1-BsF: 5'-ATATATGGTCTCGATTGGAACCAACCATGTCCAATAGTT-3' SEQ ID No: 5: CaHEC3-DT1-F0: 5'-TGGAACCAACCATGTCCAATAGTTTTAGAGCTAGAAATAGC-3' SEQ ID No: 6CaHEC3-DT2-R0: 5'-AACTCATAGCTCCTAGTCCCTCCAATCTCTTAGTCGACTCTAC-3' SEQ ID No: 7: CaHEC3-DT2-BsR: 5'-ATTATTGGTCTCGAAACTCATAGCTCCTAGCTCCTCCAA-3'.

[0008] Preferably, the method specifically comprises the following steps: (1) Selection of CaHEC3 gene targets: Select target sequences with a length of 19 bp on the CaHEC3 gene sequence, and select target 1 and target 2; (2) CaHEC3-CRISPR / Cas vector primer design: Using pCBC-DT1T2 as a template, design CaHEC3-CRISPR / Cas vector primers; (3) Construction of expression vector: Using pCBC-DT1T2 as a template, four primers of SEQ ID No: 4-7 were used for PCR amplification and purification to obtain the gRNA fragment, and the CaHEC3-CRISPR / Cas vector plasmid was connected with the gRNA fragment. The CaHEC3-CRISPR / Cas expression vector was obtained by transformation, screening, and verification; (4) Recombinant plasmid transformation: The CaHEC3-CRISPR / Cas expression vector was transformed into Escherichia coli competent cells and introduced into Agrobacterium competent cells to obtain CaHEC3-CRISPR / Cas Agrobacterium. Pepper explants were infected with CaHEC3-CRISPR / Cas Agrobacterium and cultured to obtain transgenic pepper plants.

[0009] Preferably, during the four-primer PCR amplification in step (3), the primer concentrations of SEQ ID Nos: 4 and 7 are 8-12 uM; the concentrations of SEQ ID Nos: 5 and 6 are 18-22 times the primer concentrations of SEQ ID Nos: 4 and 7. The long fragment containing the editing site is first amplified by the high-concentration outer primers (-BsF / -BsR), and the diluted inner primers (-F0 / -R0) bind to the long fragment in subsequent cycles to complete fragment splicing.

[0010] Preferably, the CaHEC3-CRISPR / Cas vector plasmid in step (3) is PKSE402-Ruby.

[0011] Preferably, the CaHEC3-CRISPR / Cas vector plasmid and the gRNA fragment ligation system described in step (3) is: CaHEC3-CRISPR / Cas vector plasmid 1 μL, gRNA fragment 2 μL, 10×NEB T4 buffer 1.5 μL, 10×BSA 1.5 μL, BsaI (NEB) 1 μL, T4 Ligase (NEB) 1 μL, ddH2O 6 μL, total 15 μL; reaction conditions are: 37°C 5h; 50°C 5min, 80°C 10min.

[0012] Preferably, the verification in step (3) specifically includes: transforming the ligated plasmid into a competent cell of the large intestine, performing colony PCR identification using U626-F and U629-R, and further sequencing single clones with correct bands using U626-F and U629-F; SEQ ID No: 8: U626-F: TGTCCCAGGATTAGAATGATTAGGC SEQ ID No: 9: U629-F: TTAATCCAAACTACTGCAGCCTGAC SEQ ID No: 10: U629-R: AGCCCTCTTTCTTTCGATCCATCAAC.

[0013] Preferably, during the culture in step (4), pepper explants with red buds are screened and cultured. During the RUBY reporter gene screening, the visible component is controlled to be red, and red represents the positive vector component ruby.

[0014] Preferably, the culture in step (4) includes three steps: screening culture, bud-strengthening culture and rooting culture. The screening culture stage uses a screening medium, the bud-strengthening culture stage uses a bud-strengthening culture medium, and the rooting culture stage uses a rooting culture medium. 100ul / L of REF1 is added to the bud-strengthening culture medium and the rooting culture medium.

[0015] In this application, we searched for the homologous gene REF1 (NAD-dependent protein deacetylase HST1) in pepper and synthesized small peptides at Beijing Zhongke Yaguang Biotechnology Co., Ltd. These peptides were then added to screening and differentiation culture media as an important regenerative component.

[0016] Preferably, the screening medium comprises: MS 4.4 g / L + sucrose 30 g / L + agar 7 g / L + 6BA 5 mg / L + AgNO 3 5 mg / L + ZT 2.0 mg / L + IAA 1.2 mg / L + REF1 100 ul / L + Timentin 300 mg / L + Kan 50 mg / L, pH 5.7-5.8; The bud-strengthening culture medium comprises: MS 4.4 g / L + sucrose 30 g / L + agar 7 g / L + 6BA 10 mg / L + AgNO35 mg / L + GA3 3 mg / L + ZT 2.0 mg / L + IAA 0.5 mg / L + REF1 100 ul / L + Timentin 300 mg / L + Kan 50 mg / L, pH 5.7-5.8; The rooting medium comprises: MS 2.2 g / L + sucrose 30 g / L + agar 7 g / L + 6BA 10 mg / L + AgNO35 mg / L + GA3 3 mg / L + ZT 2.0 mg / L + IAA 0.5 mg / L + REF1 100 ul / L + Timentin 300 mg / L + Kan 50 mg / L, pH 5.7-5.8.

[0017] Compared with the prior art, the present invention has the following beneficial effects: This study combines the visual selection marker RUBY reporter gene and the plant regeneration-inducing signal molecule REF1 (ATGRRRGRPPSRPGVGRGPPPENN) in pepper genetic transformation experiments. The RUBY expression cassette used in this experiment was cloned and amplified from the vector 35S:RUBY. The visual RUBY tag significantly reduces the cost and efficiency of positive explant identification, while the regeneration factor improves the efficiency of explant regeneration buds. This provides a stable and effective pepper regeneration system. Optimizing both the vector and the regeneration factor overcomes the bottlenecks of high intractability and genotype-specificity in in vitro plant regeneration, making it highly valuable for pepper genetic transformation. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0019] Figure 1 Schematic diagram of the visualized gene editing vector PKSE402-Ruby in Example 1 Figure 2 Schematic diagram of genetic transformation in Example 2 Figure 3 PCR results of target site agarose gel electrophoresis detection of wild type WT and edited plants in Example 2 Figure 4 The results of the Sanger sequencing chromatogram comparison of target site 1 of the wild-type WT, Cahec3#1 and Cahec3#2 edited plants in Example 3 are shown.

[0020] Figure 5 The genotypes of the wild type WT, Cahec3#1 and Cahec3#2 mutants in Example 3 are shown. DETAILED DESCRIPTION

[0021] To facilitate understanding of the present invention, the present invention will be described in more comprehensive and detailed form below in conjunction with the accompanying drawings and preferred embodiments. However, the protection scope of the present invention is not limited to the following specific embodiments.

[0022] Unless otherwise defined, all technical terms used hereinafter have the same meanings as those generally understood by those skilled in the art. The technical terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.

[0023] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0024] Example 1: Construction of CRISPR / Cas9 vector for CaHEC3 gene 1.1. Selection of CaHEC3 gene targets CaHEC3 is a single exon, and its sequence was uploaded to the website ( http: / / www.rgenome.net / cas- designer / ) Select the target sequence with a length of 19bp.

[0025] Target one is: 5'-GAACCAACCATGTCCAATA-3' (the reverse complementary sequence is: 5'-TATTGGACATGGTTGGTTC-3').

[0026] Target 2 is: 5'-GAGGAGCTAGGAGCTATGA-3' (the reverse complementary sequence is: 5'-TCATAGCTCCTAGCTCCTC-3').

[0027] 1.2. CaHEC3-CRISPR / Cas vector primer design and product amplification PCR amplification: Four-primer PCR amplification was performed using pCBC-DT1T2 as the template. CaHEC3-DT1-BsF / -BsR were normal primer concentrations; CaHEC3-DT1-F0 / -R0 were diluted 20-fold.

[0028] CaHEC3-DT1-BsF: 5'-ATATATGGTCTCGATTGGAACCAACCATGTCCAATA GTT-3' CaHEC3-DT1-F0: 5'-TGGAACCAACCATGTCCAATA GTTTTAGAGCTAGAAATAGC-3' CaHEC3-DT2-R0: 5'-AACTCATAGCTCCTAGTCCCTCCAATCTCTTAGTCGACTCTAC-3' CaHEC3-DT2-BsR: 5'-ATTATTGGTCTCGAAACTCATAGCTCCTAGCTCCTCCAA-3' 1.3. Gene Editing Vector Enzyme Digestion CaHEC3-CRISPR / Cas Ligation Using the amplified product obtained in the previous step as a template, the vector was constructed according to the following components and PCR reaction procedures.

[0029] Table 1. Gene editing vector enzyme digestion-ligation system

[0030] The PKSE402 vector was kindly provided by Professor Huang Sanwen of the Chinese Academy of Agricultural Sciences (Hu et al., 2017. Engineering Non-transgenic Gynoecious Cucumber Using an Improved Transformation Protocol and Optimized CRISPR / Cas9 System. Mol Plant 10: 1575-1578). The pCBC-DT1T2 template plasmid was kindly provided by Professor Chen Qijun of China Agricultural University (Xing et al., 2014. ACRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol 14: 327). This application introduces the visualization tag RUBY based on the PKSE402 vector. Figure 1 ).

[0031] Step 1.4: Transformation of recombinant plasmid into DH5α competent cells and sequencing The recombinant plasmid, after restriction digestion and ligation, was transformed into a competent DH5α cell culture medium (Tsingke). The bacterial suspension was evenly plated on plates containing 50 mg / L kanamycin. Colony identification was performed using U626-F and U629-R. Single clones with the correct bands were further sequenced using U626-F and U629-F.

[0032] U626-F: TGTCCCAGGATTAGAATGATTAGGC U629-F: TTAATCCAAACTACTGCAGCCTGAC U629-R: AGCCCTCTTTCTTTCGATCCATCAAC Example 2: Genetic transformation of CaHEC3 gene 2.1. Transformation of recombinant vector into K599 Agrobacterium rhizogenes competent cells Thaw K599 competent Agrobacterium rhizogenes (Weidi Biotech K599 Chemically Competent Cell) stored at -80°C on ice. Add 200 ng of the above recombinant plasmid DNA to 100 μl of competent culture. Gently pipette and mix thoroughly. Place on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and finally in an ice bath for 5 minutes. Then, add 500 μl of TY medium and incubate at 28°C at 200 rpm for 2 hours. Spread 200 μl of the culture onto TY plates containing antibiotics (50 mg / L Kan and 100 mg / L SM). After 48 hours, identify colonies and store positive cultures at -80°C.

[0033] 2.2 Preparation of sterile pepper explants ( Figure 2 ) 2.2.1 Sowing: Take mature pepper varieties 1-51 seeds, place them in a 10ml centrifuge tube, and soak them at room temperature for 2 hours. Disinfect with 75% alcohol for 1 minute, rinse with sterile water for 3 times, and then add 20% sodium hypochlorite solution to continue disinfection. After 15 minutes, rinse again with sterile water for 4 times. Place the treated seeds on sterilized filter paper to dry, and then sow them evenly. The seeds were cultured on MS medium (MS 2.2 g / L + sucrose 30 g / L + agar 7 g / L, pH 5.7-5.8) in the dark at 23°C until they germinated, and then cultured at 24°C under a 12-h photoperiod until the two cotyledons of the pepper were flattened.

[0034] 2.2.2 Explant preparation: Sterile pepper seedlings were removed, and after removing the growing point, the cotyledons and hypocotyls were cut into sections of approximately 0.5 cm. The sections were placed in pepper pre-culture medium (MS 2.2 g / L + sucrose 30 g / L + agar 7 g / L + 6-BA 3 mg / L + IAA 0.5 mg / L, pH 5.7-5.8) and cultured in the dark at 23°C for 24 h.

[0035] 2.3 Activate the bacterial suspension: 2 days in advance, streak the bacterial suspension stored at -80°C onto plates containing SM solid medium (50 mg / L kan, 100 mg / L SM). Incubate the plates upside down at 28°C. Before infection, use a sterile pipette to pick activated colonies and transfer them to TY liquid medium (50 mg / L kan, 100 mg / L SM). Shake at 28°C, 200 rpm, until the OD value reaches 1.0.

[0036] 2.4 Infection: Centrifuge the above bacterial solution at 5000 rpm for 5 minutes to collect the cells. Resuspend the cells in infection solution (MS 4.4 g / L, sucrose 30 g / L, AS 200 μM, MES 1.25 mM, ZT 2.0 mg / L, IAA 0.1 mg / L, pH 5.7-5.8) and adjust the OD value to 0.1-0.2. Place the dark-cultured pepper explants in the resuspended bacterial solution and vortex for 1 minute. The explants were then placed on sterilized filter paper to absorb the bacterial suspension. The explants were then transferred to a co-culture medium (MS 4.4 g / L, sucrose 30 g / L, agar 7 g / L, AS 200 μM, MES 1.25 mM, ZT 2.0 mg / L, IAA 0.1 mg / L, pH 5.7–5.8) covered with sterilized filter paper. The co-culture was incubated at 23°C in the dark for 48 h.

[0037] 2.5 Screening Culture: Transfer the co-cultivated explants to screening medium (MS 4.4 g / L, sucrose 30 g / L, agar 7 g / L, 6BA 5 mg / L, AgNO 35 mg / L, ZT 2.0 mg / L, IAA 1.2 mg / L, REF1 100 μl / L, Timentin 300 mg / L, Kan 50 mg / L, pH 5.7–5.8) plates and culture at 23 ± 2°C for 2 weeks with a light intensity of 12 h / d and 2500 lx.

[0038] 2.6 Bud culture: The pepper explants with red buds after screening with screening medium were transferred to bud culture medium (MS 4.4 g / L + sucrose 30 g / L + agar 7 g / L + 6BA 10 mg / L + AgNO35 mg / L + GA3 3 mg / L + ZT2.0 mg / L + IAA 0.5 mg / L + REF1 100 ul / L + Timentin 300 mg / L + Kan 50 mg / L, pH 5.7-5.8) and cultured at 25°C with 16 h light / 8 h photoperiod for 20 days.

[0039] 2.7 Rooting Culture: After bud growth, trim any visible red buds and those containing red leaves and transfer them to rooting medium (MS 2.2 g / L + sucrose 30 g / L + agar 7 g / L + 6BA 10 mg / L + AgNO₃ 5 mg / L + GA₃ 3 mg / L + ZT 2.0 mg / L + IAA 0.5 mg / L + REF1 100 μl / L + Timentin 300 mg / L + Kan 50 mg / L, pH 5.7-5.8) at 23 ± 2°C with a photoperiod of 12 h / d and a light intensity of 2500 lx.

[0040] Example 3: Obtaining pepper plants edited with gene CaHEC3 The CaHEC3 gene was PCR amplified using the primers CaHEC3-F and CaHEC3-R in Example 4. The resulting products were subjected to gel electrophoresis. The PCR amplified gel products of different individual strains were then subjected to Sanger sequencing. The sequence of the CaHEC3 gene obtained by the sequencing company was aligned with the wild-type (WT) CaHEC3 gene, and the genotype of the obtained gene-edited plants was then identified ( Figure 3 , 4, 5). The results showed that the verified plants had a +1bp insertion and a -1bp deletion, respectively. Analysis revealed an overall editing efficiency of 100%. Furthermore, the average regeneration efficiency in the culture medium supplemented with the CaREF1 peptide increased from 0.41 to 0.84 compared to the culture medium without the peptide.

[0041] CaHEC3 gene editing detection primer sequences: SEQ ID No: 11: HEC3-JC-F: ATGGATATCAACCACATTAACCTC SEQ ID No: 12: HEC3-JC-R:TCTAGCATGGAAGCAGTGT.

Claims

1. A method for constructing pepper plant mutants by visual marker gene editing, characterized in that: The gene editing uses CRISPR / Cas9 technology, including two gene target sites designed on the CaHEC3 gene, the nucleotide sequence of which is shown in SEQ ID No: 1; The nucleotide sequence of target one is shown in SEQ ID No: 2: 5′-GAACCAACCATGTCCAATA-3′; The nucleotide sequence of target 2 is shown in SEQ ID No: 3: 5′-GAGGAGCTAGGAGCTATGA-3′.

2. The method according to claim 1, wherein The PCR amplification primers for target one include: SEQ ID No: 4: CaHEC3-DT1-BsF: 5'-ATATATGGTCTCGATTGGAACCAACCATGTCCAATAGTT-3' SEQ ID No: 5: CaHEC3-DT1-F0: 5'-TGGAACCAACCATGTCCAATA GTTTTAGAGCTAGAAATAGC-3' SEQ ID No: 6: CaHEC3-DT2-R0: 5'-AACTCATAGCTCCTAGTCCCTCCAATCTCTTAGTCGACTCTAC-3' SEQ ID No: 7: CaHEC3-DT2-BsR: 5'-ATTATTGGTCTCGAAACTCATAGCTCCTAGCTCCTCCAA-3'.

3. The method according to claim 2, wherein The method specifically comprises the following steps: (1) Selection of CaHEC3 gene targets: Select target sequences with a length of 19 bp on the CaHEC3 gene sequence, and select target 1 and target 2; (2) CaHEC3-CRISPR / Cas vector primer design: Using pCBC-DT1T2 as a template, design CaHEC3-CRISPR / Cas vector primers; (3) Construction of expression vector: Using pCBC-DT1T2 as a template, four primers of SEQ ID No: 4-7 were used for PCR amplification and purification to obtain the gRNA fragment, and the CaHEC3-CRISPR / Cas vector plasmid was connected with the gRNA fragment. The CaHEC3-CRISPR / Cas expression vector was obtained by transformation, screening, and verification; (4) Recombinant plasmid transformation: The CaHEC3-CRISPR / Cas expression vector was transformed into Escherichia coli competent cells and introduced into Agrobacterium competent cells to obtain CaHEC3-CRISPR / Cas Agrobacterium. Pepper explants were infected with CaHEC3-CRISPR / Cas Agrobacterium and cultured to obtain transgenic pepper plants.

4. The method according to claim 3, wherein During the four-primer PCR amplification in step (3), the primer concentrations of SEQ ID Nos: 4 and 7 are 8-12 uM; the concentrations of SEQ ID Nos: 5 and 6 are 18-22 times the primer concentrations of SEQ ID Nos: 4 and 7.

5. The method according to claim 3, wherein The CaHEC3-CRISPR / Cas vector plasmid described in step (3) is PKSE402-Ruby.

6. The method according to claim 5, wherein The CaHEC3-CRISPR / Cas vector plasmid and the gRNA fragment ligation system described in step (3) is: CaHEC3-CRISPR / Cas vector plasmid 1 μL, gRNA fragment 2 μL, 10×NEBT4 buffer 1.5 μL, 10×BSA 1.5 μL, BsaI (NEB) 1 μL, T4 Ligase (NEB) 1 μL, ddH2O 6 μL, Total 15 μL; reaction conditions are: 37°C 5h; 50°C 5min, 80°C 10min.

7. The method according to claim 5, wherein The verification described in step (3) specifically includes: transforming the ligated plasmid into the competent cell of large intestine, performing colony PCR identification using vector primers U626-F and U629-R, and further sequencing the single clone with the correct band using U626-F and U629-F; SEQ ID No: 8: U626-F: TGTCCCAGGATTAGAATGATTAGGC SEQ ID No: 9: U629-F: TTAATCCAAACTACTGCAGCCTGAC SEQ ID No: 10: U629-R: AGCCCTCTTTCTTTCGATCCATCAAC.

8. The method according to claim 3, wherein During the culturing described in step (4), pepper explants with red buds are screened and cultured.

9. The method according to claim 8, wherein The culture in step (4) includes three steps: screening culture, bud-strengthening culture and rooting culture. The screening culture stage uses a screening medium, the bud-strengthening culture stage uses a bud-strengthening culture medium, and the rooting culture stage uses a rooting culture medium. REF1 80-120ul / L is added to the bud-strengthening culture medium and the rooting culture medium.

10. The method according to claim 9, wherein The screening medium comprises: MS 4.4 g / L + sucrose 30 g / L + agar 7 g / L + 6BA 5 mg / L + AgNO3 5 mg / L + ZT 2.0 mg / L + IAA 1.2 mg / L + REF1 100 ul / L + Timentin 300 mg / L + Kan 50 mg / L, pH 5.7-5.8; The bud-strengthening culture medium comprises: MS 4.4 g / L + sucrose 30 g / L + agar 7 g / L + 6BA 10 mg / L + AgNO35 mg / L + GA3 3 mg / L + ZT 2.0 mg / L + IAA 0.5 mg / L + REF1 100 ul / L + Timentin 300 mg / L + Kan 50 mg / L, pH 5.7-5.8; The rooting medium comprises: MS 2.2 g / L + sucrose 30 g / L + agar 7 g / L + 6BA 10 mg / L + AgNO35 mg / L + GA3 3 mg / L + ZT 2.0 mg / L + IAA 0.5 mg / L + REF1 100 ul / L + Timentin 300 mg / L + Kan 50 mg / L, pH 5.7-5.8.

Citation Information

Patent Citations

  • Nondestructive screening system for naked eye visible plant genetic transformation under visible light, construction method and application thereof

    CN112063649A

  • Pepper yield regulation gene LOC107867680 as well as encoding protein, expression vector and application thereof

    CN116574739A

  • Sesame seed shattering character regulation gene Sihec3 and application thereof

    CN117004617A

  • Gene editing vector for increasing proportion of regenerated red seedlings and proportion of gene editing plants as well as construction method and application of gene editing vector

    CN117925686A

  • Pepper in-vitro regeneration method, induction medium composition and application thereof

    CN118680069A