Application of gene GmPMEI156 in improving plant tolerance to low phosphorus stress

By introducing the GmPMEI156 gene into plants, the problem of phosphorus absorption difficulties in soybeans in acidic soils was solved, and the tolerance and yield of soybeans in low phosphorus environments were improved.

CN120485246BActive Publication Date: 2025-11-21SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510605234.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-12
Publication Date
2025-11-21
Estimated Expiration
2045-05-12

AI Technical Summary

Technical Problem

The acidic soil in South China makes it difficult for soybeans to absorb phosphorus nutrients, resulting in low yields and economic benefits. Existing technologies are insufficient to effectively improve the tolerance of soybeans to low-phosphorus environments.

Method used

The ability of plants to tolerate low phosphorus stress can be improved by introducing the gene GmPMEI156 into plants. The specific steps include cloning the GmPMEI156 gene, overexpressing or introducing it into recipient plants, and increasing root length, fresh weight and the number of lateral roots.

Benefits of technology

It significantly enhances the plant's tolerance to low phosphorus environments, increases root length, fresh weight, and the number of lateral roots, promotes efficient phosphorus absorption and utilization, and improves soybean yield and economic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120485246B_ABST
    Figure CN120485246B_ABST
Patent Text Reader

Abstract

The application relates to the technical field of genetic engineering, and discloses a cloning method of a soybean gene GmPMEI156 and application of the soybean gene GmPMEI156 in low-phosphorus tolerance regulation, and belongs to the technical field of genetic engineering. The soybean GmPMEI156 gene is cloned and analyzed, and heterologous transformation of Arabidopsis is carried out to verify the low-phosphorus tolerance of the gene, and the result shows that the expression amount of the GmPMEI156 gene is significantly increased under low-phosphorus stress, and the Arabidopsis can effectively resist the low-phosphorus stress. The application provides a resistance gene for soybean molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically involving the application of gene GmPMEI156 in improving the ability of plants to tolerate low phosphorus stress. Background Technology

[0002] Soybean seeds are rich in plant protein and are one of the main sources of high-quality protein for people. Soybeans play a very important role in agricultural production and food processing. In agricultural production, soybeans are an important crop for crop rotation, as they can improve soil fertility through nitrogen fixation. In food processing, soybeans are widely used in the production of soy products, vegetable oils, and plant protein products. In the feed industry, soybean meal is a major source of protein in livestock and poultry feed.

[0003] Phosphorus (P) is an essential element for plant growth and development. As a basic component of plant cells, phosphorus plays a crucial role in cell growth and proliferation. It also participates in various physiological and biochemical processes, including photosynthesis, respiration, energy storage and transfer, and cell division. Furthermore, phosphorus promotes root growth and development, enhances drought and cold resistance, and thus increases plant yield. Therefore, phosphorus is extremely important for plant growth and development.

[0004] The soils in South China are predominantly acidic with low pH values. In acidic soils, phosphorus is easily oxidized and fixed by metal ions such as iron (Fe) and aluminum (Al), while in alkaline soils, it is easily precipitated by calcium (Ca). Therefore, crops have difficulty absorbing phosphorus nutrients from the soil, resulting in low soybean yields and low economic benefits. Soil phosphorus deficiency has become a major limiting factor for improving soybean yields and economic benefits in South China.

[0005] Therefore, by utilizing relevant biological knowledge to analyze the molecular mechanisms of genes in low phosphorus tolerance, explore genes, realize the efficient absorption and utilization of phosphorus in soybeans, and cultivate new phosphorus-efficient soybean varieties, it is of great practical significance and application value for improving and increasing soybean yield in South China. Summary of the Invention

[0006] To address the problems mentioned above in the background art, one objective of this invention is to provide the application of the gene GmPMEI156 in improving the plant's tolerance to low phosphorus stress, wherein the nucleotide sequence of the CDS region of the gene GmPMEI156 is shown in SEQ ID NO.1, or the gene GmPMEI156 encodes the amino acid sequence shown in SEQ ID NO.2.

[0007] This application improves the plant's tolerance to low phosphorus stress by introducing the gene GmPMEI156 into the plant.

[0008] Furthermore, the plant is Arabidopsis thaliana or soybean.

[0009] The second objective of this invention is to provide a method for improving the tolerance of plants to low phosphorus stress. The method involves increasing the expression level of the amino acid sequence shown in SEQ ID NO.2 in the recipient plant. The specific steps include: introducing the gene GmPMEI156 shown in SEQ ID NO.1 into the recipient plant to obtain a transgenic plant, wherein the transgenic plant has a higher tolerance to low phosphorus stress than the recipient plant; or overexpressing the amino acid sequence shown in SEQ ID NO.2 in the recipient plant.

[0010] Furthermore, the increased tolerance of the plant to low phosphorus stress is reflected in the increase in its root length, fresh weight, or number of lateral roots.

[0011] The third objective of this invention is to provide the application of recombinant plasmids, recombinant vectors, and transgenic plant cell lines of the gene GmPMEI156 in improving the plant's tolerance to low phosphorus stress, wherein the nucleotide sequence of the gene GmPMEI156 is shown in SEQ ID NO.1; or the gene GmPMEI156 encodes the amino acid sequence shown in SEQ ID NO.2.

[0012] The fourth objective of this invention is to provide the application of the gene GmPMEI156 in the cultivation of plants tolerant to low phosphorus stress, wherein the nucleotide sequence of the gene GmPMEI156 is shown in SEQ ID NO.1; or the gene GmPMEI156 encodes the amino acid sequence shown in SEQ ID NO.2.

[0013] To achieve the above objectives, this application provides the following technical solution:

[0014] S1. Soybean root tip RNA was extracted and reverse transcribed into cDNA. The coding DNA sequence (CDS) of the GmPMEI156 gene was then cloned by PCR amplification.

[0015] S2, the cloned CDS was sequenced, and the sequencing results were compared with the reference sequence of the GmPMEI156 gene (the known sequence of this gene in the NCBI database). The CDS sequence was consistent with the reference sequence.

[0016] S3. The CDS was ligated into a vector and transformed into Agrobacterium. The function and role of the gene GmPMEI156 in low phosphorus stress tolerance were investigated through heterologous transformation of Arabidopsis thaliana and hairy roots. The specific steps are shown below:

[0017] First, the GmPMEI156 gene was inserted into an overexpression vector to construct a recombinant plasmid, which was then transformed into Agrobacterium. The CDS was then transferred into wild-type Arabidopsis thaliana using the anther infection method. Functional overexpressing plants were screened and propagated to the T5 generation.

[0018] Subsequently, using quantitative fluorescence, three lines with the highest expression levels were selected to conduct low phosphorus tolerance phenotype experiments on wild-type Arabidopsis and transgenic Arabidopsis.

[0019] In summary, the beneficial effects of this invention are as follows: Through the cloning and analysis of the soybean gene GmPMEI156, and through heterologous transformation of wild-type Arabidopsis thaliana to verify the gene function, this invention found that the low phosphorus tolerance of GmPMEI156 overexpression plants is significantly enhanced, which can lay the foundation for molecular breeding of soybeans to tolerate low phosphorus.

[0020] The above description is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention and to implement it in accordance with the contents of the specification, and to make the above and other objects, features and advantages of the present invention more apparent and understandable, preferred embodiments are described in detail below with reference to the accompanying drawings. Attached Figure Description

[0021] Figure 1 Phylogenetic tree analysis of some PMEI family genes in soybean and Arabidopsis thaliana;

[0022] Figure 2 Quantitative PCR results of the GmPMEI156 gene under different phosphorus conditions;

[0023] Figure 3 Cloning of the target fragment of the soybean GmPMEI156 gene (a) and identification of the bacterial culture ligated with the pLB vector (b).

[0024] Figure 4 Subcellular localization results of soybean GmPMEI156 gene protein;

[0025] Figure 5 Yeast self-activation verification of soybean GmPMEI156 gene and interaction verification with candidate proteins; part a is the self-activation verification of GmPMEI156 gene, and part b is the interaction verification of GmPMEI156 gene with candidate proteins.

[0026] Figure 6 Analysis of phosphorus expression patterns of two candidate proteins in the soybean GmPMEI156 gene;

[0027] Figure 7 Figure and plant biomass analysis of soybean hairy root experiment results with soybean GmPMEI156 gene;

[0028] Figure 8Genetic transformation and generation increment of soybean GmPMEI156 gene in Arabidopsis thaliana;

[0029] Figure 9 Phenotypic characteristics of whole plants of soybean transgenic Arabidopsis and wild-type Arabidopsis (Col-0) after 14 days of treatment under normal and low phosphorus conditions. Detailed Implementation

[0030] To further illustrate the technical means employed in this invention, the technical solution of this invention will be further described in detail through the following specific embodiments. In this invention, the equipment and raw materials used can all be purchased from the market or are commonly used in the field; the soybeans used are all provided by the Guangdong Branch of the National Soybean Improvement Center.

[0031] It should be understood that the implementation of the present invention is not limited to the following embodiments, and unless otherwise specified, they are all conventional methods in the art.

[0032] The nucleotide sequence of the CDS region of the GmPMEI156 gene is shown in SEQ ID NO.1:

[0033]

[0034] The full-length CDS of the GmPMEI15 gene in this embodiment is 1689 bp, and the protein consists of 562 amino acid residues.

[0035] The amino acid sequence encoded by the GmPMEI156 gene is shown in SEQ ID NO.2:

[0036] *

[0037] The protein encoded by the gene GmPMEI156 in this embodiment consists of 562 amino acid residues and has an isoelectric point (PI) of 8.29. Protein domain prediction using SMART and NCBI websites shows that the GmPMEI156 protein contains a PLN02713 domain located in the region of amino acids 1-562. Figure 1 This domain belongs to the PMEI family. It inhibits pectin methylesterase and invertase by forming a non-covalent 1:1 complex; it is involved in the regulation of fruit development, carbohydrate metabolism, and cell wall elongation.

[0038] Example 1: Analysis of the expression pattern of the GmPMEI156 gene under different phosphorus levels.

[0039] 1. Soybean material processing

[0040] S1. Prepare seeds of Brazilian No. 13 soybean and disinfect their surface with alcohol. Sow the disinfected seeds in moist vermiculite and place them in a culture room (temperature: 26℃, light: 16h / dark: 8h) for germination. When true leaves emerge, seedlings of similar growth are grouped and transferred to normal phosphorus nutrient (Normal Phosphorus, NP, 500μM KH2PO4) and low phosphorus nutrient (Low Phosphorus, LP, 5μM KH2PO4) nutrient solutions. Samples are collected at 0h, 3h, 6h, 12h, 24h, 36h, 2d, 7d, and 14d, and immediately flash-frozen in liquid nitrogen and stored at -80℃.

[0041] Table 1 Low-phosphorus culture medium formulation

[0042]

[0043]

[0044] When preparing the solution, the P concentration should be adjusted according to the corresponding experiment; if KH2PO4 is used for P treatment, K2SO4 should be used to supplement it.

[0045] S2, RNA was extracted from soybean root samples preserved after treatment with different phosphorus concentrations and reverse transcribed into cDNA.

[0046] S3, using cDNA as a template, real-time quantitative PCR was performed. Quantitative primers were designed using NCBI's Primer BLAST to obtain qGmPMEI156-F and qGmPMEI156-R.

[0047] qGmPMEI156-F (SEQ ID NO.3):5'-GCTGGGTTACGTATAATATGAGCAAA-3';

[0048] qGmPMEI156-R (SEQ ID NO. 4): 5'-ACAATATAGAGTGGCAGTGCAT-3'.

[0049] Soybean internal reference genes Actin3-F (SEQ ID NO.5): 5'-GCACCACCGGAGAGAAAATA-3'; Actin3-R (SEQ ID NO.6): 5'-GTGCACAATTGATGGACCAG-3'.

[0050] qRT-PCR was performed using a quantitative real-time PCR kit (Nanjing Novizan Biotechnology Co., Ltd., product model: Q312). The quantitative PCR system is shown in Table 2, and the reaction procedure is shown in Table 3. The obtained data were analyzed according to Formula 2. ^-△△CT Processing calculations.

[0051] Table 2. Quantitative Fluorescence System

[0052] reagents Volume (μL) cDNA 1 qGmPMEI156-F 0.4 qGmPMEI156-R 0.4 2×NovoStartSYBRqPCRSuperMixPlus 10 RNaseFreeWater 8.2

[0053] Table 3 qPCR reaction procedure

[0054]

[0055] The expression levels of the GmPMEI156 gene under normal and low phosphorus levels are as follows: Figure 2 As shown in the figure, the experiment indicates that the GmPMEI156 gene is induced to express in soybean roots by low phosphorus stress.

[0056] Example 2: Cloning and analysis of the target fragment of the GmPMEI156 gene

[0057] S1. Soybean root samples of the Huachun 6 variety were collected and immediately flash-frozen in liquid nitrogen. Total RNA was extracted from the soybean root samples using an RNA extraction kit (Nanjing Novizan Biotechnology Co., Ltd.). Subsequently, the RNA was reverse transcribed into cDNA using a reverse transcription kit (Nanjing Novizan Biotechnology Co., Ltd., product model: R333-C1) for subsequent gene expression analysis.

[0058] S2 uses NCBI's Primer BLAST for specific primer design.

[0059] The specific primer sequences are as follows:

[0060] GmPMEI156-F (SEQ ID NO.7): 5'-TAAACCTCATGCATTCCCATACA-3';

[0061] GmPMEI156-R (SEQ ID NO. 8): 5'-CACGTGCACCAGCATTAAAAG-3'.

[0062] Using cDNA as a template, the target fragment of the GmPMEI156 gene was cloned. The target fragment was amplified according to the reaction system in Table 4. The reaction program was as follows: pre-denaturation at 95℃ for 3 min; 34 cycles (denaturation at 95℃ for 15 s; annealing at 55℃ for 15 s; extension at 72℃ for 1 min / kb); final extension at 72℃ for 5 min. The cloned product of the target fragment was obtained and stored in a refrigerator at 12℃.

[0063] Table 4. Gene target fragment amplification system

[0064]

[0065] like Figure 3 As shown in part a, the clone length is 1842 bp.

[0066] S3. The target fragment cloning product was purified and then ligated into the pLB vector (Tiangen Biotech Co., Ltd., product model: VT205) to obtain the ligation product. This ligation product was transformed into *E. coli* DH5α competent cells using a heat shock method. Single colonies were then picked for colony PCR verification. Positive clones were screened and sent to a sequencing company for sequencing. Strains with correct sequencing results underwent plasmid extraction and glycerol preservation. The resulting plasmid was named pLB-GmPMEI156. The PCR primer synthesis and gene sequencing in the above steps were performed by Sangon Biotech (Shanghai) Co., Ltd. The identification diagram of the bacterial culture after ligation of the GmPMEI156 gene with the pLB vector is shown below. Figure 3 As shown in section b, M is DNA ladder marker 2000, lane 1 is the water negative control, and lanes 2-6 are single colony identification bands of pLB-GmPMEI156.

[0067] Example 3: Subcellular localization of GmPMEI156 protein

[0068] ① Amplification of the target fragment: Using pLB-GmPMEI156 as template cDNA, recombinant cloning primers were designed using CE designV1.03.

[0069] p1300-GmPMEI156-F(SEQ ID NO.9):5'-ccaaatcgactctagtctagaATGGCTTTCAAGAACTTGTCCG-3'

[0070] p1300-GmPMEI156-R (SEQ ID NO.10):5'-catggtaccggatccactagtTATCAATCCACTAATGTATGGAACTCC-3';

[0071] The full-length CDS sequence of the GmPMEI156 gene was amplified by PCR. The PCR amplification method and conditions were the same as above. After gel electrophoresis, the amplified product was purified using a product purification kit (Nanjing Novizan Biotechnology Co., Ltd., product model: DC301).

[0072] ② Linearization vector: The pCAMBIA1300 empty vector plasmid was digested with XbaI and SpeI restriction endonucleases.

[0073] ③ Ligation: The target fragment, GFP fragment and pCAMBIA1300 were ligated, and the ligation product was transformed into DH5α E. coli. Then, colonies were picked for bacterial identification and sequencing. After the sequencing was correct, plasmids were extracted and the remaining strains were preserved to obtain the pCAMBIA1300-GmPMEI156-GFP vector for subsequent experiments.

[0074] The plasmid extraction procedure was performed according to the instructions for the Novizan Plasmid Extraction Kit DC201. Detailed steps are as follows:

[0075] (1) Add bacterial culture to a 2 mL centrifuge tube, place the tube in a centrifuge and centrifuge at 12000 r / min for 1 min; discard the filtrate. Repeat three times to collect the bacterial cells;

[0076] (2) Add 250 μL Buffer P1 and place in a vortex mixer to suspend all the bacterial cells;

[0077] (3) Add 250 μL of Buffer P2 and gently invert the container 8 times.

[0078] (4) Add 350 μL Buffer P3 and gently invert the tube 8 times. Place the tube in a centrifuge and centrifuge at 12000 r / min for 10 min.

[0079] (5) Install the adsorption column onto a clean centrifuge tube, transfer 600 μL of supernatant into the adsorption column, and then centrifuge (12000 r / min, 1 min); discard the waste liquid;

[0080] (6) Add 600 μL of Buffer PW2 to the adsorption column and centrifuge (12000 r / min, 1 min); discard the waste liquid;

[0081] (7) Repeat step (6);

[0082] (8) Centrifuge again (12000 r / min, 2 min);

[0083] (9) Place the adsorption column on the collection tube, add 25 μL of ddH2O, let it stand at room temperature for 2 min, and then centrifuge at 12000 r / min for 1 min. Repeat this step to increase the plasmid mass, and store the product in a -20℃ refrigerator.

[0084] Preservation of bacterial strain: Mix the bacterial solution and 50% glycerol in a 1:1 ratio in 2 mL sterile centrifuge tubes and store at -80°C.

[0085] ④ Transformation of Tobacco Bunsenii: Prepare the pCAMBIA1300-GPF plasmid and transform the pCAMBIA1300-GPF and pCAMBIA1300-GmPMEI156-GFP plasmids into Agrobacterium GV3101 (P19) strain, respectively. Shake the cells beforehand to OD600 = 0.6-0.8, then centrifuge (5000 r / min, 5 min), retain the bacterial blocks, and prepare a tobacco resuspension. Prepare the tobacco resuspension according to Table 5, and use immediately.

[0086] Transform Agrobacterium tumefaciens according to the Vedi GV3101 transformation instructions. Detailed steps are as follows:

[0087] (1) The competent state was melted at room temperature and placed on ice;

[0088] (2) Add the target gene DNA plasmid to the bacterial culture and gently tap to mix. Perform the following treatments in sequence: place on ice, flash freeze in liquid nitrogen, bathe in a 37°C water bath, and then place on ice again; each step should be performed for 5 minutes.

[0089] (3) Add antibiotic-free YEP liquid culture medium to the clean bench and place it in a shaker at 28℃ and 220r / min for 2-3 hours;

[0090] (4) In a clean bench, use a glass rod to evenly spread the bacterial solution onto YEP solid medium containing antibiotics Kan (working concentration: 50 μg / L) and Rif (working concentration: 25 μg / L), and incubate upside down in an incubator at 28℃ for 2-3 days.

[0091] (5) Once colonies have grown, pick a single colony in a clean bench and transfer it to a 1.5 mL centrifuge tube containing antibiotics Kan (working concentration: 50 μg / L) and Rif (working concentration: 25 μg / L). Place the EP tube in a shaker at 28°C and 200 rpm for 6 hours, and then perform PCR identification on the colonies.

[0092] Table 5 Tobacco Resuspension Formulation

[0093]

[0094] Protein localization prediction of the GmPMEI156 gene was performed using the PSORT and WoLF PSORT websites.

[0095] Plant tobacco, and after about a month, select healthy, undamaged leaves for injection. Mark the leaves and treat them in the dark for 2-3 days. After the dark treatment, gently peel off the lower epidermis of the tobacco leaves with tweezers and observe them under a laser confocal microscope.

[0096] The results are as follows Figure 4As shown in the figure, eGFP is the GFP channel (excitation wavelength 488 nm), DAPI is the ultraviolet channel (excitation wavelength 360 nm) that can bind to DNA and emit blue fluorescence, Merge indicates the fusion of GFP and DAPI, and Bright field represents the bright field. Experiments show that the GmPMEI156 protein is located in the cell nucleus.

[0097] Example 4: Yeast self-activation of GmPMEI156 and verification of candidate interacting proteins

[0098] (1) Amplification of the target fragment: Using pLB-GmPMEI156 as a template cDNA, recombinant cloning primers were designed using CE designV1.03.

[0099] pGBKT7-GmPMEI156-F(SEQ ID NO.11):5'-atggccatggaggccgaattcATGGCTTTCAAGAACTTGTCCG-3'

[0100] pGBKT7-GmPMEI156-R(SEQ ID NO.12):5'-ccgctgcaggtcgacggatccCTATCAATCCACTAATGTATGGAACTCC-3'

[0101] The full-length CDS sequence of the GmPMEI156 gene was amplified by PCR. The PCR amplification method and conditions were the same as above. After gel electrophoresis, the amplified product was purified using a product purification kit (Nanjing Novizan Biotechnology Co., Ltd., product model: DC301).

[0102] (2) Linearization of the vector: The pGBKT7 vector was linearized using EcoRI and BamHI restriction endonucleases.

[0103] (3) Ligation: The target fragment was ligated with pGBKT7, and the ligation product was transformed into DH5α Escherichia coli. Then, colonies were picked for bacterial identification and sequencing. After the sequencing was correct, plasmids were extracted and the remaining strains were preserved to obtain the pGBKT7-GmPMEI156 vector for subsequent experiments.

[0104] Transfer the correct strain to LB liquid medium containing antibiotic Kan (working concentration: 50 μg / L), and amplify it at 37°C and 200 rpm using a shaker, following the instructions for the Novizan plasmid extraction kit DC201.

[0105] (4) The successfully constructed pGBKT7-GmPMEI156 plasmid and pGADT7 empty vector were transformed into Y2HGold yeast competent cells to detect self-activation activity. pGBKT7-53 plasmid and pGADT7-T were used as positive controls; pGBKT7-lam and pGADT7-T were used as negative controls. For specific procedures, refer to the Y2HGold ChemicallyCompetentCell instruction manual from Shanghai Weidi Company. The strain was plated on yeast SD / -Trp-Leu plates and incubated upside down at 28℃ for 2-3 days.

[0106] (5) Add Xa-Gal chromogenic agent to SD / -Trp-Leu, pick up colonies, dilute and resuspend them with 0.9% physiological saline, dip the bacterial solution onto the culture medium, and grow in a constant temperature incubator at 29℃ for 2-3 days.

[0107] The results are as follows Figure 5 As shown in part a: GmPMEI156 does not have self-activation.

[0108] ⑥ The SMART website predicted ten genes that interact with GmPMEI156 in yeast. Gene information was retrieved using Phytozome, and primers for cloning the target fragments were designed using NCBI's Primer BLAST. Using cDNA from Huachun 6 soybean as a template, PCR amplification was performed, and two target genes were successfully cloned. Subsequent yeast self-activation verification was then conducted.

[0109] Glyma.13G134200-F(SEQ ID NO.13):GGAAACGTCTAGCACCCACA;

[0110] Glyma.13G134200-R(SEQ ID NO.14):CCCCTGCATTTATGCAACAGC;

[0111] Glyma.10G277200-F(SEQ ID NO.15):CAAACCCCTTCCCAAACCCA;

[0112] Glyma.10G277200-R(SEQ ID NO.16):CAATCATAGTGCACCTAGCTCT;

[0113] pGBKT7-Glyma.13G134200-F(SEQ ID NO.17):5'-atggccatggaggccgaattcATGGGTAACTCCCATGGACACC-3'

[0114] pGBKT7-Glyma.13G134200-R(SEQ ID NO.18):5'-ccgctgcaggtcgacggatccTAGTGTTTGATCTGCTGGCTTAGC-3';

[0115] pGADT7-Glyma.13G134200-F(SEQ ID NO.19):5'-gccatggaggccagtgaattcATGGGTAACTCCCATGGACACC-3'

[0116] pGADT7-Glyma.13G134200-R(SEQ ID NO.20):5'

[0117] acgattcatctgcagctcgagCTAGTGTTTTGATCTGCTGGCTTAGC-3'

[0118] pGBKT7-Glyma.10G277200-F(SEQ ID NO.21):5'-atggccatggaggccgaattcATGCTCCCCATCACCTGCA-3'

[0119] pGBKT7-Glyma.10G277200-R(SEQ ID NO.22):5'-ccgctgcaggtcgacggatccTAGTAATGATAATAAAAAGGCATGGTTG-3';

[0120] pGADT7-Glyma.10G277200-F(SEQ ID NO.23):5'-gccatggaggccagtgaattcATGCTCCCCATCACCTGCA-3'

[0121] pGADT7-Glyma.10G277200-R(SEQ ID NO.24):5'-acgattcatctgcagctcgagCTAGTAATGATAATAAAAAGGCATGGTTG-3'

[0122] The results are as follows Figure 5 Part b shows that the protein of gene GmPMEI156 interacts with the genes Glyma.13G134200 and Glyma.10G277200.

[0123] Analysis of phosphorus expression patterns of interacting genes; results are as follows Figure 6As shown, the gene Glyma.13G134200 is not induced by low phosphorus stress in soybean; Glyma.10G277200 is a low phosphorus-sensitive gene, induced by low phosphorus stress. The quantitative primers for the interacting genes are as follows:

[0124] q Glyma.13G134200-F (SEQ ID NO.25):GGTAACTCCCATGGACACCG;

[0125] q Glyma.13G134200-R (SEQ ID NO.26): TTATGGGGAGGAGGAACCGT;

[0126] q Glyma.10G277200-F(SEQ ID NO.27):ACGCTCTTCTCAACCTCAACC;

[0127] q Glyma.10G277200-R (SEQ ID NO. 28): CCCTTCTCCGTAGTGAGGCA.

[0128] Example 5: Identification of low phosphorus tolerance in soybean hairy roots

[0129] Gene editing vectors were constructed; four targets were designed for GmPMEI156 using CRISPR-P 2.0 from the Huazhong Agricultural University website, resulting in Guide2, Guide10, Guide37, and Guide53.

[0130] Guide2-F(SEQ ID NO.29):GGATTGCGTAAATCCTTCCTTCTGC;

[0131] Guide2-R(SEQ ID NO.30):AAACGCAGAAGGAAGGATTTACGCA;

[0132] Guide10-F (SEQ ID NO.31):GGATTGGTCTAACTTCTTGGACGGA;

[0133] Guide10-R(SEQ ID NO.32):AAACTCCGTCCAAGAAGTTAGACCA;

[0134] Guide37-F (SEQ ID NO.33):GGATTGCATTGTGAAAACGTACCTT;

[0135] Guide37-R(SEQ ID NO.34):AAACAAGGTACGTTTTCACAATGCA;

[0136] Guide53-F (SEQ ID NO.35):GGATTGGCGGCTAATAACCGTGCAG;

[0137] Guide53-R (SEQ ID NO. 36):AAACCTGCACGGTTATTAGCCGCCA.

[0138] Referencing the cloning method for the legume CRISPR / Cas9 vector pUC19, primers were designed and synthesized to target the desired target. After annealing the oligonucleotides to double strands, they were ligated with the BsaI-digested pUC19 plasmid. The ligation product was transformed into E. coli DH5α competent cells, colonies were picked for bacterial identification and sequencing, and correctly sequenced strains were preserved and plasmids were extracted.

[0139] Transfer the correct strain to LB liquid medium containing the antibiotic Kan (working concentration: 50 μg / L), and amplify it at 37°C and 200 rpm using a shaker, following the instructions for the Novizan plasmid extraction kit DC201.

[0140] The pTF101 empty vector, pTF101-GmPMEI156, and Cas9-GmPMEI156 plasmids were transformed into Agrobacterium K599. The transformed strains were amplified by shaking until OD600 = 0.6-0.8; then centrifuged at 5000 rpm for 5 min, retaining the bacterial block. 5 mL of resuspension buffer was added for resuspending.

[0141] The hair root resuspension solution should be prepared according to Table 6 and used immediately after preparation.

[0142] Table 6 Hair Root Resuspension Formulation

[0143]

[0144] Soybean rooting: Plant Brazilian No. 13 seeds in vermiculite. When the seeds reach 6cm in length, use a 1mL syringe to draw up a resuspended bacterial solution and inject it into the seedlings 1-2cm below the cotyledon node. Incubate in a high-temperature and high-humidity environment (16h light / 8h dark, 26℃) for approximately 7 days.

[0145] Hairy root phenotypic identification: After the above seeds have grown 3-5cm hairy roots, cut off the original roots, and gently take the roots to culture in Hogland solutions with KH2PO4 concentrations of 500μmol / L and 5μmol / L (pH=5.8) for 14 days, changing the water every 2 days.

[0146] During hydroponics, DNA was rapidly extracted from the roots of each seedling to identify positive seedlings; simultaneously, root samples were collected and RNA was extracted, with three replicates for each treatment. RNA was reverse transcribed into cDNA, and gene expression levels under different treatments were determined by quantitative real-time PCR.

[0147] After hydroponics, photos were taken for record-keeping. At the same time, the fresh weight of the above-ground and underground parts of soybean plants under different treatments was weighed. After the samples were completely dried, the dry weight was measured. Fresh and dry samples were taken to determine the soluble phosphorus and total phosphorus content. At least three biological replicates were taken for each data point. The collected samples were stored at -80℃.

[0148] The results of the hairy root phenotypic identification of GmPMEI156 transgenic are as follows: Figure 7 As shown, a and b represent the phenotypes of soybean chimeras overexpressing the GmPMEI156 gene (OE), gene-edited GmPMEI156 gene (gmpmei156), and empty vector (CK) after 14 days of treatment under normal and low phosphorus conditions; cI represents the results of aboveground fresh weight, underground fresh weight, relative expression level of roots, aboveground fresh weight, underground fresh weight, aboveground phosphorus content, and underground phosphorus content.

[0149] The experimental results showed that the root elongation, lateral root growth and dry weight of the overexpression (OE) plants were significantly improved compared with the wild-type control plants (CK), indicating that overexpression of the GmPMEI156 gene can improve tolerance to low phosphorus stress; gene editing of the GmPMEI156 gene will enhance the sensitivity of soybean to low phosphorus stress.

[0150] Example 6: Genetic transformation and phenotypic identification in Arabidopsis thaliana

[0151] Step 1, construct the overexpression vector:

[0152] ① Amplification of the target fragment: pLB-GmPMEI156 was used as template cDNA, and recombinant cloning primers pTF-GmPMEI156-F and pTF-GmPMEI156-R were designed using CE designV1.03.

[0153] pTF-GmPMEI156-F (SEQ ID NO.37):

[0154] gagaacacgggggactctagaATGGCTTTCAAGAACTTGTCCG

[0155] pTF-GmPMEI156-R(SEQ ID NO.38):

[0156] cgatcggggaaattcgagctcCTATATCAATCCACTAATGTATGGAACTCC

[0157] The full-length CDS sequence of the GmPMEI156 gene was amplified by PCR. The PCR amplification method and conditions were the same as above. After gel electrophoresis, the amplified product was purified using a product purification kit (Nanjing Novizan Biotechnology Co., Ltd., product model: DC301).

[0158] ② Linearization vector: The pTF101 empty vector plasmid was digested with XbaI and SacI restriction endonucleases.

[0159] ③ Ligation: The target fragment was ligated to pTF101, and the ligation product was transformed into DH5α Escherichia coli. Colonies were then picked for bacterial identification and sequencing. After successful sequencing, plasmids were extracted, and the remaining strains were preserved to obtain the pTF101-GmPMEI156 vector for subsequent experiments.

[0160] The pTF101-GmPMEI156 plasmid was transformed into GV3101 (Weidi), plated, and the bacterial culture was identified and preserved.

[0161] Preparation before heterologous transformation of Arabidopsis thaliana: Add water to wild-type Arabidopsis thaliana, purify it in a 4℃ refrigerator for 3 days, sow it on nutrient soil, and place it in a constant temperature incubator.

[0162] Anther infection of Arabidopsis thaliana: The GV3101 strain containing the gene was amplified by shaking until OD600 = 0.6-0.8, then centrifuged at 5000 rpm for 5 min, retaining the bacterial bulk. 10 μL of Arabidopsis thaliana infection activator (silliweet-77) was added to every 50 mL of 1 / 2 MS liquid, and the mixture was stirred on a magnetic stirrer to create foam. The bacterial cells were resuspended 1:1 in the resuspended solution, and the bacterial bulk was agitated by pipetting.

[0163] Before infecting Arabidopsis thaliana, water thoroughly, remove the pods from the plants, and completely immerse the flower buds in the resuspended bacterial solution for 1-2 minutes. Cover with a bag to maintain humidity, and incubate in the dark for 12-16 hours before transferring to an incubator. Infect once a week, adding 6-BA to the resuspended solution for the second infection.

[0164] Step 2, Arabidopsis thaliana screening and identification

[0165] Arabidopsis thaliana harvested after infection was vernalized, sown on nutrient soil, and cultured in an incubator. Once true leaves unfolded, the plants were sprayed with 20 μg / mL glufosinate-ammonium herbicide. Ten days later, resistant seedlings were transplanted into nutrient soil. After obtaining the T1 generation, DNA was extracted from plant leaves for positive seedling identification. Positive seedlings were then passaged to homozygotes. RNA was extracted from leaves of positive seedlings, and the relative expression level of the GmPMEI156 gene in different lines was determined by quantitative real-time PCR.

[0166] The results are as follows Figure 8 As shown in the figure, part a is a picture of Arabidopsis thaliana after being sprayed with glufosinate; part b is the result of relative expression level of positive seedlings; part c is the result of bacterial culture identification of positive seedlings, M is DNA ladder marker 2000, lane 1 is water negative control, lane 2 is pTF101-GmPMEI156 plasmid, and lanes 3-10 are transgenic Arabidopsis thaliana lines.

[0167] Experiments showed that the expression level of the GmPMEI156 gene in transgenic plants was significantly increased compared with that in wild-type (WT) plants, indicating that the GmPMEI15 gene was successfully transferred into the plants and achieved stable expression in transgenic plants.

[0168] Step 3, Identification of low-phosphorus phenotype in Arabidopsis thaliana:

[0169] Three lines with high expression levels and WT were selected for phenotypic identification. The lines were dispensed into individual containers, and 300 μL of 20% sodium hypochlorite and 700 μL of sterile ultrapure water were added to a clean bench. The containers were washed on a shaker for 6-8 minutes, followed by washing the seeds 8 times with ultrapure water. The containers were then placed in a 4°C refrigerator for vernalization for 3 days.

[0170] Prepare 1 / 2 MS (pH=5.8) solid medium, sow vernalized Arabidopsis seeds on the plate, place them vertically in the tissue culture room, and wait for the roots to grow to about 1 cm.

[0171] Solid culture media with different phosphorus concentrations were prepared; specifically, solid culture media with KH2PO4 concentrations of 500 μmol / L and 100 μmol / L at pH 5.8. Germinated lines and WT plants (5 plants each) were transferred to normal phosphorus and low phosphorus plates for further growth. After 14 days, the differences in Arabidopsis plant growth were observed, phenotypes were photographed and recorded, and fresh weight was recorded.

[0172] The results are as follows Figure 9 As shown in the figure, part a is the phenotypic identification diagram of Arabidopsis thaliana tolerating low phosphorus; parts b and c are bar charts respectively of the phosphorus content of Arabidopsis thaliana, the fresh weight of the underground parts of five Arabidopsis thaliana plants, the length of the taproot, and the number of lateral roots.

[0173] Experiments showed that under low phosphorus growth conditions, the taproot and lateral root growth of GmPMEI156 overexpressing plants were superior to that of wild-type Arabidopsis thaliana (WT), and the aboveground and underground fresh weights of transgenic Arabidopsis were also higher. Therefore, overexpressing Arabidopsis plants can alleviate the inhibitory effects of low phosphorus stress on the growth and development of Arabidopsis.

[0174] In summary, the experiments showed that heterologous overexpression of the GmPMEI156 gene in Arabidopsis thaliana significantly increased the length of the taproot, the number of lateral roots, and the fresh weight of the plant, thereby enhancing its tolerance to low phosphorus. This demonstrates that the GmPMEI156 gene has strong resistance to low phosphorus stress.

[0175] This application, through cloning the soybean GmPMEI156 gene and bioinformatics analysis, combined with the identification of low phosphorus tolerance in soybean hairy roots and the verification of gene function in Arabidopsis thaliana, confirms that the soybean gene GmPMEI156 can enhance the plant's tolerance to low phosphorus stress.

[0176] The data in this embodiment are the average and standard error of three replicates. "*", "**", "***" and "****" indicate that the difference between the treatment and the control is significant (*P≤0.05), extremely significant (**P≤0.01), extremely significant (***P≤0.001), and extremely significant (****P≤0.0001), respectively.

[0177] The embodiments described above are merely preferred embodiments of the present invention and should not be construed as limiting the scope of protection of the present invention. Any non-substantial changes and modifications made by those skilled in the art based on the invention shall fall within the scope of protection of the present invention.

Claims

1. The application of gene GmPMEI156 in improving plant tolerance to low phosphorus stress, characterized by: The nucleotide sequence of the CDS region of the gene GmPMEI156 is shown in SEQ ID NO.1, or the amino acid sequence encoded by the gene GmPMEI156 is shown in SEQ ID NO.2; the plant is Arabidopsis thaliana or soybean.

2. A method for improving the tolerance of plants to low phosphorus stress, characterized in that, The method is to increase the expression level of the amino acid sequence shown in SEQ ID NO.2 in the recipient plant; the plant is Arabidopsis thaliana or soybean.

3. The method according to claim 2, characterized in that, The increased tolerance of the plant to low phosphorus stress was reflected in the increase in its root length, fresh weight, or number of lateral roots.

4. The application of recombinant vectors and transgenic plant cell lines containing the gene GmPMEI156 in improving the plant's tolerance to low phosphorus stress, characterized in that... The nucleotide sequence of the gene GmPMEI156 is shown in SEQ ID NO.1; or the gene GmPMEI156 encodes the amino acid sequence shown in SEQ ID NO.2; the plant is Arabidopsis thaliana or soybean.

5. The application of gene GmPMEI156 in the cultivation of plants tolerant to low phosphorus stress, characterized in that, The nucleotide sequence of the gene GmPMEI156 is shown in SEQ ID NO.1; or the gene GmPMEI156 encodes the amino acid sequence shown in SEQ ID NO.2; the plant is Arabidopsis thaliana or soybean.

Citation Information

Patent Citations

  • Application of gene GmPP2-10 in promoting growth of plant in low-phosphorus stress environment

    CN120400218A

  • Application of soybean low-phosphorus-tolerant gene GmVQ32 in improvement of low-phosphorus stress tolerance of plants

    CN120400219A

  • Application of soybean low-phosphorus-tolerant gene GmAP2 in improvement of low-phosphorus stress tolerance of plants

    CN120485245A