Diagnosis and treatment assisting method for cardiovascular complications of gestational diabetes mellitus
By detecting the expression levels of miR-584-5p, PTEN and PINK1 proteins and mitophagy-related indicators in umbilical vein endothelial cells of patients with gestational diabetes, combined with clinical indicators, the problem of early accurate assessment and targeted intervention of cardiovascular complications of gestational diabetes was solved, and scientific and targeted judgment of cardiovascular risk was achieved.
Patent Information
- Application Number
- CN202510593795.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-09
- Publication Date
- 2025-08-15
AI Technical Summary
The prior art cannot accurately assess the risk of cardiovascular complications of gestational diabetes mellitus, and the lack of detection of endothelial cells' mitophagy function and related molecular mechanisms, making it difficult for interventions to fundamentally improve endothelial cell dysfunction.
By detecting the expression levels of miR-584-5p, PTEN genes and their downstream PINK1 protein in umbilical vein endothelial cell samples of gestational diabetes patients, risk assessment is carried out in combination with clinical indicators, and risk scoring formulas are optimized to achieve early accurate assessment and targeted intervention.
It has achieved multi-level and accurate assessment of cardiovascular complications of gestational diabetes, breaking through the limitations of traditional single-index testing, and providing scientific and targeted risk judgments.
Smart Images

Figure CN120485352A_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the technical field of diagnosis and treatment of diabetic complications, and specifically to an auxiliary method for diagnosis and treatment of cardiovascular complications of gestational diabetes. Background Art
[0002] Gestational diabetes mellitus (GDM) is a common endocrine disorder during pregnancy. The increased risk of long-term cardiovascular disease in offspring associated with GDM has become a significant clinical concern. Although glycemic control during pregnancy can improve short-term pregnancy outcomes, its effectiveness in preventing cardiovascular disease in offspring is limited, suggesting that GDM has a "metabolic memory" effect, the mechanism of which is closely related to endothelial cell dysfunction.
[0003] Existing studies have found that umbilical vein endothelial cells (HUVECs) in GDM exhibit damaged phenotypes such as abnormal mitochondrial ultrastructure, decreased membrane potential, and increased reactive oxygen species. Abnormal regulation of the key mitochondrial autophagy pathway, PTEN / PINK1 / Parkin, is a major cause of the accumulation of damaged mitochondria. However, current clinical assessments of cardiovascular complications in GDM offspring still rely on traditional indicators such as blood glucose and body mass index, lacking precise detection of endothelial cell mitochondrial autophagy function and related molecular mechanisms. Furthermore, interventions for GDM have not yet targeted the mitochondrial autophagy regulatory pathway, making it difficult to fundamentally improve endothelial cell dysfunction.
[0004] Secondly, microRNA (miRNA) is an important regulator of gene expression, and its abnormal expression plays a key role in the pathogenesis of GDM. Studies have confirmed that miR-584-5p is significantly upregulated in HUVECs of GDM patients. By inhibiting the target gene PTEN, it inhibits PINK1 / Parkin-mediated mitochondrial autophagy, leading to abnormal mitochondrial accumulation and endothelial dysfunction. However, existing technologies do not combine molecular detection of the miR-584-5p / PTEN / PINK1 pathway with clinical indicators, making it impossible to achieve early and accurate assessment of cardiovascular complication risk and targeted intervention.
[0005] Therefore, there is an urgent need for a more optimized auxiliary technology for the diagnosis and treatment of cardiovascular complications of gestational diabetes to improve the accuracy of diagnosis and treatment results. Summary of the Invention
[0006] The purpose of this application is to provide an auxiliary method for the diagnosis and treatment of cardiovascular complications of gestational diabetes mellitus to solve the technical problems raised in the above background technology.
[0007] To achieve the above objectives, the present application discloses the following technical solution: a method for assisting the diagnosis and treatment of cardiovascular complications of gestational diabetes, the method comprising the following steps:
[0008] S1-Collection of umbilical vein endothelial cell samples from patients with gestational diabetes;
[0009] S2-Detecting the expression level of miR-584-5p, the expression level of the PTEN gene and its downstream PINK1 protein in the umbilical vein endothelial cell sample, and detecting mitophagy-related indicators, wherein the mitophagy-related indicators at least include: the expression levels of PINK1 / Parkin pathway proteins LAMP2 and ATG12;
[0010] S3-Combined with clinical indicators, the risk of cardiovascular complications in the offspring of patients with gestational diabetes is assessed based on the expression level of the miR-584-5p, the expression level of the PTEN gene and its downstream PINK1 protein, and the related indicators.
[0011] Preferably, the obtaining of the umbilical vein endothelial cell sample specifically includes:
[0012] S11-Under sterile conditions, remove a 15-20 cm piece of neonatal umbilical cord and flush the umbilical vein with 37°C preheated PBS until the outflowing fluid is colorless and transparent;
[0013] S12-inject 0.125% pancreatin solution and digest at 37°C for 8 minutes;
[0014] S13-Collect the digestion solution and centrifuge, discard the supernatant, add M199 complete medium containing 20% fetal bovine serum, 5ng / mL fibroblast growth factor, 0.25mg / mL heparin, 100U / mL penicillin and 100U / mL streptomycin to make 1×10 6 / mL cell suspension;
[0015] S14 - The cell suspension is inoculated into a culture flask, and cultured at 37° C. and 5% CO 2 until the cell confluence reaches 80%. Cells at passages 3 to 6 are taken as the umbilical vein endothelial cell samples.
[0016] Preferably, the detection of the expression level of miR-584-5p specifically includes:
[0017] S211-miRNA sequencing technology was used to screen differentially expressed miRNAs, with the screening conditions being fold difference FC>1.5, p<0.05, and TPM>10;
[0018] S212-Real-time quantitative PCR was used to verify the relative expression of miR-584-5p using U6snRNA as an internal reference and the ΔΔCT method. The qPCR primer sequences for miR-584-5p were as follows:
[0019] Forward primer: 5'-GATGCTCCTTATGGTTT GCCT-3',
[0020] Reverse primer: 5′-TATGGTT GTTCACGACTCCTTCAC-3′.
[0021] Preferably, the detection of PTEN gene and protein expression levels specifically includes:
[0022] S221-mRNA level detection: Total RNA was extracted from the umbilical vein endothelial cell sample and detected by qPCR method, using GAPDH as the internal reference, wherein the PTEN qPCR primer sequence is:
[0023] Forward primer: 5'-TTTGAAGACCATAACCC ACCAC-3',
[0024] Reverse primer: 5′-ATTACACCAGTTCGTCCCTTTC-3′;
[0025] S222-Protein level detection: Western blot was used to extract total protein, followed by SDS-PAGE electrophoresis and membrane transfer; GAPDH was used as an internal reference, and the relative expression of PTEN protein was analyzed by chemiluminescence imaging.
[0026] Preferably, the expression level of the PINK1 protein and the detection of the mitophagy-related indicators are detected by Western blot method, specifically including:
[0027] After total protein extraction from S231-cells, protein concentration was determined by BCA assay;
[0028] S232- Perform SDS-PAGE electrophoresis to separate proteins. After transfer, block the PVDF membrane with 5% skim milk powder, incubate with specific primary and secondary antibodies in sequence, and develop and analyze the grayscale value of the protein bands using a chemiluminescence imager.
[0029] Preferably, the clinical indicators include: pre-pregnancy body mass index, fasting blood glucose value, 2-hour blood glucose value after oral glucose tolerance test and glycosylated hemoglobin value, wherein,
[0030] The calculation formula of the pre-pregnancy body mass index is: TZ 孕前体重 is the pre-pregnancy weight, SG 身高 is height;
[0031] The fasting blood glucose value and the 2-hour blood glucose value after the oral glucose tolerance test are determined by the glucose oxidase method, and the glycosylated hemoglobin value is determined by the high-pressure liquid chromatography method.
[0032] Preferably, the assessment of the risk of cardiovascular complications specifically includes:
[0033] S31-Calculate the risk score. The risk score is calculated using the following formula:
[0034] F=a×ZData miR-584-5p +b×(ZData miR-584-5p ×ZData PTEN蛋白表达量 )
[0035] -c×ZData PTEN蛋白表达量 -d×(ZData PTEN蛋白表达量 ×ZData PINK1蛋白表达量 )
[0036] -e×ZData PINK1蛋白表达量 +f×ZData BMI +g×ZData FPG +h×ZData OGTT-2h
[0037] +j×ZData HbA1c
[0038] Among them, ZData miR-584-5p is the relative expression level of miR-584-5p after Z-score normalization; ZData PTEN蛋白表达量 is the PTEN protein expression after Z-score normalization; ZData PINK1蛋白表达量 is the PINK1 protein expression level after Z-score normalization; ZData BMI is the pre-pregnancy body mass index after Z-score standardization; ZData FPG is the fasting blood glucose value after Z-score standardization; ZData OGTT-2h ZData is the blood glucose value after 2 hours of oral glucose tolerance test after Z-score standardization; HbA1c is the glycated hemoglobin value after Z-score standardization, a, b, c, d, e, f, g, h, j are the regression coefficients of each indicator; the Z-score standardization formula is: ZData i is the value of an indicator after Z-score standardization, Data i is the original value of the indicator, is the mean value of the index in the umbilical vein endothelial cell samples, and S is the standard deviation of the index in the umbilical vein endothelial cell samples;
[0039] S32-If the calculated risk score F ≥ F 阈值 , the risk of cardiovascular complications is assessed as high risk. If the calculated risk score F<F 阈值, the risk of cardiovascular complications is assessed as low risk; F 阈值 is the preset risk score threshold.
[0040] Preferably, the risk score is further optimized by an optimization mechanism, and the optimized risk score is used as the basis for risk level determination. The optimization mechanism specifically introduces gestational age data to optimize the initially calculated risk score. The optimized risk score is specifically:
[0041] F'=F+k×T 孕周
[0042] Among them, T 孕周 is the gestational age; k is the regression coefficient corresponding to the gestational age index.
[0043] Preferably, the risk score threshold is determined by maximizing the Youden index of the ROC curve.
[0044] Beneficial effects: The auxiliary method for the diagnosis and treatment of cardiovascular complications of gestational diabetes mellitus in this application, by detecting the expression levels of miR-584-5p, PTEN, PINK1 and mitochondrial autophagy-related proteins (LAMP2, ATG12) in umbilical vein endothelial cells, realizes a multi-level and accurate evaluation of the pathogenesis of cardiovascular complications in GDM offspring (miRNA regulation-target gene-mitochondrial autophagy pathway), breaks through the limitations of traditional single indicator detection, and provides molecular-level evidence for the early detection of endothelial cell dysfunction; by combining clinical indicators such as pre-pregnancy body mass index, fasting blood glucose, and glycated hemoglobin for risk assessment, a quantitative prediction of the risk of cardiovascular complications is achieved, which solves the problem of lack of mechanism association in existing assessment methods and makes risk judgment more scientific and targeted. BRIEF DESCRIPTION OF THE DRAWINGS
[0045] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present application. For those skilled in the art, other drawings can be obtained based on these drawings without paying any creative work.
[0046] Figure 1 This is a flowchart of auxiliary methods for the diagnosis and treatment of cardiovascular complications of gestational diabetes mellitus;
[0047] Figure 2 Schematic diagram of cell migration control;
[0048] Figure 3 This is a comparison diagram of the tube forming experiment results;
[0049] Figure 4 Schematic diagram of cell viability control;
[0050] Figure 5 Schematic diagram of cell activity detection control;
[0051] Figure 6 Schematic diagram of mitochondrial structure comparison;
[0052] Figure 7 This is a schematic diagram of the control results of mitochondrial morphology staining;
[0053] Figure 8 Schematic diagram of mitochondrial membrane potential control;
[0054] Figure 9 Schematic diagram of mitochondrial superoxide production control;
[0055] Figure 10 This is a schematic diagram of ATP content control;
[0056] Figure 11 This is a schematic diagram showing the control results of PINK1 protein expression level detection. DETAILED DESCRIPTION
[0057] The following is a clear and complete description of the technical solutions in the embodiments of this application. Obviously, the embodiments described are only part of the embodiments of this application, not all of them. Based on the embodiments of this application, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of this application.
[0058] In this document, the term "comprising" is intended to encompass non-exclusive inclusion, such that a process, method, article, or apparatus that includes a list of elements includes not only those elements but also other elements not explicitly listed, or elements inherent to such process, method, article, or apparatus. In the absence of further limitations, an element defined by the phrase "comprising..." does not preclude the presence of additional identical elements in the process, method, article, or apparatus that includes the element.
[0059] This embodiment provides a Figure 1 The following auxiliary methods are shown for the diagnosis and treatment of cardiovascular complications of gestational diabetes, including:
[0060] S1-Collect umbilical vein endothelial cell (HUVEC) samples from patients with gestational diabetes;
[0061] S2-Detect the expression levels of miR-584-5p, PTEN gene and its downstream PINK1 protein in umbilical vein endothelial cell samples, and simultaneously detect mitophagy-related indicators. Mitophagy-related indicators include at least the expression levels of PINK1 / Parkin pathway proteins LAMP2 and ATG12;
[0062] S3- Combined with clinical indicators, the risk of cardiovascular complications in the offspring of patients with gestational diabetes is assessed based on the expression level of miR-584-5p, the expression level of the PTEN gene and its downstream PINK1 protein, and related indicators. Based on the evaluation results, auxiliary suggestions centered on regulating the PTEN / PINK1 / Parkin pathway are provided.
[0063] Specifically, the acquisition of umbilical vein endothelial cell samples includes:
[0064] S11 - Under sterile conditions, remove a 15-20 cm piece of neonatal umbilical cord. In a clean bench, cut off any clamp marks and hematoma at both ends of the cord and trim the cross section. Gently insert a 17G flat-blade needle into the umbilical vein and secure it with a hemostat. Connect the other end of the needle to a 20 mL syringe and flush the umbilical vein with 37°C preheated PBS until the effluent is colorless and transparent.
[0065] S12-Inject 0.125% pancreatic enzyme solution preheated at 37°C to flush out the remaining PBS in the umbilical vein, clamp the blood vessel with a hemostat, continue to inject pancreatic enzyme solution until the umbilical vein is full, and digest at 37°C for 8 minutes;
[0066] S13-Wrap the umbilical cord with sterile gauze and gently rub it for 1-2 minutes to promote the detachment of umbilical vein endothelial cells from the tube wall. Collect the digestion fluid in a centrifuge tube, rinse the umbilical vein with M199 culture medium containing 20% FBS, and collect it in a centrifuge tube. After collecting the digestion fluid, centrifuge (1000rpm, 10min), discard the supernatant, add 37°C preheated M199 complete culture medium containing 20% fetal bovine serum, 5ng / mL fibroblast growth factor, 0.25mg / mL heparin, 100U / mL penicillin and 100U / mL streptomycin, pipet and mix well to make 1×10 6 / mL cell suspension;
[0067] S14 - Inoculate the cell suspension into a culture flask and incubate at 37°C, 5% CO2. Change the culture medium after 18 hours, and then every 1-2 days until the cells reach 80% confluency. When the endothelial cells reach 80% confluency, subculture them and inoculate them into new culture flasks at a ratio of 1:3. Incubate in a cell culture incubator. Cells from passages 3-6 (P3-P6) are used as umbilical vein endothelial cell samples.
[0068] In order to compare the phenotypic differences of HUVECs in the GDM group and the normal group, this example evaluated endothelial cell function in terms of cell migration, angiogenesis, apoptosis, and cell viability. Twenty-four GDM patients and 22 healthy controls were included. Table 1 lists the general information of the two groups of subjects.
[0069] Table 1 - Clinical characteristics of normal and GMD pregnancies
[0070] GDM group (GDM), 24 cases Healthy control group (Non-GDM), 22 cases Maternal age (years) 31.57±3.90 31.22±3.91 BMI index (kg / m2) 27.28±3.25 23.65±2.22 Fasting blood glucose (mmol / L) 5.00±0.77 <5.1 Blood glucose 1 hour after meal (mmol / L) 11.11±1.51 <10.1 Blood glucose 2 hours after meal (mmol / L) 9.61±2.24 <8.6 Maternal HbA1c (%) 5.98±0.41 NA Maternal HbA1c range (%) 5.11~6.53 NA Gestational age (weeks) 38.73±1.24 38.80±1.23 Sex of newborns (% male) 50 59 Birth weight (kg) 3.33±0.37 3.31±0.35
[0071] in:
[0072] The specific steps of cell migration were as follows: endothelial cells from the GDM group and the healthy control group in the logarithmic growth phase were inoculated into cell migration chambers (ibidi, 81176) at a density of 4×10 5 / ml, inoculate 70 μl in each chamber, culture in an incubator overnight, remove the insert (Culture-Insert), and a 500 μm wide "gap" area will be generated. Observe and take photos at 0 h and 10 h respectively under a microscope, and calculate the area of the scratch using ImageJ software. Figure 2 Schematic diagram of cell migration control. Figure 2 In the figure, Part A shows the endothelial cell scratch test; Part B shows the percentage of wound healing area. As can be seen from the figure, compared to the healthy control group, the percentage of HUVEC cells repopulating the scratch area 10 hours after scratching was significantly lower in the GDM group, suggesting that the cell migration ability of GDM-HUVEC is significantly weaker than that of normal HUVEC.
[0073] The specific steps of the tube forming experiment are as follows: TM , 354230) was melted on ice and spread on the lower well of a pre-cooled angiogenesis slide (ibidi, μ-Slide AngiogenesisibiTreat, 81506), 10 μl Matrigel / well; after standing in the incubator for 30 minutes to allow gelation, 50 μl endothelial cell suspension (2×10 5 / ml, serum-free medium) was added to the upper well of the slide and cultured in the incubator; after 16 h of tube formation, the old medium was removed, and 50 μl of Calcein AM (1 mM) diluted with serum-free medium to a final concentration of 2 μM was added, and incubated at room temperature in the dark for 20 min; washed three times with PBS, observed using a fluorescence microscope (Leica DMi8), images were collected, and the tubule length was calculated using Image J software. Figure 3 This is a comparison diagram of the tube forming experiment results. Figure 3In the figure, Part A shows the extent of HUVEC tube formation on growth factor-reduced Matrigel by Ca-AM staining; Part B shows the total length. As can be seen from the figure, when HUVEC from the GDM and normal groups were plated on growth factor-reduced Matrigel, the total length of the tube-like structures photographed and counted 16 hours later was only 75% of that in the control group, indicating that the ability of endothelial cells to form tubes is reduced in GDM.
[0074] The specific steps of cell apoptosis detection are as follows:
[0075] Dilute 10× Binding Buffer to 1× Binding Buffer with deionized water; collect endothelial cells by digestion with EDTA-free trypsin; wash cells once with pre-chilled PBS; add 5μl Annexin V-FITC (AlphaApplied Bioscience, A21005) and 10μl PI to 85μl Binding Buffer, suspend cells in 100μl staining solution, and incubate at room temperature in the dark for 15 minutes; add 300μl 1× Binding Buffer to each system, and detect by flow cytometry (BD FACSCanto).
[0076] Caspase 3 activity analysis: pNA (10 mM) was diluted sequentially to 0, 10, 20, 50, 100, and 200 μM standards. 100 μl of each concentration was measured using a microplate reader to measure the absorbance (OD value) at 405 nm, and a standard curve of pNA concentration versus OD value was drawn. The cell culture medium was aspirated and set aside. Endothelial cells were trypsinized and collected into the reserved cell culture medium. The cells were collected by centrifugation, the supernatant was carefully aspirated, and the cells were washed once with PBS. Each 2 × 10 6 The cells were added with 100 μl of lysis buffer and lysed on ice for 15 min. The reaction system was prepared as follows: 40 μl of sample, 50 μl of detection buffer, 10 μl of Ac-DEVD-pNA (2 mM), 10 μl, a total of 100 μl, and incubated at 37°C for 60 min. The cells were analyzed using a microplate reader (Thermo Scientific). TM Multiskan TM The absorbance (OD value) at 405 nm was measured by GO, which is the absorbance of pNA produced by caspase 3. The amount of pNA produced in the sample was calculated using a standard curve. The protein concentration of the sample was also determined by the Bradford method, from which the caspase 3 enzyme activity units per unit weight of protein in the sample were calculated. Figure 4 This is a schematic diagram of cell viability control. It can be seen that there is no significant difference between the GDM group and the healthy control group.
[0077] The specific steps of cell activity are as follows: inoculate the cell suspension in a 96-well plate at a density of 5×10 3 / well; after overnight culture in the incubator, 1 / 10 volume of CCK8 solution was added to each well; the cells were incubated in the incubator for another 1 hour, and the absorbance (OD value) at 450 nm was measured using a microplate reader to calculate the relative changes in endothelial cells between the GDM group and the healthy control group. Figure 5 This is a schematic diagram of the cell viability assay control. Part A shows the distribution of the two colors using Annexin V-FITC / PI fluorescence staining and flow cytometry; Part B shows the proportion of early and late apoptosis; and Part C shows the detection of apoptosis using Caspase 3 fluorescence staining. As can be seen, there were no significant differences between the healthy control group and the GDM group in either the early apoptosis rate (Annexin V+ / PI-) or the late apoptosis rate (Annexin V+ / PI+). Similarly, Caspase 3 activity assays showed no statistically significant difference between the two groups.
[0078] The observation of endothelial cell mitochondrial morphology and functional testing involves the following:
[0079] 1. Transmission Electron Microscopy: Primary endothelial cells in logarithmic growth phase were collected and plated on the bottom of a 1.5 ml EP tube. Fixation was performed with 1 ml of 2.5% glutaric acid at room temperature for 2 h and then at 4°C overnight. Rinse with PBS for 20 min and dehydrate in a gradient of acetone. Tissues were conventionally coated with epoxy resin and then oven-heated to polymerize and harden, forming embedded blocks. Sections were carefully adjusted, including the water level and light position, heating current, and sectioning speed. Sections were then placed on a support film-lined grid. Paraffin was dissolved in a clean Petri dish to create a vinegar plate. Several drops of staining solution were then applied to the wax plate. Grasp the edge of the grid with tweezers and place it, section-side down, so that the grid floated on the droplet. Cover the Petri dish and stain for 10–20 min. After removing the grid from the staining solution, rinse it with distilled water as soon as possible. Mitochondrial morphology and ultrastructure were observed using a transmission electron microscope (JEOL, Tokyo, Japan). Figure 6 This is a schematic diagram of mitochondrial structure observed under transmission electron microscopy. In the figure, the red arrows indicate the mitochondrial morphology observed under transmission electron microscopy. Based on the diagram, it can be seen that the mitochondria in the healthy control group (Non-GDM) HUVEC cells mostly have a clear double membrane structure and continuous and neatly arranged mitochondrial cristae. In contrast, the mitochondria in the GDM group (GDM) HUVEC cells have mitochondrial structural abnormalities such as swollen mitochondria, unclear membrane structure, broken mitochondrial cristae, and internal vacuoles (*).
[0080] 2. Immunofluorescence staining - 3×10 4Endothelial cells were seeded into 35 mm confocal culture dishes and cultured overnight. The old culture medium was removed, the cells were washed once with PBS, and pre-prepared MitoTracker Red (Invitrogen, M7521) working solution (100 nM) was added. The cells were incubated at 37°C in the dark for 30 min. The staining solution was removed, the cells were washed twice with PBS, and the mitochondrial morphology was observed using a laser confocal microscope (Leica SP8) and images were collected. Figure 7 The figure is a schematic diagram of the comparison of mitochondrial morphology staining results. It can be seen that when observing mitochondrial fission and fusion under a fluorescence microscope, the mitochondria in the healthy control group (Non-GDM) are mostly in a filamentous fusion state, while in the GDM group, the HUVEC endothelial cells are more likely to be in a fragmented separation state.
[0081] 3. Mitochondrial membrane potential detection - Prepare cell suspension with HBSS (containing Ca2+) buffer and adjust the cell density to 10 6 / ml; prepare TMRM (Sigma, T668) staining working solution with a final concentration of 200 nM, take 200 μl of the working solution and mix with an equal volume of cell suspension, incubate at 37°C in the dark for 20 min; wash once with HBSS (containing Ca2+), resuspend the cells in 300 μl of buffer, and detect the mean fluorescence intensity (excitation / emission: 488 / 575 nm) by flow cytometry. Figure 8 This is a schematic diagram of mitochondrial membrane potential control. Based on the diagram, it can be seen that compared with the healthy control group, the mitochondrial membrane potential of the GDM group was significantly reduced, and the loss of mitochondrial membrane potential is an early manifestation of mitochondrial damage.
[0082] 4. Mitochondrial reactive oxygen species (MitoSOX) detection - Prepare 5 μM MitoSOX (Invitrogen, M36008) working solution with HBSS (containing Ca2+) buffer; 4 Endothelial cells were seeded into 35 mm confocal culture dishes. After overnight culture, the old culture medium was removed, the cells were washed once with PBS, and the pre-prepared staining solution was added. The cells were incubated at 37°C in the dark for 20 min. The staining solution was removed, and the cells were washed twice with HBSS (containing Ca2+). The cells were observed and images were collected using a fluorescence microscope (Leica DMi8) (excitation / emission 510 / 580 nm). The average fluorescence intensity was calculated for analysis. Figure 9 Schematic diagram of mitochondrial superoxide production control. Figure 9 Part A shows the specific binding of MitoSox dye to mitochondrial superoxide, and Part B shows the quantitative statistical graph of mean fluorescence intensity. Based on the graph, it can be seen that the superoxide content in the mitochondria of HUVEC in the GDM group was higher than that in the healthy control group, and there was also a significant difference between the two groups.
[0083] 5. ATP test - remove the culture medium and test every 10 6 ATP Assay Buffer (BioVision, K354) was added to 100 μl of lysis buffer per 100 cells. Cells were lysed on ice for 15 minutes, and the protein in the lysate was removed. 1 mM ATP standard was diluted sequentially to 50 μl per well, containing 0, 2, 4, 6, 8, and 10 nmol ATP. For each sample, 50 μl of ATP assay working solution was prepared as follows: 44 μl ATP Assay Buffer + 2 μl ATP Probe + 2 μl ATP Converter + 2 μl Developer. 50 μl of sample and 50 μl of working solution were placed in a 96-well plate and incubated in the dark for 30 minutes at room temperature. The absorbance (OD) at 570 nm was measured using a microplate reader. The amount of ATP in the sample was calculated using the standard curve. Protein concentration was also determined using the BCA assay. Results are presented as nmol ATP / mg protein. Figure 10 This is a schematic diagram of ATP content control. Based on the diagram, it can be seen that the level of ATP in HUVECs in the GDM group is significantly lower than that in the healthy control group, further indicating that the mitochondrial function of HUVECs in the GDM group is abnormal.
[0084] The above results of endothelial cell mitochondrial morphological observation and functional testing indicate that HUVEC mitochondrial structure and function are abnormal in GDM. These abnormalities are primarily manifested in the destruction of normal mitochondrial structure, loss of mitochondrial membrane potential, increased mitochondrial superoxide production, and decreased ATP production, providing direct evidence of mitochondrial damage in GDM HUVEC. Following mitochondrial damage, increased intramitochondrial ROS can ultimately lead to endothelial cell dysfunction through activation of polyols, glycosylation, PKC, and hexosamine pathways, as well as direct inhibition of endothelial nitric oxide synthase and prostacyclin synthase activities.
[0085] Because their DNA lacks histone protection and their repair mechanisms are imperfect, mitochondria are vulnerable to attack by free radicals (Reactive Oxygen Species, ROS) generated by exogenous or endogenous metabolism, or to damage caused by other stresses. Mitochondrial damage can lead to membrane permeability transition (MPT), uncoupling of oxidative phosphorylation, and excessive ATP consumption, triggering cell necrosis. Alternatively, mitochondrial swelling can lead to the release of cytochrome c into the cytoplasm, triggering apoptosis. Timely removal of damaged mitochondria to maintain their quantity and quality is crucial for normal cell growth and metabolism. Therefore, miRNA sequencing is needed to understand the role of mitophagy in mitochondrial dysfunction.
[0086] The specific steps of miRNA sequencing are as follows:
[0087] 1. RNA Extraction: Total RNA was extracted using Trizol reagent (Invitrogen), and miRNAs were extracted using the miRNeasy Mini Kit (Qiagen). Purity was assessed by OD260 / OD280, and quantification was performed based on OD260 values.
[0088] 2. Quantitative RT-PCR using PrimeScript TM cDNA was synthesized by reverse transcription using the RTreagent Kit (Perfect RealTime). qPCR was performed using the SYBR Green method using the CFX96 Real-Time PCR System (Bio-Rad). Finally, selected genes were analyzed using the ΔΔCT method.
[0089] 1) Reverse transcription
[0090] Prepare miRNA and mRNA reverse transcription mixed reaction solutions according to the components in Tables 2 and 3 (the reaction solutions were prepared on ice).
[0091] Table 2 - Configuration of miRNAs reverse transcription mixed reaction solution
[0092]
[0093] Table 3 - mRNA reverse transcription mixed reaction solution configuration table
[0094]
[0095] The reaction conditions were as follows: 37°C for 15 min (reverse transcription reaction), 85°C for 5 s (reverse transcriptase inactivation reaction), and storage at 4°C.
[0096] 2) Quantitative RT-PCR
[0097] The reverse transcription products were prepared into a Quantitative RT-PCR reaction mixture according to Table 4 below (the reaction mixture was prepared on ice).
[0098] Table 4 - Quantitative RT-PCR reaction mixture configuration
[0099]
[0100] The reaction conditions were as follows: Step 1: 95°C for 30 s; Step 2: PCR, GOTO: 39 (40 cycles), 95°C for 5 s, 60°C for 30 s; Step 3: Melt Curve.
[0101] 3) Primers are shown in Table 5 below.
[0102] Table 5 Primer sequences
[0103] Gene Forward Primer Reverse Primer miR126 TCGTCTGTCGTACCGTGAGTAAT TATGGTTGTTCACGACTCCTTCAC miR146a TGCCGCTGAGAACTGAATT CAGAGCAGGGTCCGAGGTA miR7974 GCTACGAATAGGCTGTGATGCT TATGGTTGTTCACGACTCCTTCAC miR128-1-5p GCAACTATCGGGGCCGTA TATGGTTGTTCACGACTCCTTCAC miR222-5p GATGCTCTCTCAGTAGCCAGTGTA TATGGTTGTTCTGCTCTCTGTCTC miR584-5p GATGCTCCTTATGGTTTGCCT TATGGTTGTTCACGACTCCTTCAC miR130b-3p ACTCGCAGTGCAATGATGAA TATGGTTGTTCTGCTCTCTGTCTC miR29b-3p CAGACCTGTAGCACCATTTGAA TATCCTTGTTCACGACTCCTTCAC miR320a TGATCTCAAAAAGCTGGGTTGA TATGGTTGTTCACGACTCCTTCAC miR221-3p GATGCTCTAAGCTACATTGTCTGC TATGGTTGTTCTGCTCTCTGTCTC U6 ATTGGAACGATACAGAGAAGATT GGAACGCTTCACGAATTTG PTEN TTTGAAGACCATAACCCACCAC ATTACACCAGTTCGTCCCTTTC PINK1 GGAGGAGTATCTGATAGGGCAG AACCCGGTGCTCTTTGTCAC GAPDH CATGAGAAGTATGACAACAGCCT AGTCCTTCCACGATACCAAAGT
[0104] 3. Cell transfection: 24 h before transfection, trypsinize the cells and count them. 1.5×10 cells per well of a 6-well plate was used. 5 The cells were plated at a density of 70-80% at the time of transfection in 1.8 ml of normal growth medium without antibiotics. 3 μl of miRNA mimics (20 μM), 10 μl of miRNA inhibitor (20 μM) or 6 μl of RNAiMAX, incubate at room temperature for 5 minutes; RNAiMAX was mixed and incubated at room temperature for 20 min. RNAiMAX (or inhibitor- Add the RNAiMAX mixture to the culture wells containing cells and 1.8 ml of culture medium and mix gently. Continue culturing for 6-8 hours and replace with complete culture medium. Perform subsequent experiments 24 or 48 hours after transfection.
[0105] Based on the above, in this embodiment, the detection of the expression level of miR-584-5p specifically includes:
[0106] S211-miRNA sequencing technology was used to screen differentially expressed miRNAs, with the screening conditions being fold difference FC>1.5, p<0.05, and TPM>10;
[0107] S212-Real-time quantitative PCR (qPCR) verification was performed, and the relative expression level was calculated by the ΔΔCT method using U6 snRNA as the internal reference, wherein the qPCR primer sequence of miR-584-5p was:
[0108] Forward primer: 5'-GATGCTCCTTATGGTTT GCCT-3',
[0109] Reverse primer: 5′-TATGGTT GTTCACGACTCCTTCAC-3′.
[0110] Based on the results obtained from miRNA sequencing, it was found that overexpression of miR-584-5p can significantly inhibit the expression of PTEN and reduce the luciferase activity of the pEZX-PTEN wild-type plasmid. However, after mutating the core binding site, miR-584-5p cannot inhibit the expression of PTEN (i.e., the luciferase activity of the mutant plasmid is restored), indicating that PTEN is a target gene of miR-584-5p. In this embodiment, the detection of the PTEN gene and protein expression levels specifically includes:
[0111] S221-mRNA level detection: Total RNA was extracted from the umbilical vein endothelial cell sample and detected by qPCR method, using GAPDH as the internal reference, wherein the PTEN qPCR primer sequence is:
[0112] Forward primer: 5'-TTTGAAGACCATAACCC ACCAC-3',
[0113] Reverse primer: 5′-ATTACACCAGTTCGTCCCTTTC-3′;
[0114] S222 protein level assay: Western blot analysis was performed. Total cellular protein was extracted using the following steps: RIPA protein lysis buffer containing cocktail and PMSF was prepared in advance; the old culture medium was removed and the cells were washed twice with pre-chilled PBS; an appropriate volume of lysis buffer was added based on the cell number; the lysate was collected and placed on ice for 15 minutes; the cells were centrifuged at 14,000 rpm at 4°C for 20 minutes, and the supernatant was transferred to a fresh EP tube to obtain total cellular protein. Protein concentration was determined by the BCA assay: 20 μl of each appropriately diluted sample and BSA standard were added to a 96-well plate; a reaction mixture was prepared at a ratio of 50:1 between solution A and solution B, and 200 μl of the reaction mixture was added to each well; the reaction mixture was incubated at 37°C for 30 minutes, and the absorbance (OD) at 562 nm was measured using a microplate reader. Protein concentration was calculated based on the standard curve. After total protein extraction, the cells were subjected to SDS-PAGE electrophoresis and transferred to a membrane. PTEN protein expression was analyzed by chemiluminescence imaging using GAPDH as an internal control.
[0115] Furthermore, the expression level of the PINK1 protein and the detection of the mitophagy-related indicators are detected by Western blot method, which specifically includes:
[0116] After total protein extraction from S231-cells, protein concentration was determined by BCA assay;
[0117] S232-Select appropriate SDS-PAGE gel, voltage and current conditions according to the molecular weight of the target band, perform SDS-PAGE electrophoresis to separate the protein, transfer the membrane at a constant flow, and after transfer, block the PVDF membrane with 5% skim milk powder at room temperature for 1 hour, incubate with specific primary antibodies (PINK1 antibody, LAMP2 antibody, ATG12 antibody) and secondary antibodies in sequence, incubate the primary antibody at 4°C overnight, and incubate the secondary antibody at room temperature for 2 hours. Use a chemiluminescence imager to develop and analyze the grayscale value of the protein bands.
[0118] Figure 11 This is a schematic diagram showing the control results of PINK1 protein expression level detection. Figure 11 In the figure, Part A shows PINK1 protein expression; Part B shows the relative quantitative statistical graph of protein expression; and Part C shows the relative mRNA concentration of PINK. The figure shows that both PINK1 protein and mRNA levels in the GDM group were lower than those in the normal control group. The decrease in PINK1 suggests that the loss of mitochondrial membrane potential in GDM does not activate mitophagy.
[0119] The results of linear regression correlation analysis showed that the linear fitting degree of fasting blood glucose in the second trimester and the expression of PTEN protein was high, and there was a clear negative correlation (R = -0.7209, P = 0.0187). HbA1c also had a negative correlation trend with the expression of PTEN protein (R = -0.5969, P = 0.0685). Therefore, the corresponding indicators need to be taken into account in the clinical indicators. In this embodiment, the clinical indicators include: pre-pregnancy body mass index (BMI), fasting blood glucose value (FPG), oral glucose tolerance test 2-hour blood glucose value (OGTT-2h) and glycosylated hemoglobin value (HbA1c), among which:
[0120] The calculation formula of the pre-pregnancy body mass index is: TZ 孕前体重 is the weight before pregnancy, measured by medical electronic scale, SG 身高 is height, obtained by a stadiometer;
[0121] The fasting blood glucose value and the 2-hour blood glucose value after the oral glucose tolerance test are determined by the glucose oxidase method, and the glycosylated hemoglobin value is determined by the high-pressure liquid chromatography method.
[0122] As a preferred implementation of this embodiment, the assessment of the risk of cardiovascular complications specifically includes:
[0123] S31-Calculate the risk score. The risk score is calculated using the following formula:
[0124] F=a×ZData miR-584-5p +b×(ZData miR-584-5p ×ZDataPTEN蛋白表达量 )
[0125] -c×ZData PTEN蛋白表达量 -d×(ZData PTEN蛋白表达量 ×ZData PINK1蛋白表达量 )
[0126] -e×ZData PINK1蛋白表达量 +f×ZData BMI +g×ZData FPG +h×ZData OGTT-2h
[0127] +j×ZData HbA1c
[0128] Among them, F is the calculated risk score, ZData miR-584-5p is the relative expression level of miR-584-5p after Z-score normalization; ZData PTEN蛋白表达量 is the PTEN protein expression after Z-score normalization; ZData PINK1蛋白表达量 is the PINK1 protein expression level after Z-score normalization; ZData BMI is the pre-pregnancy body mass index after Z-score standardization; ZData FPG is the fasting blood glucose value after Z-score standardization; ZData OGTT-2h ZData is the blood glucose value after 2 hours of oral glucose tolerance test after Z-score standardization; HbA1c is the glycated hemoglobin value after Z-score standardization, a, b, c, d, e, f, g, h, and j are the regression coefficients of each indicator, which are obtained by multivariate linear regression analysis of historical data of patients with gestational diabetes mellitus. The historical data include the test values of the above indicators and the clinical diagnosis results of whether cardiovascular complications occur. The Z-score standardization formula is: ZData i Data is the value of an indicator (including the aforementioned relative expression of miR-584-5p, PTEN protein expression, PINK1 protein expression, pre-pregnancy body mass index, fasting blood glucose value, oral glucose tolerance test 2-hour blood glucose value and glycosylated hemoglobin value) after Z-score standardization. i is the original value of the indicator, is the mean value of the index in the umbilical vein endothelial cell samples, and S is the standard deviation of the index in the umbilical vein endothelial cell samples;
[0129] S32-If the calculated risk score F ≥ F 阈值, the risk of cardiovascular complications is assessed as high risk. If the calculated risk score F<F 阈值 , the risk of cardiovascular complications is assessed as low risk; F 阈值 is the preset risk score threshold.
[0130] It should be noted that the calculation of risk scores provides quantitative assistance for the diagnosis and treatment of complication risks, thereby improving the efficiency of judging the risk of cardiovascular complications in gestational diabetes.
[0131] The risk score threshold is determined by maximizing the Youden index of the ROC curve. That is, the ROC curve is analyzed and the value at which the Youden index is maximized is used as the corresponding risk score threshold.
[0132] Considering that the risk associated with gestational diabetes may change with increasing gestational age, in a preferred embodiment, the risk score is further optimized by an optimization mechanism, and the optimized risk score is used as the basis for determining the risk level. The optimization mechanism specifically introduces gestational age data to optimize the initially calculated risk score. The optimized risk score is specifically:
[0133] F'=F+k×T 孕周
[0134] Among them, T 孕周 is the gestational age; k is the regression coefficient corresponding to the gestational age index.
[0135] Among them, F' is the calculated optimized risk score, T 孕周 is the gestational age, is the gestational age corresponding to the end of the patient's pregnancy; k is the regression coefficient corresponding to the gestational age index.
[0136] At this time, if the calculated optimized risk score F'≥F 阈值 , the risk of cardiovascular complications is assessed as high risk. If the calculated optimized risk score F'<F 阈值 , the risk of cardiovascular complications is assessed as low. Considering that the impact of patient indicators on complications may increase with increasing gestational age in late pregnancy, incorporating gestational age as a time variable into risk assessment improves the accuracy of diagnosis and treatment of cardiovascular complications of gestational diabetes, thus enabling a more dynamic risk assessment of cardiovascular complications in patients with gestational diabetes.
[0137] In summary, the auxiliary method for the diagnosis and treatment of cardiovascular complications of gestational diabetes in this embodiment, by detecting the expression levels of miR-584-5p, PTEN, PINK1 and mitochondrial autophagy-related proteins (LAMP2, ATG12) in umbilical vein endothelial cells, achieves a multi-level and accurate assessment of the pathogenesis of cardiovascular complications in GDM offspring, breaks through the limitations of traditional single indicator detection, and provides molecular-level evidence for the early detection of endothelial cell dysfunction; by combining clinical indicators such as pre-pregnancy body mass index, fasting blood glucose, and glycated hemoglobin for risk assessment, it achieves a quantitative prediction of the risk of cardiovascular complications, solves the problem of lack of mechanism association in existing assessment methods, and makes risk judgment more scientific and targeted.
[0138] In the embodiments provided herein, it should be understood that the embodiments described herein can be implemented in hardware, software, firmware, middleware, code, or any appropriate combination thereof. For hardware implementation, the processor can be implemented in one or more of the following units: an application-specific integrated circuit (ASIC), a digital signal processor (DSP), a digital signal processing device (DSPD), a programmable logic device (PLD), a field programmable gate array (FPGA), a processor, a controller, a microcontroller, a microprocessor, other electronic units designed to implement the functions described herein, or a combination thereof. For software implementation, part or all of the processes of the embodiments can be completed by instructing the relevant hardware through a computer program. When implemented, the above program can be stored in a computer-readable storage medium or transmitted as one or more instructions or codes on a computer-readable storage medium. Computer-readable storage media include computer storage media and communication media, wherein the communication media include any medium that facilitates the transmission of a computer program from one place to another. The storage medium can be any available medium that a computer can access. The computer-readable storage medium can include, but is not limited to, RAM, ROM, EEPROM, CD-ROM or other optical disk storage, magnetic disk storage media or other magnetic storage devices, or any other medium that can be used to carry or store the desired program code in the form of instructions or data structures and can be accessed by a computer.
[0139] Finally, it should be noted that the above is only a preferred embodiment of the present application and is not intended to limit the present application. Although the present application has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or make equivalent replacements for some of the technical features therein. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present application should be included in the scope of protection of the present application.
Claims
1. A method for assisting diagnosis and treatment of cardiovascular complications of gestational diabetes, characterized in that: The method comprises the following steps: S1-Collection of umbilical vein endothelial cell samples from patients with gestational diabetes; S2-Detecting the expression level of miR-584-5p, the expression level of the PTEN gene and its downstream PINK1 protein in the umbilical vein endothelial cell sample, and detecting mitophagy-related indicators, wherein the mitophagy-related indicators at least include: the expression levels of PINK1 / Parkin pathway proteins LAMP2 and ATG12; S3-Combined with clinical indicators, the risk of cardiovascular complications in the offspring of patients with gestational diabetes is assessed based on the expression level of the miR-584-5p, the expression level of the PTEN gene and its downstream PINK1 protein, and the related indicators.
2. The auxiliary method for diagnosis and treatment of cardiovascular complications of gestational diabetes mellitus according to claim 1, characterized in that: The acquisition of the umbilical vein endothelial cell sample specifically includes: S11-Under sterile conditions, remove a 15-20 cm piece of neonatal umbilical cord and flush the umbilical vein with 37°C preheated PBS until the outflowing fluid is colorless and transparent; S12-inject 0.125% pancreatin solution and digest at 37°C for 8 minutes; S13-Collect the digestion solution and centrifuge, discard the supernatant, add M199 complete medium containing 20% fetal bovine serum, 5ng / mL fibroblast growth factor, 0.25mg / mL heparin, 100U / mL penicillin and 100U / mL streptomycin to make 1×10 6 / mL cell suspension; S14 - The cell suspension is inoculated into a culture flask, and cultured at 37° C. and 5% CO 2 until the cell confluence reaches 80%. Cells at passages 3 to 6 are taken as the umbilical vein endothelial cell samples.
3. The auxiliary method for diagnosis and treatment of cardiovascular complications of gestational diabetes mellitus according to claim 2, characterized in that: The detection of the expression level of miR-584-5p specifically includes: S211-miRNA sequencing technology was used to screen differentially expressed miRNAs, with the screening conditions being fold difference FC>1.5, p<0.05, and TPM>10; S212-Real-time quantitative PCR was used to verify the relative expression of miR-584-5p using U6snRNA as an internal reference and the ΔΔCT method. The qPCR primer sequences for miR-584-5p were as follows: Forward primer: 5'-GATGCTCCTTATGGTTT GCCT-3', Reverse primer: 5′-TATGGTT GTTCACGACTCCTTCAC-3′.
4. The auxiliary method for diagnosis and treatment of cardiovascular complications of gestational diabetes mellitus according to claim 3, characterized in that: The detection of PTEN gene and protein expression levels specifically includes: S221-mRNA level detection: Total RNA was extracted from the umbilical vein endothelial cell sample and detected by qPCR method, using GAPDH as the internal reference, wherein the PTEN qPCR primer sequence is: Forward primer: 5'-TTTGAAGACCATAACCC ACCAC-3', Reverse primer: 5′-ATTACACCAGTTCGTCCCTTTC-3′; S222-Protein level detection: Western blot was used to extract total protein, followed by SDS-PAGE electrophoresis and membrane transfer; GAPDH was used as an internal reference, and the relative expression of PTEN protein was analyzed by chemiluminescence imaging.
5. The auxiliary method for diagnosis and treatment of cardiovascular complications of gestational diabetes mellitus according to claim 4, characterized in that: The expression level of the PINK1 protein and the detection of the mitophagy-related indicators were detected by Western blot, which specifically included: After total protein extraction from S231-cells, protein concentration was determined by BCA assay; S232- Perform SDS-PAGE electrophoresis to separate proteins. After transfer, block the PVDF membrane with 5% skim milk powder, incubate with specific primary and secondary antibodies in sequence, and develop and analyze the grayscale value of the protein bands using a chemiluminescence imager.
6. The auxiliary method for diagnosis and treatment of cardiovascular complications of gestational diabetes mellitus according to any one of claims 1 to 5, characterized in that: The clinical indicators include: pre-pregnancy body mass index, fasting blood glucose level, 2-hour blood glucose level after oral glucose tolerance test, and glycosylated hemoglobin level, among which: The calculation formula of the pre-pregnancy body mass index is: TZ 孕前体重 is the pre-pregnancy weight, SG 身高 is height; The fasting blood glucose value and the 2-hour blood glucose value after the oral glucose tolerance test are determined by the glucose oxidase method, and the glycosylated hemoglobin value is determined by the high-pressure liquid chromatography method.
7. The auxiliary method for diagnosis and treatment of cardiovascular complications of gestational diabetes mellitus according to claim 1, characterized in that: The assessment of the risk of cardiovascular complications specifically includes: S31-Calculate the risk score. The risk score is calculated using the following formula: F=a×ZData miR-584-5p +b×(ZData miR-584-5p ×ZData PTEN蛋白表达量 ) -c×ZData PTEN蛋白表达量 -d×(ZData PTEN蛋白表达量 ×ZData PINK1蛋白表达量 ) -e×ZData PINK1蛋白表达量 +f×ZData BMI +g×ZData FPG +h×ZData OGTT-2h +j×ZData HbA1c Among them, ZData miR-584-5p is the relative expression level of miR-584-5p after Z-score normalization; ZData PTEN蛋白表达量 is the PTEN protein expression after Z-score normalization; ZData PINK1蛋白表达量 is the PINK1 protein expression level after Z-score normalization; ZData BMI is the pre-pregnancy body mass index after Z-score standardization; ZData FPG is the fasting blood glucose value after Z-score standardization; ZData OGTT-2h ZData is the blood glucose value after 2 hours of oral glucose tolerance test after Z-score standardization; HbA1c is the glycated hemoglobin value after Z-score standardization, a, b, c, d, e, f, g, h, j are the regression coefficients of each indicator; the Z-score standardization formula is: ZData i is the value of an indicator after Z-score standardization, Data i is the original value of the indicator, is the mean value of the index in the umbilical vein endothelial cell samples, and S is the standard deviation of the index in the umbilical vein endothelial cell samples; S32-If the calculated risk score F ≥ F 阈值 , the risk of cardiovascular complications is assessed as high risk. If the calculated risk score F<F 阈值 , the risk of cardiovascular complications is assessed as low risk; F 阈值 is the preset risk score threshold.
8. The auxiliary method for diagnosis and treatment of cardiovascular complications of gestational diabetes mellitus according to claim 7, characterized in that: The risk score is further optimized through an optimization mechanism, and the optimized risk score is used as the basis for risk level determination. The optimization mechanism specifically introduces gestational age data to optimize the initially calculated risk score. The optimized risk score is specifically: F'=F+k×T 孕周 Among them, T 孕周 is the gestational age; k is the regression coefficient corresponding to the gestational age index.
9. The auxiliary method for diagnosis and treatment of cardiovascular complications of gestational diabetes mellitus according to claim 7 or 8, characterized in that: The risk score threshold is determined by maximizing the Youden index of the ROC curve.