Application of Gremlin1 antibody in resisting pulmonary fibrosis

Abstract

The invention belongs to the field of pharmacy, and relates to a medicine for treating pulmonary fibrosis, in particular to application of an anti-Gremlin1 antibody to preparation of a medicine for preventing and treating pulmonary fibrosis. The Gremlin1 antibody disclosed by the invention can be applied to prevention and treatment of pulmonary fibrosis, effectively improves bleomycin (BLM)-induced pulmonary fibrosis lesions of mice and improves the survival rate of the mice. Compared with a BLM group, the mouse inspiration capacity (IC) and the lung static compliance (CRS) treated by the Gremlin1 antibody are remarkably improved, the hydroxyproline content in lung tissue is remarkably reduced, and compared with the BLM group, the Ashcroft score, the collagen deposition area in Masson three-color dyeing and the Sirius red dyeing area of an antibody intervention group are remarkably reduced, and the proportion of activated endothelial cells and the proportion of transition-state epithelial cells are remarkably reduced. Therefore, the Gremlin1 antibody can be used for preparing the medicine for preventing and / or treating the pulmonary fibrosis.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to a new use of Gremlin1 antibodies in preparing drugs for preventing and / or treating pulmonary fibrosis. Background Art

[0002] Idiopathic pulmonary fibrosis (IPF), the most common type of idiopathic interstitial pneumonia, is a chronic, progressive, irreversible, and fatal fibrotic lung disease. Its primary characteristics are alveolar epithelial cell damage, abnormal fibroblast proliferation, and excessive deposition of extracellular matrix proteins, ultimately leading to lung parenchymal destruction, impaired gas exchange, and respiratory failure. In my country, a country with an increasingly aging population, the number of IPF patients is increasing annually, posing a serious threat to public health. Therefore, in-depth research into the pathogenesis and intervention strategies of IPF is crucial for delaying disease progression and improving patient outcomes.

[0003] At present, the clinical treatment strategies for pulmonary fibrosis mainly include anti-fibrotic, anti-inflammatory, immunomodulatory, antioxidant and acid-suppressing drug interventions, as well as lung transplantation for terminal patients. Existing drugs such as pirfenidone and nintedanib can delay disease progression, but they cannot reverse the established fibrosis and are often accompanied by serious toxic side effects, affecting patient compliance and quality of life. Lung transplantation as the ultimate treatment is limited by donor shortages, high surgical risks and heavy economic burdens. Therefore, existing treatments are difficult to meet clinical needs in terms of efficacy and safety. There is an urgent need to further explore the pathogenesis of pulmonary fibrosis, find new therapeutic targets, and develop new anti-pulmonary fibrosis drugs with greater efficacy and higher safety to improve patients' survival and quality of life.

[0004] Gremlin1 is a multifunctional protein containing a cysteine knot and a member of the DAN family. It antagonizes the BMP (bone morphogenetic protein) signaling pathway, preferentially binding to BMP2 and BMP4, inhibiting the phosphorylation of SMAD1 / 5 / 8, thereby blocking downstream signaling. Gremlin1 also plays a crucial role in stem cell niche maintenance, multiple myeloma, and fibrosis in various organs (such as the kidney, liver, eye, and skin). Gremlin1 is significantly upregulated in tissues from patients with idiopathic pulmonary fibrosis (IPF) and in a bleomycin-induced mouse model.

[0005] Currently, there are no reports on the use of Gremlin1 antibodies in the preparation of drugs for preventing and / or treating pulmonary fibrosis. Summary of the Invention

[0006] The object of the present invention is to provide use of Gremlin1 antibodies in the preparation of drugs for preventing and / or treating pulmonary fibrosis.

[0007] The application of the present invention refers to the application in the targeted preparation of drugs for preventing and / or treating pulmonary fibrosis diseases associated with Gremlin1.

[0008] Wherein, the pulmonary fibrosis disease includes idiopathic pulmonary fibrosis and / or pulmonary fibrosis indications.

[0009] Among them, the pulmonary fibrosis diseases include systemic sclerosis-related interstitial lung disease, spontaneous systemic lupus erythematosus interstitial lung disease, rheumatoid arthritis-related interstitial lung disease, inflammation / virus-related interstitial lung disease and tumor-related interstitial lung disease.

[0010] The application of the present invention effectively improves bleomycin (BLM)-induced pulmonary fibrosis and increases the survival rate.

[0011] The application of the present invention refers to a significant increase in inspiratory capacity (IC) and lung static compliance (CRS), and a significant decrease in the hydroxyproline content in lung tissue.

[0012] The application of the present invention refers to a significant decrease in the Ashcroft score, the collagen deposition area (Trichrome area) in Masson trichrome staining, and the Sirius red staining area, and a significant decrease in the proportion of activated endothelial cells and the proportion of transitional epithelial cells.

[0013] The application of the present invention is to reduce the lung function damage caused by BLM, increase collagen deposition, reduce lung tissue structure damage and lung hydroxyproline content, and reduce endothelial cell activation and abnormal differentiation of type II alveolar epithelial cells.

[0014] The application of the present invention is to reduce endothelial cell activation and inhibit alveolar epithelial cell differentiation block;

[0015] Wherein, the drug is a pharmaceutical composition containing Gremlin1 antibody.

[0016] The pharmaceutical composition further includes a pharmaceutically acceptable carrier or excipient.

[0017] The pharmaceutical composition of the present invention can be prepared into any pharmaceutically acceptable dosage form.

[0018] The dosage form of the pharmaceutical combination of the present invention is injection or infusion.

[0019] Among them, injection administration includes: intravenous injection, intramuscular injection, intraperitoneal injection, intradermal injection or subcutaneous intravenous injection.

[0020] Through systematic experimental studies, the present invention found that in an animal model of bleomycin (3U / kg)-induced pulmonary fibrosis in C57BL / 6 mice, anti-Gremlin1 antibodies and isotype IgG antibodies were intravenously injected one day before modeling and 3, 6, 9, 12, 15, and 18 days after modeling. Histopathological and imaging analysis and evaluation of changes in lung inflammation, damage, and fibrosis in mice treated with bleomycin intratracheal instillation revealed that anti-Gremlin1 antibody treatment significantly reduced mortality in mice treated with bleomycin intratracheal instillation; significantly reduced BLM-induced lung function damage, increased collagen deposition, reduced lung tissue structural damage and lung hydroxyproline content, and reduced endothelial cell activation and abnormal differentiation of type II alveolar epithelial cells. The experimental results showed that anti-Gremlin1 antibodies can inhibit bleomycin-induced pulmonary fibrosis, providing good application prospects for the treatment of pulmonary fibrosis.

[0021] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments, which are not to be construed as limiting the present invention. Any equivalent replacements in the art made in accordance with the disclosure of the present invention shall fall within the scope of protection of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Sham: sham operation group; Model: bleomycin model group; aIgG: anti-IgG antibody group; aGremlin1: anti-Gremlin1 antibody group; *P<0.05, **P<0.01 compared with the bleomycin model group.

[0023] Figure 1 Anti-Gremlin1 antibodies restored bleomycin-induced lung function, survival, and hydroxyproline.

[0024] Figure 1 A: Lung function of mice, IC: lung volume; Crs: lung compliance;

[0025] Figure 1 B: Survival rate of mice

[0026] Figure 1 C: Hydroxyproline content in mouse lungs

[0027] Figure 2 Anti-Gremlin1 antibody reduces bleomycin-induced lung inflammation

[0028] Figure 2 A: Typical HE staining of mice

[0029] Figure 2 B: HE staining inflammation score of mice

[0030] Figure 3Anti-Gremlin1 antibody reduces bleomycin-induced lung fibrosis

[0031] Figure 3 A: Massone staining of mouse lungs

[0032] Figure 3 B: Quantitative analysis of Massone staining in mouse lungs

[0033] Figure 4 Anti-Gremlin1 antibody reduces bleomycin-induced fibrotic gene expression

[0034] Figure 4 A: Quantification of Col1a gene in mouse lung tissue

[0035] Figure 4 B: Quantification of Acta2 gene in mouse lung tissue DETAILED DESCRIPTION

[0036] The present invention is further illustrated by the following examples.

[0037] The products and preparation methods described herein are further described below with reference to specific examples, but the present invention is not limited to these examples. Unless otherwise specified, the methods described are conventional methods. Unless otherwise specified, the raw materials described can be obtained from publicly available commercial sources.

[0038] Main reagents and experimental animals

[0039] The anti-Gremlin1 antibody used in the experiment was purchased from ThermoFisher; the anti-IgG antibody was purchased from BioLegend; Bleomycin (BLM) was purchased from Hanhui Pharmaceutical Co., Ltd. (Lot No. 23017711); and the hydroxyproline detection kit was purchased from Nanjing Jiancheng Bioengineering Technology Co., Ltd. SPF-grade C57BL / 6 mice (male, 6-8 weeks, approximately 20 g) were purchased from Beijing Huafukang Laboratory Animal Technology Co., Ltd. Animal husbandry was carried out at the Laboratory Animal Center of the Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences.

[0040] method

[0041] Preparation of pulmonary fibrosis mouse model

[0042] Male C57BL / 6 mice (6-8 weeks old) were fasted overnight and anesthetized with tribromoethanol. Bleomycin (BLM) (dose: 3 U / kg) was injected intratracheally. The anesthetized mouse's upper jaw was placed on a curved wire. With the aid of forceps and a surgical light, the location of the tracheal orifice was observed. A guidewire was used to guide the trocar into the trachea. The guidewire was then removed, and the mouse was fixed vertically on an operating table. A microsyringe was used to inject 50 μL of BLM into the trachea. The operating table was quickly rotated to ensure that BLM evenly entered the lung lobes. The mouse was then placed upright for 5 minutes.

[0043] Pulmonary function tests

[0044] After fasting and anesthesia, mice were intubated. The inspiratory and expiratory airway resistance and lung compliance of the mice were measured using a flexiVent small animal pulmonary function analyzer, and the data were analyzed. For specific steps, please refer to the instrument manual.

[0045] Lung tissue sampling, fixation and staining

[0046] Mouse lung tissue was fixed with 4% paraformaldehyde, dehydrated, embedded in paraffin, and cut into 4-μm sections. Sections were stained with HE and Masson's trichrome. Images were acquired and analyzed using Image J software at 200x magnification. Inflammation and fibrosis scores were calculated. Higher scores indicate greater inflammatory damage and pulmonary fibrosis.

[0047] Hydroxyproline determination

[0048] Weigh the wet weight of the mouse left lung, homogenize, and remove 200 μL of the supernatant. Add 550 μL of hydrolysis solution to a glass test tube, mix, and hydrolyze at 120°C, 0.1 kPa, for 45 minutes. Adjust the pH, bring to volume, treat with activated carbon, and centrifuge to remove the supernatant. Follow the kit instructions and measure the absorbance of each tube. Use the absorbance to calculate the hydroxyproline content. For details, see the Nanjing Jiancheng Hydroxyproline Assay Kit.

[0049] RT-qPCR experiments

[0050] Total RNA was extracted using an RNA extraction kit (Novozymes, RC113-01), and the RNA concentration was determined by NanoDrop2000. Reverse transcription was performed according to the instructions of EasyScript One-Step gDNA Removal and cDNA Synthesis Super Mix (AT311); qPCR was performed according to the instructions of NovoStart SYBR QPCR SuperMix Plus (E096-01A).

[0051] Statistical analysis

[0052] The results in this paper are expressed as mean ± standard deviation (x ± s), and the means between the two groups were compared using Student's t test.

[0053] Example 1. Treatment of Bleomycin-induced Pulmonary Fibrosis Mouse Model with Anti-Gremlin1 Antibody

[0054] Experimental groups

[0055] The experiment was divided into sham-operated groups (Sham), bleomycin-induced model groups (Model), anti-IgG antibody groups (anti-IgG), and anti-Gremlin1 antibody groups (anti-Gremlin1). The day of bleomycin-induced modeling was designated Day 0. The corresponding solvent or antibody was administered at 100 ng / mouse on the day before modeling and on days 3, 6, 9, 12, 15, and 18 after modeling. The experiment was terminated on Day 21. Detailed group design is shown in Table 1.

[0056] Table 1. Experimental design of the effect of anti-Gremlin1 antibody on bleomycin-induced pulmonary fibrosis

[0057]

[0058] Before the end of the experiment, the lung function of mice was measured using tribromoethanol, as shown in Figure 1 As shown in A, the lung volume and lung compliance of the group treated with anti-Gremlin1 antibody were significantly restored. Figure 1 As shown in B, the survival rate of mice in the group treated with anti-Gremlin1 antibody was significantly improved.

[0059] Example 2. Determination of Hydroxyproline in Bleomycin-Induced Pulmonary Fibrosis

[0060] Weigh the wet weight of the left lung of the mouse, take 200 μL of supernatant after homogenization, add 550 μL of hydrolysis solution to a glass test tube, mix well and hydrolyze at 120°C and 0.1 kPa for 45 minutes. Adjust the pH value and make up the volume. After treating with activated carbon, centrifuge and take the supernatant. Follow the instructions of the kit to measure the absorbance value of each tube and use the absorbance value to calculate the hydroxyproline content. For details, see Nanjing Jiancheng Hydroxyproline Determination Kit. Figure 1 As shown in C, the hydroxyproline content in the lung tissue of mice treated with anti-Gremlin1 antibody was significantly decreased.

[0061] Example 3. Pathological and imaging analysis of bleomycin-induced pulmonary fibrosis

[0062] Mouse lung tissue was fixed with 4% paraformaldehyde, dehydrated, embedded in paraffin, and cut into 4-μm sections. Sections were stained with HE and Masson's trichrome. Images were acquired and analyzed using Image J software at 200x magnification. Inflammation and fibrosis scores were calculated. Higher scores indicate greater inflammatory damage and pulmonary fibrosis.

[0063] Lung tissue inflammation grading standard (0-5)

[0064] 0 points: normal lung tissue;

[0065] 1 point: minimal inflammatory changes;

[0066] 2 points: mild to moderate inflammatory changes, but without obvious alveolar structural disorder;

[0067] 3 points: moderate inflammatory damage, with destruction of alveolar structure;

[0068] 4 points: moderate to severe inflammatory damage, localized pneumonia area, and destruction of alveolar structure;

[0069] 5 points: severe inflammatory damage, severe destruction of local lung tissue, closure of the lumen, etc.

[0070] After collecting the pathological films, 5-10 fields of view were randomly selected from each specimen to perform inflammation scoring on the mouse lung tissues, such as Figure 2 As shown in A and B, the inflammation score in the lung tissue of mice treated with anti-Gremlin1 antibodies was significantly reduced, indicating that the inflammation level in the lung tissue of mice was significantly reduced after anti-Gremlin1 antibody treatment.

[0071] 0 points: normal lung tissue;

[0072] 1 point: slight thickening of alveolar or bronchial wall;

[0073] 3 points: moderate thickening of alveolar or bronchial walls, but without obvious alveolar structural disorder;

[0074] 5 points: Alveolar structure is destroyed, and cord-like fibrous bands or small-scale fibrous foci are formed;

[0075] 7 points: The alveolar structure is severely destroyed, with extensive fibrous foci and honeycomb lungs.

[0076] 8 points: fibrotic lesions in the entire field of view.

[0077] 2, 4, and 6 are between the corresponding scores.

[0078] After collecting the pathological slides, use Image J to measure the collagen staining area and the area of lung tissue under the field of view after Masson staining. The relative content of collagen is expressed by the ratio of the staining area to the field of view. 5-10 fields of view are randomly selected for each specimen, and the mean value is used to represent the relative collagen content in the lung tissue of the animal. Figure 3 As shown in A and B, the collagen content in the lung tissue of mice treated with anti-Gremlin1 antibodies was significantly decreased.

[0079] Example 4. Detection of bleomycin-induced pulmonary fibrosis-related gene expression levels using RT-qPCR

[0080] RT-qPCR experiments were performed using total mRNA extracted from lung tissue to detect changes in the transcription levels of Col1a1, Acta2, Krt8, and Grem1 genes in each group. The primers for each gene are as follows:

[0081] Col1a1-F:CCTCAGGGTATTGCTGGACAAC

[0082] Col1a1-R:CAGAAGGACCTTGTTTGCCAGG

[0083] Acta2-F: TGCTGACAGAGGCACCACTGAA

[0084] Acta2-R:CAGTTGTACGTCCAGAGGCATAG

[0085] like Figure 4 As shown in A and B, compared with the model group, the expression levels of Col1a1 and Acta2 genes in the lung tissues of mice treated with anti-Gremlin1 antibodies were significantly decreased.

[0086] The above description is only a preferred embodiment of the present invention. It should be noted that the embodiments of the present invention are not limited to the embodiments described. Without departing from the principles of the present invention, a number of changes, modifications, substitutions, combinations, and simplifications may be made, all of which are equivalent replacement methods and should also be considered as the scope of protection of the present invention.

Claims

1. Use of Gremlin1 antibodies in the preparation of drugs for preventing and / or treating pulmonary fibrosis.

2. The use according to claim 1, characterized in that Application in the targeted preparation of drugs for preventing and / or treating Gremlin1-related pulmonary fibrosis diseases.

3. The use according to claim 1, characterized in that The pulmonary fibrosis disease includes idiopathic pulmonary fibrosis and / or pulmonary fibrosis indications.

4. The use according to claim 3, characterized in that The pulmonary fibrosis diseases include systemic sclerosis-related interstitial lung disease, spontaneous systemic lupus erythematosus interstitial lung disease, rheumatoid arthritis-related interstitial lung disease, inflammation / virus-related interstitial lung disease and tumor-related interstitial lung disease.

5. The use according to any one of claims 1 to 4, characterized in that: The drugs include drugs that reduce endothelial cell activation and inhibit alveolar epithelial cell differentiation.

6. The use according to claim 1, characterized in that The medicine is a pharmaceutical composition containing Gremlin1 antibodies.

7. The use according to claim 1, characterized in that The pharmaceutical composition also includes a pharmaceutically acceptable carrier or excipient.

8. The use according to claim 1, characterized in that The dosage form of the pharmaceutical composition can be any pharmaceutically acceptable dosage form.

9. The application according to claim 8, characterized in that The dosage form of the pharmaceutical composition is injection or infusion.

10. The use according to claim 1, characterized in that It refers to reducing the lung function damage caused by BLM, increasing collagen deposition, reducing lung tissue structure damage and lung hydroxyproline content, and reducing endothelial cell activation and abnormal differentiation of type II alveolar epithelial cells.

Images