An engineered bacterium for producing n-acetyl-trans-4-hydroxyproline and application thereof

Abstract

The application discloses an engineering bacterium for producing N-acetyl-trans-4-hydroxyproline and application thereof and belongs to the technical field of biotechnology.The application realizes fermentation synthesis of N-acetyl-trans-4-hydroxyproline by taking proline as a substrate through mutation of acyltransferase and introduction of exogenous proline-4-hydroxylase.The application has the advantages of low production cost, short fermentation period and high strain stability and has high economic benefits.The recombinant strain constructed by the application can convert 0.5M of proline into 19.64mg / L of N-acetyl-trans-4-hydroxyproline.

Description

Technical Field

[0001] This invention relates to an engineered bacterium for producing N-acetyl-trans-4-hydroxyproline and its applications, belonging to the field of biotechnology. Background Technology

[0002] N-acetyl-trans-4-hydroxyproline is a substance found to inhibit leukocyte infiltration and late-stage connective tissue changes during arthritis. It is considered an effective ingredient for the preparation of analgesic nonsteroidal anti-inflammatory drugs (NSAIDs) to relieve moderate to severe pain. Compared to traditional NSAIDs, this substance has good gastrointestinal tolerability and fewer side effects, thus showing broad medical application prospects. This makes N-acetyl-trans-4-hydroxyproline one of the most promising new NSAIDs in recent years. Its unique biological activity and favorable pharmacological properties provide a new clinical option for relieving pain symptoms.

[0003] Currently, the synthesis of N-acetyl-trans-4-hydroxyproline is achieved through organic synthetic chemical reactions, including the introduction of the proline protecting group, the transformation of the hydroxyl functional group, and precise control of stereochemistry. The chemical synthesis of N-acetyl-trans-4-hydroxyproline faces several challenges. First, the synthetic steps are cumbersome, involving multiple complex reaction steps, requiring highly precise synthetic techniques and operational control. Second, due to the presence of multiple functional groups in the molecule, reaction selectivity becomes an issue, leading to the potential inclusion of multiple isomers in the synthesized product. Furthermore, yield is a challenge, with some chemical reactions yielding low amounts, affecting overall preparation efficiency and increasing time costs. Simultaneously, the synthetic process may involve environmentally unfriendly reagents and conditions, such as the use of organic solvents and substrate modifiers, which does not conform to the principles of green synthesis. In addition, highly precise stereochemical control is required for this type of bioactive substance. To overcome these problems, current research focuses on developing more efficient, environmentally friendly, and high-yield synthetic methods.

[0004] The synthesis of N-acetyl-trans-4-hydroxyproline via bio-fermentation is currently attracting attention, but related research remains in its infancy. The synthesis pathway for N-acetyl-trans-4-hydroxyproline is singular, and the substrate trans-4-hydroxyproline is costly. Currently, the synthesis of trans-4-hydroxyproline is well-established using proline-4-hydroxylase catalysis. However, further research on the catalytic synthesis of N-acetyl-trans-4-hydroxyproline from trans-4-hydroxyproline has encountered a bottleneck. Some studies have shown that acyltransferases derived from Mycobacterium smegma hold promise for converting trans-4-hydroxyproline to N-acetyl-trans-4-hydroxyproline, but the wild-type acyltransferase exhibits extremely low catalytic activity, making it difficult to achieve the production of N-acetyl-trans-4-hydroxyproline.

[0005] Therefore, further modifying the synthetic pathway of N-acetyl-trans-4-hydroxyproline to improve the conversion efficiency from trans-4-hydroxyproline to N-acetyl-trans-4-hydroxyproline, thereby achieving the synthesis of N-acetyl-trans-4-hydroxyproline from the substrate proline, and thus improving the synthesis efficiency and quality of N-acetyl-trans-4-hydroxyproline while reducing costs, is an urgent problem to be solved and has extremely high economic and practical value. Summary of the Invention

[0006] To address the problems of high substrate cost and low conversion efficiency of N-acetyl-trans-4-hydroxyproline in existing technologies, this invention provides an engineered bacterium for producing N-acetyl-trans-4-hydroxyproline using proline and its applications. This invention uses *Escherichia coli* as the starting strain, introducing an acyltransferase gene and proline-4-hydroxylase through genetic engineering. By mutagenesis of the acyltransferase, the engineered *E. coli* strain produces N-acetyl-trans-4-hydroxyproline using proline as a substrate. Furthermore, this invention further mutates the exogenous acyltransferase, increasing the yield of N-acetyl-trans-4-hydroxyproline, providing a reference for the rational design of heterologous metabolic pathways and cell factories for the production of high-value amino acid derivatives in this strain.

[0007] The first objective of this invention is to provide a genetically engineered bacterium that expresses an exogenous acyltransferase and a proline-4-hydroxylase; wherein the amino acid sequence of the exogenous acyltransferase is as shown in SEQ ID NO.1, or the amino acid at position 97 and / or position 154 is mutated based on the amino acid sequence shown in SEQ ID NO.1.

[0008] In one embodiment, the amino acid sequence of the exogenous acyltransferase (MsAcT(S11C)) is as shown in SEQ ID NO.1; or based on the amino acid sequence shown in SEQ ID NO.1, the lysine at position 97 is mutated to alanine (MsAcT(S11C / K97A)); or the phenylalanine at position 154 is mutated to alanine (MsAcT(S11C / F154A)); or based on the lysine at position 97 being mutated to alanine, the phenylalanine at position 154 is further mutated to alanine (MsAcT(S11C / K97A / F154A)).

[0009] In one embodiment, the exogenous acyltransferase MsAcT(S11C) is obtained by mutating the serine at position 11 of the wild-type acyltransferase to cysteine; the amino acid sequence of the wild-type acyltransferase is shown in SEQ ID NO.13, and the nucleotide sequence is shown in SEQ ID NO.14.

[0010] In one embodiment, the exogenous proline-4-hydroxylase can be any type of proline-4-hydroxylase. Optionally, the exogenous proline-4-hydroxylase can be derived from bacteria, actinomycetes, fungi, or fungi such as *Dactylogyrus*. More preferably, the exogenous proline-4-hydroxylase can be derived from *Streptomyces griseoviridus* P8648, *Clonostachys cylindrospora* SANK14591, or *Dactylosporangium aurantiacum* RH1.

[0011] In one embodiment, the amino acid sequence of the exogenous proline-4-hydroxylase is shown in SEQ ID NO.2.

[0012] In one embodiment, the nucleotide sequence of the exogenous acyltransferase is shown in SEQ ID NO.3, and the nucleotide sequence of the exogenous proline-4-hydroxylase is shown in SEQ ID NO.4.

[0013] In one embodiment, the exogenous acyltransferase gene of the engineered bacteria is expressed using the T7 promoter; the exogenous proline-4-hydroxylase gene is expressed using the Ptrp2 promoter.

[0014] In one embodiment, the engineered bacteria is a genetically engineered Escherichia coli.

[0015] In one implementation, Escherichia coli BL21(DE3) is used as the host.

[0016] A second objective of this invention is to provide a method for producing N-acetyl-trans-4-hydroxyproline, wherein the method involves adding any of the above-mentioned genetically engineered bacteria to a culture system containing proline and culturing until OD (Organic Demand). 600 When the concentration reaches 0.8–1.0, lactose is added for induction, and then acetyl donor is added for fermentation.

[0017] In one embodiment, the amount of proline added to the culture system is 0.01–2 M.

[0018] In one embodiment, the amount of acyl donor added to the culture system is 0.5–20% v / v.

[0019] In one embodiment, the acyl donor may be one or more of the following: ethyl acetate, vinyl acetate, isopropyl acetate, isopropyl acetate, isopropyl acetate, isoamyl acetate, and p-nitrobenzene acetate.

[0020] In one embodiment, a surfactant is added to the culture system at an amount of 0.5–5% v / v.

[0021] In one embodiment, the surfactant may be one or more of the following: DMSO, isopropanol, glycerol, PEG 4000, Triton X-100, Tween 80.

[0022] In one implementation, the induction temperature of the culture system is between 16 and 37°C.

[0023] In one implementation, the induction time of the culture system is 2–24 hours.

[0024] In one embodiment, the fermentation time is 2–72 h; the fermentation temperature is 16–45 °C.

[0025] A third object of the present invention is to provide the use of any of the above-mentioned genetically engineered bacteria in the production of N-acetyl-trans-4-hydroxyproline.

[0026] Beneficial effects

[0027] This invention mutates wild-type acyltransferase to obtain acyltransferase MsAcT(S11C), and uses Escherichia coli BL21(DE3) as the starting strain. Through genetic engineering, the acyltransferase MsAcT(S11C) gene and the proline-4-hydroxylase gene are introduced to construct the recombinant strain BL21(DE3) / pTMPH(S11C), realizing the synthesis of N-acetyl-trans-4-hydroxyproline from proline, with a yield of 19.64 mg / L.

[0028] Based on this, the present invention further mutated the acyltransferase MsAcT(S11C) and constructed Escherichia coli genetically engineered strains BL21(DE3) / pTMPH(S11C / K97A), BL21(DE3) / pTMPH(S11C / F154A) and BL21(DE3) / pTMPH(S11C / K97A / F154A), which further improved the yield of N-acetyl-trans-4-hydroxyproline, reaching a maximum of 33.18 mg / L. Attached Figure Description

[0029] Figure 1 A schematic diagram of the construction of the recombinant plasmid pTMPH(S11C).

[0030] Figure 2 The metabolic pathway of recombinant strain BL21(DE3) / pTMPH. Detailed Implementation

[0031] The technical solutions described below will be clearly and completely described with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0032] 1. Preparation of experimental materials

[0033] (1) Preparation of pUC19-MsAcT(S11C) plasmid:

[0034] The wild-type acyltransferase MsAcT gene with the nucleotide sequence shown in SEQ ID NO.14 (amino acid sequence shown in SEQ ID NO.13) was ligated into plasmid pUC19. The 11th amino acid of the wild-type acyltransferase MsAcT amino acid sequence was mutated from serine to cysteine ​​to prepare the pUC19-MsAcT(S11C) plasmid.

[0035] (2) Preparation of pUC19-Hyp plasmid:

[0036] The proline-4-hydroxylase (Hyp) gene, whose nucleotide sequence is shown in SEQ ID NO.4, was ligated into plasmid pUC19 to prepare the pUC19-Hyp plasmid.

[0037] 2. ZYBM9 medium:

[0038] Table 1 Composition of ZYBM9 culture medium

[0039] Element Content (g / L) trypsin 10 Yeast extract 5 NaCl 5 glucose 4 <![CDATA[KH2PO4]]> 3 <![CDATA[NH4Cl]]> 1 <![CDATA[Na2HPO4]]> 6 <![CDATA[MgSO4·7H2O]]> 0.246

[0040] 3. Fermentation sample processing:

[0041] The fermentation sample was added with 4 times its volume of anhydrous methanol and incubated at -20℃ for 3 h. After incubation, the sample was centrifuged at 12000 rpm for 10 min. 50 μL of the supernatant was used for pre-column derivatization (mixed with 50 μL of 50 mM 2-NPH and 100 μL of 25 mM EDC·HCl, incubated in a metal bath at 80℃ for 5 min, then 200 μL of 1 M NaOH was added and incubated in a metal bath at 80℃ for another 5 min). The sample was then filtered through a 0.22 μm filter membrane and used for HPLC detection.

[0042] 4. HPLC detection conditions for N-acetyl-trans-4-hydroxyproline:

[0043] Liquid chromatography was performed using an Agilent Diamond C-18 column (4.6 × 250 mm) with a flow rate of 0.5 mL / min. Mobile phase A consisted of 90% water and 10% acetonitrile (containing 25 mM pH 6 sodium phosphate buffer), and mobile phase B consisted of 40% water and 60% acetonitrile (containing 25 mM pH 6 sodium phosphate buffer). A gradient elution strategy was employed, increasing the elution from 10% B to 100% B over 20 min and decreasing it back to 10% B over 20–25 min. The column temperature was 45 °C, and the detection wavelength was 420 nm. Each sample was run for 25 min.

[0044] Example 1: Construction of N-acetyl-trans-4-hydroxyproline genetically engineered strain

[0045] Construction of N-acetyl-trans-4-hydroxyproline genetically engineered strain; schematic diagram of plasmid pET22b-MsAcT(S11C) construction as shown in the figure. Figure 1 As shown; the metabolic pathways of genetically engineered strains are as follows Figure 2 As shown.

[0046] (1) Construction of acyltransferase plasmid pET22b-MsAcT(S11C):

[0047] Table 2 Primer sequences

[0048]

[0049] Using the primers described above, with the commercial plasmid pET22b as the backbone and the pUC19-MsAcT(S11C) plasmid (which contains the gene for the acyltransferase MsAcT(S11C); the amino acid sequence of the acyltransferase MsAcT(S11C) is shown in SEQ ID NO. 1; the nucleotide sequence is shown in SEQ ID NO. 3) as the target gene template, linearization amplification was performed using PCR technology. The amplification system and PCR reaction conditions are as follows:

[0050] Table 3 pET22b amplification system

[0051] Components Volume (μL) pET22b 1 pET22b-F 2.5 pET22b-R 2.5 2x Super Pfx MasterMix 25 <![CDATA[ddH2O]]> 19

[0052] Table 4 PCR reaction conditions (pET22b)

[0053]

[0054] Table 5 pUC19-MsAcT(S11C) amplification system

[0055] Components Volume (μL) pUC19-MsAcT(S11C) 1 MsAcT-F 2.5 MsAcT-R 2.5 2x Super Pfx MasterMix 25 <![CDATA[ddH2O]]> 19

[0056] Table 6 PCR reaction conditions (pUC19-MsAcT(S11C))

[0057]

[0058] After linearization and amplification, the plasmid was incubated at 50°C for 30 min using One Step Seamless Cloning Mix homologous recombinase and then ligated. The ligation system is shown in Table 7, and the acyltransferase plasmid pET22b-MsAcT(S11C) was obtained.

[0059] Table 7 Connection System

[0060] Components Volume (μL) pET22b 1 pUC19-MsAcT(S11C) 1 2x Cloning MasterMix 5 <![CDATA[ddH2O]]> 3

[0061] (2) Constructing plasmid pTMPH(S11C):

[0062] Using the primers shown in Table 8, with the acyltransferase plasmid pET22b-MsAcT(S11C) prepared in step (1) as the backbone and the pUC19-Hyp plasmid (which contains the proline-4-hydroxylase Hyp gene; the amino acid sequence of proline-4-hydroxylase Hyp is shown in SEQ ID NO.2; and the nucleotide sequence is shown in SEQ ID NO.4) as the target gene template, a plasmid containing the acyltransferase MsAcT(S11C) gene and the proline-4-hydroxylase Hyp gene was constructed according to the method in step (1), and named pTMPH(S11C).

[0063] Table 8 Primer sequences

[0064] Primer name sequence SEQ ID MF GAATTCGAGCTCCGTCGACA NO.9 MR GGATCCGAATTAATTCCGATATTT NO.10 HF ATCGGAATTAATTTCGGATCCGACATCATAACGGTTCTGGCAA NO.11 HR TGTCGACGGAGCTCGAATCTTAAACCGGCTGAGCCAGAG NO.12

[0065] (3) Construction of a genetically engineered strain for producing N-acetyl-trans-4-hydroxyproline (BL21(DE3) / pTMPH(S11C)):

[0066] BL21(DE3) competent cells that have been prepared and frozen at -80℃ were transformed with recombinant vectors.

[0067] Take 10 μL of the pTMPH(S11C) recombinant plasmid prepared in step (2), add it to the thawed BL21(DE3) competent cells, mix gently, and incubate on ice for 30 min. Heat shock in a metal bath at 42℃ for 90 s, then incubate on ice for 5 min. Add 500 μL of LB medium, mix gently, and incubate at 37℃ and 200 rpm for 40 min.

[0068] Centrifuge the bacterial culture, discard 500 μL of supernatant, mix well by pipetting and aspiration, and spread it on LB solid plates with ampicillin (Amp) resistance. Incubate overnight at 37°C with the plates inverted to obtain the recombinant engineered strain BL21(DE3) / pTMPH(S11C).

[0069] Based on the primers shown in Table 9, amino acids 97 and 154 of the acyltransferase (amino acid sequence shown in SEQ ID NO. 1) were mutated in the plasmid pET22b-MsAcT(S11C) to obtain plasmids pET22b-MsAcT(S11C / K97A), pET22b-MsAcT(S11C / F154A), and pET22b-MsAcT(S11C / K97A / F154A), respectively. Following steps (2) and (3), engineered strains BL21(DE3) / pTMPH(S11C / K97A), BL21(DE3) / pTMPH(S11C / F154A), and BL21(DE3) / pTMPH(S11C / K97A / F154A) were prepared, respectively.

[0070] Table 9 Primer sequences

[0071] Primer name sequence SEQ ID K97A-F GACACCgcaGCGTATTTCCGCCG NO.15 K97A-R GAAATACGCtgcGGTGTCGTTTGTGC NO.16 F154A-F CTGATTgcaGAGGGCGGAGAACAAAAGAC NO.17 F154A-R GCCCTCtgcAATCAGTTGAAACCAGG NO.18

[0072] Example 2: Optimization of fermentation conditions for recombinant strain BL21(DE3) / pTMPH(S11C)

[0073] Further optimization of the inducer concentration, induction time, induction temperature, and additive concentration in the fermentation system was conducted to increase the yield of N-acetyl-trans-4-hydroxyproline.

[0074] (1) Optimization of inducer concentration:

[0075] The recombinant strain BL21(DE3) / pTMPH(S11C) successfully constructed in Example 1 was inoculated into 5 mL of LB medium and cultured overnight at 37°C and 220 rpm on a shaker. Then, it was transferred at a 1% (v / v) inoculation rate to 50 mL of ZYBM9 medium containing 0.5 M proline. It was cultured at 37°C and 220 rpm until OD... 600 When the concentration of DMSO was 0.8–1.0, DMSO was added to a final concentration of 1% (v / v). Lactose at concentrations of 50 μM, 100 μM, 200 μM, 300 μM, and 400 μM was added respectively. After inducing expression at 28°C and 220 rpm for 16 h, 10% ethyl acetate (v / v) was added and cultured for another 6 h before the culture was terminated.

[0076] The yield of N-acetyl-trans-4-hydroxyproline was measured under different concentrations of lactose. The results are shown in Table 10. The yield reached 19.64 mg / L when the lactose concentration was 200 μM. Considering the cost of addition, 200 μM is the optimal concentration of lactose.

[0077] Table 10 Effect of lactose concentration on fermentation production of N-acetyl-trans-4-hydroxyproline

[0078] Lactose concentration (μM) 50 100 200 300 400 Yield (mg / L) 6.67 12.64 19.64 19.88 20.13

[0079] (2) Optimization of induction time:

[0080] Based on (1), the lactose concentration was changed to 200 μM, and the induction time was 4 h, 8 h, 12 h, 16 h and 20 h at 28 °C, respectively. The other conditions were the same as in (1). The yield of N-acetyl-trans-4-hydroxyproline under different induction time conditions was detected. The results are shown in Table 11. The optimal induction time was 16 h.

[0081] Table 11 Effect of induction time on fermentation production of N-acetyl-trans-4-hydroxyproline

[0082]

[0083]

[0084] (3) Optimization of induction temperature:

[0085] Based on (1), the lactose concentration was changed to 200 μM, and expression was induced for 16 h at 16℃, 20℃, 24℃, 28℃, 32℃ and 37℃ respectively. The other conditions were the same as in (1). The yield of N-acetyl-trans-4-hydroxyproline at different induction temperatures was detected. The results are shown in Table 12. 28℃ is the optimal induction temperature.

[0086] Table 12 Effect of induction temperature on fermentation production of N-acetyl-trans-4-hydroxyproline

[0087] Induction temperature (°C) 16 20 24 28 32 37 Yield (mg / L) 10.32 13.68 14.73 19.64 13.61 13.52

[0088] (4) Optimization of additive concentration:

[0089] Based on (1), the lactose concentration was changed to 200 μM, and the amount of DMSO added was 0.25%, 0.5%, 0.75%, 1%, 1.5%, and 2% (v / v). Expression was induced at 28℃ for 16 h, and the other conditions were the same as in (1). The yield of N-acetyl-trans-4-hydroxyproline was detected at different additive concentrations. The results are shown in Table 13. When the amount of DMSO added was 1% (v / v), the yield of N-acetyl-trans-4-hydroxyproline reached 19.64 mg / L. When the amount of DMSO added was increased to 2% (v / v), the yield increased only slightly. Considering cost reasons, the optimal amount of DMSO added was 1% (v / v).

[0090] Table 13 Effect of additive concentration on fermentation production of N-acetyl-trans-4-hydroxyproline

[0091] Additive concentration % 0.25 0.5 0.75 1 1.5 2 Yield (mg / L) 9.17 14.83 18.06 19.64 19.59 20.11

[0092] Example 3: Application of different recombinant strains in the production of N-acetyl-trans-4-hydroxyproline

[0093] The optimal fermentation conditions for N-acetyl-trans-4-hydroxyproline were obtained from Example 2. The recombinant strains BL21(DE3) / pTMPH(S11C), BL21(DE3) / pTMPH(S11C / K97A), BL21(DE3) / pTMPH(S11C / F154A), and BL21(DE3) / pTMPH(S11C / K97A / F154A) successfully constructed in Example 1 were inoculated into 5 mL of LB medium and cultured overnight at 37°C with a shaker at 220 rpm. Then, they were transferred at a 1% (v / v) inoculation rate to 50 mL of ZYBM9 medium containing 0.5 M proline and cultured at 37°C with a shaker at 220 rpm until OD (dose retardation). 600 When the concentration of lactose was 0.8–1.0, lactose with a final concentration of 200 μM and 1% (v / v) DMSO were added. After inducing expression at 28 °C and 220 rpm for 16 h, 10% ethyl acetate (v / v) was added and cultured for another 6 h before ending the culture.

[0094] 1 mL of samples from different recombinant bacteria were added to 4 mL of anhydrous methanol, incubated at -20 °C for 3 h, centrifuged at 12000 rpm for 10 min, and 50 μL of the supernatant was used for pre-column derivatization before analysis by HPLC and LC-MS. *Escherichia coli* BL21(DE3) was used as a blank, and the recombinant strain BL21(DE3) / pTMPH containing the wild-type acyltransferase MsAcT and proline-4-hydroxylase Hyp genes was used as a control. The results showed that neither the blank nor the control group could synthesize N-acetyl-trans-4-hydroxyproline, but the recombinant strain BL21(DE3) / pTMPH(S11C) could produce N-acetyl-trans-4-hydroxyproline, with a yield of 19.64 mg / L.

[0095] The yields of recombinant strains BL21(DE3) / pTMPH(S11C / K97A), BL21(DE3) / pTMPH(S11C / F154A), and BL21(DE3) / pTMPH(S11C / K97A / F154A) reached 26.67 mg / L, 23.94 mg / L, and 33.18 mg / L, respectively.

[0096] Table 14 Yield of Recombinant Strains

[0097]

[0098] Example 4: Synthesis of N-acetyl-trans-4-hydroxyproline using different acyl donors

[0099] Based on Example 3, the recombinant strain BL21(DE3) / pTMPH(S11C) was used, and the 10% v / v ethyl acetate was replaced with equal amounts of vinyl acetate, isopropyl acetate, isopropyl acetate, isoamyl acetate, and p-nitrobenzene acetate. The remaining steps were the same as in Example 3. The yield of N-acetyl-trans-4-hydroxyproline was determined. The results show that the yield of N-acetyl-trans-4-hydroxyproline is shown in Table 15.

[0100] Table 15 Effects of different acyl donors on the fermentation production of N-acetyl-trans-4-hydroxyproline

[0101]

[0102] Example 5: Effect of different surfactants on the synthesis of N-acetyl-trans-4-hydroxyproline

[0103] Based on Example 3, recombinant strain BL21(DE3) / pTMPH(S11C) was used, and 1% v / v DMSO was replaced with equal amounts of isopropanol, glycerol, PEG 4000, Triton X-100, and Tween 80. The remaining steps were the same as in Example 3. The yield of N-acetyl-trans-4-hydroxyproline was measured. The results are shown in Table 16.

[0104] Table 16 Effects of different surfactants on the fermentation production of N-acetyl-trans-4-hydroxyproline

[0105] Types of additives Isopropanol glycerin DMSO PEG 4000 Triton X-100 Tween 80 Production (mg / L) 18.77 7.03 19.64 14.32 10.50 10.03

[0106] The partial sequence of this invention is as follows:

[0107] The amino acid sequence of the exogenous acyltransferase is shown in SEQ ID NO.1:

[0108] MAKRILCFGDCLTWGWVPVEDGAPTERFAPDVRWTGVLAQQLGADFEVIEEGLSARTTNIDDPTDPRLNGASYLPSCLATHLPLDLVIIMLGTNDTKAYFRRTPLDIALGMSVLVTQVLTSAGGVGTTYPAPKVLVVSPPPLAPMPHPWFQLIFEGGEQKTTELARVYSALASFMKVPFFDAGSVISTDGVDGIHFTEANNRDLGVALAEQVRSLL

[0109] The amino acid sequence of the exogenous proline-4-hydroxylase is shown in SEQ ID NO.2:

[0110] MLTPTELKQYREAGYLLIEDGLGPREVDCLRRAAAALYAQDSPDRTLEKDGRTVRAVHGCHRRDPVCRDLVRHPRLLGPAMQILSGDVYVHQFKINAKAPMTGDVWPWHQDYIFWAREDGMDRPHVVNVAVLLDEA THLNGPLLFVPGTHELGLIDVERRAPAGDGDAQWLPQLSADLDYAIDADLLARLTAGRGIESATGPAGSILLFDSRIVHGSGTNMSPHPRGVVLVTYNRTDNALPAQAAPRPEFLAARDATPLVPLPAGFALAQPV

[0111] The nucleotide sequence of the exogenous acyltransferase is shown in SEQ ID NO.3:

[0112] ATGGCCAAACGCATCTTATGTTTCGGAGACTGCCTGACTTGGGGATGGGTTCCCGTGGAAGACGGTGCTCCTACTGAACGCTTTGCGCCAGATGTACGCTGGACCGGCGTATTAGCTCAGCAGTTAGGCGCTGACTTTGAAGTCATTGAGGAAGGTTTGTCTGCCCGTACGACAAACATCGATGATCCCACCGACCCGCGTTTGAATGGAGCGAGCTATCTTCCCTCGTGCCTGGCAACTCACTTACCGCTGGATCTTGTTATTATCATGTTGGGCACAAACGACACCAAGGCGTATTTCCGCCGCACACCCCTTGATATTGCACTTGGGATGTCGGTGCTTGTCACACAGGTCTTGACATCCGCGGGGGGAGTAGGCACGACATATCCCGCACCGAAAGTATTAGTCGTCTCGCCTCCTCCCTTGGCACCCATGCCTCACCCCTGGTTTCAACTGATTTTTGAGGGCGGAGAACAAAAGACAACGGAACTTGCCCGTGTGTATTCAGCGCTGGCTTCGTTTATGAAAGTCCCGTTCTTTGATGCCGGTAGCGTGATCAGTACAGACGGCGTAGATGGTATCCACTTTACGGAGGCCAATAACCGTGATCTGGGGGTGGCACTGGCGGAGCAAGTTCGCTCACTTTTA

[0113] The nucleotide sequence of exogenous proline-4-hydroxylase is shown in SEQ ID NO.4:

[0114] ATGCTGACCCCGACCGAACTGAAACAGTATCGTGAAGCGGGCTATCTGCTGATTGAAGATGGCCTGGGCCCGCGTGAAGTTGACTGCCTGCGTCGTGCTGCTGCTGCTCTGTACGCTCAGGACTCTCCGGACCGTACCCTGGAAAAAGACGGTCGTACCGTTCGTGCTGTTCACGGTTGCCACCGTCGTGACCCGGTTTGCCGTGACCTGGTTCGTCACCCGCGTCTGCTGGGTCCGGCTATGCAGATCCTGTCTGGTGACGTTTACGTTCACCAGTTCAAAATCAACGCTAAAGCTCCGATGACCGGTGACGTTTGGCCGTGGCACCAGGACTACATCTTCTGGGCTCGTG AAGACGGTATGGACCGTCCGCACGTTGTTAACGTTGCTGTTCTGCTGGACGAAGCTACCCACCTGAACGGTCCGCTGCTGTTCGTTCCGGGTACCCACGAACTGGGTCTGATCGACGTTGAACGTCGTGCTCCGGCTGGTGACGGTGACGCTCAGTGGCTGCCGCAGCTGTCTGCTGACCTGGACTACGCTATCGACGCTGACCTGCTGGCTCGTCTGACCGCTGGTCGTGGTATCGAATCTGCTACCGGTCCGGCTGGTTCTATCCTGCTGTTCGACTCTCGTATCGTTCACGGTTCTGGTACCAACATGTCTCCGCACCCGCGTGGTGTTGTTCTGGTTACCTACAACCGTACCGACAACGCTCTGCCGGCTCAGGCTGCTCCGCGTCCGGAATTTCTGGCTGCTCGTGACGCTACCCCGCTGGTTCCGCTGCCGGCTGGTTTCGCTCTGGCTCAGCCGGTT

[0115] The amino acid sequence of the wild-type acyltransferase is shown in SEQ ID NO. 13:

[0116] MAKRILCFGDSLTWGWVPVEDGAPTERFAPDVRWTGVLAQQLGADFEVIEEGLSARTTNIDDPTDPRLNGASYLPSCLATHLPLDLVIIMLGTNDTKAYFRRTPLDIALGMSVLVTQVLTSAGGVGTTYPAPKVLVVSPPPLAPMPHPWFQLIFEGGEQKTTELARVYSALASFMKVPFFDAGSVISTDGVDGIHFTEANNRDLGVALAEQVRSLL

[0117] The nucleotide sequence of the wild-type acyltransferase is shown in SEQ ID NO.14:

[0118] ATGGCCAAACGCATCTTATGTTTCGGAGACTCCCTGACTTGGGGATGGGTTCCCGTGGAAGACGGTGCTCCTACTGAACGCTTTGCGCCAGATGTACGCTGGACCGGCGTATTAGCTCAGCAGTTAGGCGCTGACTTTGAAGTCATTGAGGAAGGTTTGTCTGCCCGTACGACAAACATCGATGATCCCACCGACCCGCGTTTGAATGGAGCGAGCTATCTTCCCTCGTGCCTGGCAACTCACTTACCGCTGGATCTTGTTATTATCATGTTGGGCACAAACGACACCAAGGCGTATTTCCGCCGCACACCCCTTGATATTGCACTTGGGATGTCGGTGCTTGTCACACAGGTCTTGACATCCGCGGGGGGAGTAGGCACGACATATCCCGCACCGAAAGTATTAGTCGTCTCGCCTCCTCCCTTGGCACCCATGCCTCACCCCTGGTTTCAACTGATTTTTGAGGGCGGAGAACAAAAGACAACGGAACTTGCCCGTGTGTATTCAGCGCTGGCTTCGTTTATGAAAGTCCCGTTCTTTGATGCCGGTAGCGTGATCAGTACAGACGGCGTAGATGGTATCCACTTTACGGAGGCCAATAACCGTGATCTGGGGGTGGCACTGGCGGAGCAAGTTCGCTCACTTTTA

[0119] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. Use of genetically engineered bacteria in the production of N-acetyl-trans-4-hydroxyproline, characterized in that, The engineered bacteria express an exogenous acyltransferase and proline-4-hydroxylase; wherein the amino acid sequence of the exogenous acyltransferase is shown as SEQ ID NO. 1, or is mutated at the 97th or / and 154th amino acid based on the amino acid sequence shown as SEQ ID NO. 1; wherein the lysine at the 97th position is mutated to alanine, and the phenylalanine at the 154th position is mutated to alanine.

2. A method for producing N-acetyl-trans-4-hydroxyproline, characterized by, The method is to add the genetically engineered bacteria of claim 1 into a culture system containing proline, culture to OD 600 0.8~1.0, add lactose for induction, and then add acyl donor for fermentation.

3. The method of claim 2, wherein, The addition amount of proline in the culture system is 0.01-2M; the addition amount of acetyl donor in the culture system is 0.5%-20% v / v.

4. The method of claim 2, wherein, A surfactant is added to the culture system, and the addition amount is 0.5%-5% v / v.

5. The method of claim 2, wherein, The induction temperature of the culture system is 16-37℃.

6. The method of claim 2, wherein, The induction time of the culture system is 2-24h.

7. The method of claim 2, wherein, The fermentation time is 2-72h; the fermentation temperature is 16-45℃.

Images