Compound microorganisms, compound inoculants, and their applications for oil degradation in aerobic composting of kitchen waste.

Abstract

This invention provides a composite microorganism, a composite preparation, and its application for the aerobic composting and oil degradation of kitchen waste. The composite microorganism includes *Agrobacterium tumefaciens*. Agrobacterium swelling Curvular Pseudomonas Pseudomonas kneeling Near root flavobacterium Luteobacter rhizovicin Cylindrica monopermanente Simplellium cylindrosporum Fusarium moniliforme Fusarium proliferated ,and Simplellium woolly The provided compound microorganisms and compound preparations can be used for lipid degradation.

Description

Technical Field

[0001] This invention relates to the field of microorganisms, specifically to a composite microorganism, a composite microbial agent, and its application that can be used for the aerobic composting and oil degradation of kitchen waste. Background Technology

[0002] Microbial inoculation has a positive regulatory effect on the aerobic composting process, such as accelerating the composting process and improving compost quality. Chinese patent application number 202411872817.8 and publication number CN119776153A describes a type of emerging Fusarium. Fusarium proliferatum This microorganism, deposited on November 20, 2023, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 40988, can be used for lipid degradation. However, for lipid degradation, single microorganisms cannot fully meet the requirements; more compound microbial agents are needed to adapt to various complex environments or to provide higher lipid degradation efficiency. Existing technologies mostly use single-factor or orthogonal experimental methods to formulate microbial agents, resulting in low compounding efficiency, and due to limitations in horizontal settings, it is difficult to optimize to the actual optimal solution. Summary of the Invention

[0003] This invention aims to at least partially solve one of the technical problems in related technologies. Existing technologies often employ single-factor or orthogonal experimental methods to formulate microbial agents, resulting in low compounding efficiency and, due to limitations in horizontal settings, difficulty in optimizing to the actual optimal solution. This invention addresses the high oil content problem of kitchen waste by employing a mixed design-simple shape centroid method to formulate microbial agents for use in the kitchen waste composting process, effectively improving oil degradation efficiency. This invention creatively conceives of using the simple shape centroid method for microbial agent compounding, utilizing a three-dimensional model for simulation, allowing for the fitting of optimal results with minimal experimental design. The composite microorganisms and composite microbial agents obtained through the simple shape centroid method can be used for oil degradation.

[0004] Specifically, the present invention provides the following technical solution:

[0005] A first aspect of the present invention provides a composite microorganism for the aerobic composting and oil degradation of kitchen waste, comprising:

[0006] Agrobacterium tumefaciens Agrobacterium tumefaciens Curvular Pseudomonas Pseudomonas kneeling Near root flavobacterium Luteibacter rhizovicinus Cylindrica monopermanente Simplellium cylindrosporum Fusarium moniliforme Fusarium proliferatum ,and Simplicillium lanosoniveum .

[0007] The aforementioned bacteria were obtained by screening and streak-stretching separation using materials from the high-temperature period of aerobic composting of kitchen waste as the initial inoculum and soybean oil as the sole carbon source. The *Agrobacterium tumefaciens* and *Pseudomonas curvaturei* mentioned can also be obtained commercially. Verification has shown that these bacteria can be combined and used for oil degradation, especially for oil degradation in aerobic composting of kitchen waste.

[0008] According to an embodiment of the present invention, the *Agrobacterium tumefaciens* Agrobacterium tumefaciens The activity is not less than 10 10 CFU / mL;

[0009] The curved Pseudomonas Pseudomonas geniculata The activity is not less than 10 10 CFU / mL;

[0010] The *Acetobacter irradiata* Luteibacter rhizovicinus The activity is not less than 10 10 CFU / mL;

[0011] The Cyclosporium monopergenum Simplicillium cylindrosporum The activity is not less than 10 10 CFU / mL;

[0012] The exfoliated Fusarium Fusarium proliferatum The activity is not less than 10 10 CFU / mL;

[0013] The Simplicillium lanosoniveum The activity is not less than 10 10 CFU / mL.

[0014] According to an embodiment of the present invention, the *Xanthomonas quasi-root* Luteibacter rhizovicinus It was deposited on July 5, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 27740.

[0015] The Cyclosporium monopergenum Simplicillium cylindrosporum It was deposited on July 5, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 40761.

[0016] The exfoliated Fusarium Fusarium proliferatum It was deposited on November 20, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 40988.

[0017] The Simplicillium lanosoniveum It was deposited on November 20, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 40987.

[0018] According to an embodiment of the present invention, the *Agrobacterium tumefaciens* Agrobacterium tumefaciens The 16S rDNA sequence is shown in SEQ ID NO:1;

[0019] The curved Pseudomonas Pseudomonas geniculata The 16S rDNA sequence is shown in SEQ ID NO:2;

[0020] The *Acetobacter irradiata* Luteibacter rhizovicinus The 16S rDNA sequence is shown in SEQ ID NO:3;

[0021] The Cyclosporium monopergenum Simplicillium cylindrosporum The 18S rDNA sequence is shown in SEQ ID NO:4;

[0022] The exfoliated Fusarium Fusarium proliferatum The 18S rDNA sequence is shown in SEQ ID NO:5; and

[0023] The Simplicillium lanosoniveum The 18S rDNA sequence is shown in SEQ ID NO:6. 。

[0024] In a second aspect, the present invention provides a compound microbial agent for the aerobic composting and oil degradation of kitchen waste, comprising:

[0025] Agrobacterium tumefaciens Agrobacterium tumefaciens Inoculant, Pseudomonas curvatureii Pseudomonas kneeling Inoculant, *Bacillus repens* Luteibacter rhizovicinus Inoculant, Cyclospora monophylla Simplicillium cylindrosporum Inoculant, Fusarium moniliforme Fusarium proliferatum Bacterial agents, and Simplicillium lanosoniveum Bacterial agent.

[0026] According to an embodiment of the present invention, the *Agrobacterium tumefaciens* is defined as follows, based on volume fractions with the same number of viable bacteria: Agrobacterium tumefaciens The amount of bacterial agent is 10-20 parts;

[0027] The curved Pseudomonas Pseudomonas geniculata The amount of bacterial agent is 5-15 parts;

[0028] The *Acetobacter irradiata* Luteibacter rhizovicinus The amount of bacterial agent is 8-18 parts;

[0029] The Cyclosporium monopergenum Simplicillium cylindrosporum The amount of bacterial agent is 15-30 parts;

[0030] The exfoliated Fusarium Fusarium proliferatum The amount of bacterial agent is 18-30 parts;

[0031] The Simplicillium lanosoniveum The amount of bacterial agent is 20-30 parts.

[0032] According to an embodiment of the present invention, the *Agrobacterium tumefaciens* Agrobacterium tumefaciens In bacterial agents Agrobacterium tumefaciens The number of active units is not less than 10 10 CFU / mL;

[0033] The curved Pseudomonas Pseudomonas geniculata In bacterial agents Pseudomonas geniculata The number of active units is not less than 10 10 CFU / mL;

[0034] The *Acinetobacter irradiata* Luteibacter rhizovicinus In bacterial agents Yellow-bellied rhizovicin The number of active units is not less than 10 10 CFU / mL;

[0035] The Cyclosporium monopergenum Simplicillium cylindrosporum In bacterial agents Simplellium cylindrosporum The number of active units is not less than 10 10 CFU / mL;

[0036] The exfoliated Fusarium Fusarium proliferatum In bacterial agents Fusarium proliferatum The number of active units is not less than 10 10 CFU / mL;

[0037] The Simplicillium lanosoniveum In bacterial agents Simplicillium lanosoniveum The number of active units is not less than 10 10 CFU / mL.

[0038] According to an embodiment of the present invention, the *Agrobacterium tumefaciens* Agrobacterium tumefaciens The microbial agent is obtained by using materials from the high-temperature period of aerobic composting of kitchen waste as the initial source of microorganisms and soybean oil as the sole carbon source, after screening and streaking separation; or it can be obtained directly by purchase.

[0039] The curved Pseudomonas Pseudomonas geniculata The microbial agent is obtained by using materials from the high-temperature period of aerobic composting of kitchen waste as the initial source of microorganisms and soybean oil as the sole carbon source, after screening and streaking separation, or by purchasing directly.

[0040] The *Acetobacter irradiata* Luteibacter rhizovicinus The microbial agent was obtained by using materials from the high-temperature period of aerobic composting of kitchen waste as the initial inoculum source, with soybean oil as the sole carbon source, and through screening and streak separation.

[0041] The Cyclosporium monopergenum Simplicillium cylindrosporumThe microbial agent was obtained by using materials from the high-temperature period of aerobic composting of kitchen waste as the initial inoculum source, with soybean oil as the sole carbon source, and through screening and streak separation.

[0042] The exfoliated Fusarium Fusarium proliferatum The microbial agent was obtained by using materials from the high-temperature period of aerobic composting of kitchen waste as the initial inoculum source, with soybean oil as the sole carbon source, and through screening and streak separation.

[0043] The Simplicillium lanosoniveum The microbial agent is obtained by using materials from the high-temperature period of aerobic composting of kitchen waste as the initial source of microorganisms and soybean oil as the sole carbon source, after screening and streaking separation.

[0044] A third aspect of the present invention provides a method for aerobic composting and oil degradation of kitchen waste, comprising:

[0045] The compound microorganisms described in any one of the first aspects or the compound microbial agent described in any one of the second aspects are mixed with kitchen waste to form a mixed compost.

[0046] The mixed compost is fermented to degrade the grease in the kitchen waste.

[0047] According to an embodiment of the present invention, the oil content in the kitchen waste is 20%, and after 42 days of fermentation, the oil content is reduced by 75.6%.

[0048] The third aspect of the present invention provides the application of the microbial composition described in the first aspect or the compound microbial agent described in any one of the second aspects in the field of aerobic composting and oil degradation of kitchen waste.

[0049] The beneficial effects achieved by this invention are at least as follows:

[0050] The composite microorganisms or composite inoculants provided by this invention can be used for oil degradation, especially for kitchen waste. For example, adding the provided composite microorganisms or composite inoculants to kitchen waste for aerobic composting can degrade oil. Assuming the oil content in the kitchen waste is 15% to 25%, after 42 days of fermentation, the oil will be degraded by at least 60%, for example, at least 65%, 70%, 75%, 80%, etc.

[0051] Preservation Certificate

[0052] Classified as *Xanthomonas chinensis* Luteibacter rhizovicinus It was deposited on July 5, 2023, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 27740. The deposit address is: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0053] Classified as *Monochorophytum spp.* Simplicillium cylindrosporum It was deposited on July 5, 2023, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 40761 and address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0054] Classified as Fusarium Fusarium proliferatum It was deposited on November 20, 2023, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 40988 and address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0055] Category naming Simplicillium lanosoniveum It was deposited on November 20, 2023, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 40987. The deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing. Attached Figure Description

[0056] Figure 1 The results show the oil removal efficiency of the bacterial group provided according to an embodiment of the present invention.

[0057] Figure 2 The results show the oil removal efficiency of the fungal group provided according to an embodiment of the present invention.

[0058] Figure 3 This is the result of the degreasing effect of the bacterial-fungal group provided according to the embodiments of the present invention.

[0059] Figure 4 This is the target optimization result of the bacterial group's expected value provided according to an embodiment of the present invention.

[0060] Figure 5 This is the target optimization result of the desired value of the fungal group provided according to an embodiment of the present invention.

[0061] Figure 6 This is the target optimization result of the desired value of the bacterial-fungal group provided according to an embodiment of the present invention. Detailed Implementation

[0062] The embodiments of the present invention are described in detail below. Examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain the present invention, but should not be construed as limiting the present invention.

[0063] The simplex centroid method mentioned in this article is a mathematical approach for mixture design. Its core idea is to efficiently construct a mathematical model of the relationship between component proportions and the response variable by systematically selecting representative experimental points. Simplex centroid design ensures sufficient coverage of the region of interest on the response surface. It constructs the response surface model by selecting a set of experimental points located at the centroid (i.e., the center point) of the simplex and on its vertices or edges. This method is particularly useful when a comprehensive exploration of the response surface is required, considering the influence of multiple component proportions.

[0064] This invention utilizes the simplex centroid method to obtain a composite microorganism for lipid degradation. The provided composite microorganism includes: *Agrobacterium tumefaciens*. Agrobacterium tumefaciens (can be abbreviated as) A. tumefaciens ), Pseudomonas curvilinearis Pseudomonas geniculata (can be abbreviated as) P. geniculata ), *Acinetobacter chinensis* Luteibacter rhizovicinus (can be abbreviated as) L. rhizovicinus ), Cylindrica monopermanente Simplellium cylindrosporum (can be abbreviated as) S. cylindrosporum Fusarium moniliforme Fusarium proliferatum (can be abbreviated as) F. proliferatum ),and Simplicillium lanosoniveum (can be abbreviated as) S. lanosoniveum ).

[0065] The mentioned *Xanthomonas auricula-judae* Luteibacter rhizovicinus Cylindrica monopermanente Simplicillium cylindrosporum Fusarium moniliforme Fusarium proliferatum ,and Simplellium woolly All bacteria were obtained using materials from the high-temperature aerobic composting period of kitchen waste as the initial inoculum, with soybean oil as the sole carbon source, and were obtained through screening and streak separation. Verification has shown that these bacteria, along with *Agrobacterium tumefaciens*, are... Agrobacterium swelling Curvular Pseudomonas Pseudomonas geniculata When combined with other ingredients, it can be used for oil degradation, especially for oil degradation in aerobic composting of kitchen waste.

[0066] According to a specific implementation method, the *Agrobacterium tumefaciens* Agrobacterium tumefaciens It can be obtained commercially. For example, it can be purchased from the China Center for Type Culture Collection (CCTCC), with the catalog number CCTCC AB2016054. Another example is the *Agrobacterium tumefaciens* used. Agrobacterium tumefaciens It can be obtained through screening, and its 16S rDNA sequence is shown in SEQ ID NO:1. During the research, it was found that, for example, these purchased or screened *Agrobacterium tumefaciens* can be combined with other microorganisms for the aerobic composting and oil degradation of kitchen waste.

[0067]

[0068] According to a specific embodiment, the *Pseudomonas curvilinearis* Pseudomonas geniculata These can be obtained commercially. For example, they can be purchased from CGMCC (China General Microbiological Culture Collection Center). Depending on the specific implementation method, the corresponding numbers can be CGMCC 1.4527, CGMCC 1.42, CGMCC 1.39, etc. For example, the *Pseudomonas curvilinearis* used can be obtained through screening, and its 16S rDNA sequence can be as shown in SEQ ID NO:2. During the research, it was found that, for example, these purchased or screened *Pseudomonas curvilinearis* can be combined with other microorganisms for the aerobic composting and oil degradation of kitchen waste.

[0069] TGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCCATACCGCGTGGGTGAAGAAGGCCTTCGGGTTGTAAAGCCCTTTTGTTGGGAAAGAAATCCAGCTGGCTAATACCCGGTTGGGATGACGGTACCCAAAGAATAAGCACCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTACTCGGAATTACTGGGCGTAA AGCGTGCGTAGGTGGTCGTTTAAGTCCGTTGTGAAAGCCCTGGGCTCAACCTGGGAACTGCAGTGGATACTGGGCGACTAGAGTGTGGTAGAGGGTAGCGGAATTCCTGGTGTAGCAGTGAAATGCGTAGAGATCAGGAGGAACATCCATGGCGAAGGCAGCTACCTGGACCAACACTGACACTGAGGCACGAAAGCGTGGGGAGCAAACAGG (SEQ ID NO:2)

[0070] According to a specific implementation method, the *Xanthomonas quasi-root* Luteibacter rhizovicinus It was deposited on July 5, 2023, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 27740, and its 16S rDNA sequence is shown in SEQ ID NO:3.

[0071]

[0072] According to a specific implementation, the *Monophora stylosa* Simplicillium cylindrosporum It was deposited on July 5, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 40761. Its 18S rDNA sequence is shown in SEQ ID NO:4.

[0073] (SEQ ID NO:4)

[0074] According to a specific embodiment, the exfoliated Fusarium Fusarium proliferatum It was deposited on November 20, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 40988. Its 18S rDNA sequence is shown in SEQ ID NO:5.

[0075] AAACTCGATAATGATCCCTCCGTAGGTGAACCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAG AGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAAT TCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGTTTGGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGCCGGCCC CGAAATCTAGTGGCGGTCTCGCTGCAGCTTCCATTGCGTAGTAGTAAAACCCTCGCAACTGGTACGCGGCGCGCCCAAGCCGTTAAACCCCCAACTTCTG-AATGTTGACCTCGGATCAGGTAGGAATACCCGCT (SEQ ID NO:5)

[0076] According to a specific implementation, the Simplicillium lanosoniveum It was deposited on November 20, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 40987. Its 18S rDNA sequence is shown in SEQ ID NO:6.

[0077] (SEQ ID NO:6)

[0078] According to a specific implementation method, the *Agrobacterium tumefaciens* Agrobacterium tumefaciens The activity is not less than 10 10 CFU / mL. According to a specific embodiment, the *Pseudomonas curvilinearis* Pseudomonas geniculata The activity is not less than 10 10 CFU / mL. According to a specific embodiment, the *Xanthomonas quassioides*... Luteibacter rhizovicinus The activity is not less than 10 10 CFU / mL. According to a specific embodiment, the *Monophora stylosa*... Simplicillium cylindrosporum The activity is not less than 10 10 CFU / mL. According to a specific embodiment, the *Fusarium* sp. Fusarium proliferatum The activity is not less than 10 10 CFU / mL. According to a specific embodiment, the... Simplicillium lanosoniveum The activity is not less than 10 10 CFU / mL, with a content of 23~28% (v / v).

[0079] The present invention also provides a compound microbial agent comprising: Agrobacterium tumefaciens Agrobacterium tumefaciens Inoculant, Pseudomonas curvatureii Pseudomonas geniculata Inoculant, *Bacillus repens* Luteobacter rhizovicin Inoculant, Cyclospora monophylla Simplicillium cylindrosporum Inoculant, Fusarium moniliforme Fusarium proliferatum Bacterial agents, and Simplicillium lanosoniveum Microbial agents. These microbial agents can all be obtained through fermentation using corresponding microorganisms. The microbial agents mentioned can be in the form of dry powder or liquid.

[0080] The mentioned Agrobacterium tumefaciens Agrobacterium tumefaciens The microbial agent uses Agrobacterium tumefaciens. Agrobacterium tumefaciens The product is obtained through fermentation. According to a specific implementation method, the fermentation conditions are as follows: inoculation into an enrichment medium, temperature 25~35℃, pH 6.5~7.5, soybean oil addition of 0.8~1.5% (v / v), constant temperature incubator 100~200r / min, fermentation culture for 2~7 days.

[0081] The mentioned Pseudomonas geniculata bacterial agent through Pseudomonas geniculata The product is obtained through fermentation. According to a specific implementation method, the fermentation conditions are as follows: inoculation into an enrichment medium, temperature 25~35℃, pH 6.5~75, soybean oil addition 1~1.5% (v / v), constant temperature incubator 100~200r / min, fermentation culture for 2~7 days.

[0082] The mentioned *Xanthomonas auricula-judae* Luteibacter rhizovicinus bacterial agent through Yellow-bellied rhizovicin The product is obtained through fermentation. According to a specific implementation method, the fermentation conditions are as follows: inoculation into an enrichment medium, temperature 28~32℃, pH 6.5~7.0, soybean oil addition 0.8~1.2% (v / v), constant temperature incubator 100~200 r / min, fermentation culture for 2~7 days.

[0083] The mentioned Cyclospora monopergenis Simplicillium cylindrosporum The fungicide is produced by *Monochorhizium anisopliae*. Simplicillium cylindrosporum The product is obtained through fermentation. According to a specific implementation method, the fermentation conditions are as follows: inoculation into an enrichment medium, temperature 25~27℃, pH 7.0~7.5, soybean oil addition of 1.3~1.5% (v / v), constant temperature incubator at 100~200 r / min, and fermentation culture for 2~7 days.

[0084] The mentioned Fusarium Fusarium proliferatum The fungal agent produces Fusarium through layering. Fusarium proliferatedThe product is obtained through fermentation. According to a specific implementation method, the fermentation conditions are as follows: inoculation into an enrichment medium, temperature 27~29℃, pH 6.8~7.2, soybean oil addition 1.1~1.3% (v / v), constant temperature incubator 100~200 r / min, fermentation culture for 2~7 days.

[0085] The mentioned Simplicillium lanosoniveum bacterial agent through Simplicillium lanosoniveum The product is obtained through fermentation. According to a specific implementation method, the fermentation conditions are as follows: inoculation into an enrichment medium, temperature 30-32℃, pH 6.5-7.5, soybean oil addition of 1-2% (v / v), constant temperature incubator 100 r / min-200 r / min, fermentation culture for 2-7 days.

[0086] The enrichment medium formula mentioned above includes 0.1~0.5 g of MgSO4·7H2O, 1~2 g of (NH4)2SO4, 0.3~1 g of KH2PO4, 1~2 g of K2HPO4, 3~8 g of NaCl, soybean oil added according to the amount of oil suitable for each microorganism, 1000 mL of deionized water, and pH 7.0~7.2.

[0087] According to specific embodiments, based on volume fractions with the same number of live bacteria, the Agrobacterium swelling The bacterial agent is 10-20 parts; the *Pseudomonas curvatureis* Pseudomonas geniculata The bacterial agent is 5-15 parts; the aforementioned *Xanthomonas auricula-judae* Luteibacter rhizovicinus The amount of inoculant is 8-18 parts; the aforementioned *Monophora stylosaporosa* Simplicillium cylindrosporum The inoculum is 15-30 parts; the *Fusarium* species mentioned above. Fusarium proliferatum The amount of bacterial agent is 18-30 parts; Simplicillium lanosoniveum The amount of bacterial agent is 20-30 parts.

[0088] According to a specific implementation method, the *Agrobacterium tumefaciens* Agrobacterium tumefaciens In bacterial agents Agrobacterium tumefaciens The number of active units is not less than 10 10 CFU / mL; the *Pseudomonas curvatureis* Pseudomonas geniculata In bacterial agents Pseudomonas geniculata The number of active units is not less than 10 10 CFU / mL, the *Xanthomonas chinensis* Luteibacter rhizovicinus In bacterial agents Luteimonas rhizovicinus The number of active units is not less than 10 10 CFU / mL, the columnar monoperiosteum Simplicillium cylindrosporum In bacterial agents Simplicillium cylindrosporum The number of active units is not less than 10 10 CFU / mL, the exfoliated Fusarium Fusarium proliferatum In bacterial agents Fusarium proliferatumThe number of active units is not less than 10 10 CFU / mL, the Simplicillium lanosoniveum In bacterial agents Simplicillium lanosoniveum The number of active units is not less than 10 10 CFU / mL.

[0089] The technical solution of the present invention will be described below through specific embodiments. It should be noted that these embodiments are only used to facilitate understanding by those skilled in the art and should not be regarded as a limitation on the scope of protection of the present invention. Unless otherwise specified, the reagents used in the embodiments can be obtained commercially.

[0090] Example 1

[0091] Example 1 obtained lipid-degrading bacteria through screening using the following method:

[0092] A 5 g sample was taken from the high-temperature composting stage of food waste from a food waste treatment company and placed in 250 mL of enrichment medium (first concentration soybean oil gradient: 1.6 g / L, 2.4 g / L, 3.2 g / L, 4 g / L, 4.8 g / L). The sample was incubated at 30℃ and 120 r / min for 6-7 days. Then, 5 mL of the bacterial culture was transferred to 250 mL of fresh enrichment medium (second concentration soybean oil gradient: 1.6 g / L, 2.4 g / L, 3.2 g / L, 4 g / L, 4.8 g / L), and incubated under the same conditions for 6-7 days. This gradient acclimatization was repeated for 6 cycles (third concentration soybean oil gradient: 3.2 g / L, 4 g / L, 4.8 g / L, 5.6 g / L, 6.4 g / L; fourth concentration soybean oil gradient: 3.2 g / L, 4.8 g / L, 5.6 g / L, 6.4 g / L, 8 g / L). The concentration gradients were as follows: 6.4 g / L, 9.6 g / L, 11.2 g / L, 12.8 g / L, and 16 g / L; and 6.4 g / L, 9.6 g / L, 11.2 g / L, 12.8 g / L, and 16 g / L. The best-growing and most effective oil-degrading microbial communities were selected for each cycle to proceed to the next stage of gradient acclimatization.

[0093] Then, the well-grown bacterial cultures after six cycles of acclimatization were serially diluted and inoculated onto medium supplemented with neutral red. The cultures were then incubated at 30 °C for 48 hours, and the colonies were observed to see if they turned red. If they turned red, it indicated that the strain could degrade oils and produce fatty acids.

[0094] The reddened colonies were screened, picked up with an inoculation loop and streaked to separate them. The purified strains were stored in beef extract peptone solid slant medium for later use.

[0095] The enrichment culture medium used included a basal culture medium and soybean oil at varying concentrations. The basal culture medium consisted of: 0.1 g MgSO4·7H2O, 1.0 g (NH4)2SO4, 0.3 g KH2PO4, 1.5 g K2HPO4, 5.0 g NaCl, 1000 mL deionized water, and a pH of 7.0–7.2. The soybean oil at varying concentrations (using soybean oil as the sole carbon source for gradient screening and domestication of microorganisms) increased in concentration with each domestication cycle (as shown above).

[0096] The formula for the beef extract peptone solid culture medium used is as follows: 5 g beef extract, 5 g NaCl, 10 g peptone, 20 g agar powder, 1000 mL deionized water, pH 7.0. It includes both plate and slant agar plates.

[0097] The culture medium containing neutral red used was formulated as follows: 1 mL of 1.6% (mass fraction) neutral red aqueous solution and 5.0 g of soybean oil were added to beef extract peptone solid medium.

[0098] Six microorganisms were obtained through screening using the above method, including three bacteria and three fungi, among which *Xanthomonas quassinoides* was found. Luteibacter rhizovicinus It was deposited on July 5, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 27740; *Monophora cylindrica*. Simplellium cylindrosporum It was deposited on July 5, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 40761; Fusarium moniliforme. Fusarium proliferatum It was deposited on November 20, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 40988. Simplicillium lanosoniveum It was deposited on November 20, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 40987. *Agrobacterium tumefaciens* Agrobacterium tumefaciens The 16S rDNA sequence of *Pseudomonas curvatureis* is shown in SEQ ID NO:1. Pseudomonas geniculata The 16S rDNA sequence is shown in SEQ ID NO:2.

[0099] Example 2

[0100] Because natural composting requires large-scale operations, researching microbial formulations necessitates extensive inoculum, resulting in high costs and low formulation efficiency. This study employed a small-scale fermentation system for composting and microbial formulation experiments. This system includes a small fermenter connected to an automated programmable temperature control chamber, an air supply system, and a water supply system to ensure adequate air and water supply and temperature regulation. The temperature control chamber can be set to multiple temperature stages according to actual composting conditions and maintain each temperature stage for a specific time period, simulating real temperature changes during composting.

[0101] Two composting simulation experiments were conducted using a small-scale fermentation model system, in which three bacterial strains were used: Agrobacterium tumefaciens (B1) Pseudomonas geniculata (B2), and Yellow-bellied rhizovicin (B3), and 3 fungi: Simplicillium cylindrosporum (F1) Fusarium proliferated (F2), and Simplicillium lanosoniveum (F3). *Agrobacterium tumefaciens* and *Pseudomonas curvatureii*, as shown in Example 1 above, were obtained through purchase. Verification showed that both the purchased *Agrobacterium tumefaciens*, *Pseudomonas curvatureii*, and other microorganisms, as well as the combinations shown in SEQ ID NO:1 and SEQ ID NO:2, exhibited lipid degradation efficacy. The following examples only illustrate the results using *Agrobacterium tumefaciens* and *Pseudomonas curvatureii* (SEQ ID NO:1 and SEQ ID NO:2) shown in Example 1 above.

[0102] The first step is within the group, which means optimizing the ratio of three bacteria or three fungi;

[0103] The second step is the inter-group formulation, which involves optimizing the ratio of bacteria and fungi between groups based on the optimal intra-group combination.

[0104] Detailed temperature settings are shown in Table 1. The first bacterial agent compounding in Table 1 is divided into eight stages. The temperature of the first stage is 30℃, and it runs for 1 day, and so on. The second bacterial agent compounding is divided into seven stages. The temperature of the first stage is 35℃, and it runs for 1 day, and so on.

[0105] Table 1. Programmable Temperature Control

[0106]

[0107] The kitchen waste used in the two rounds of composting simulation experiments was collected from the canteen of the Planning and Design Institute of the Ministry of Agriculture and Rural Affairs. Corn stalks were purchased and cut into 1-2 cm sizes. The initial material conditions for the two experiments are shown in Table 2. The material filling volume of each fermentation tank was approximately 600 mL. During the fermentation process, the ventilation rate was maintained at 0.5 L / (min·kg) dry weight, and the ventilation system was operated on and off for 30 minutes at a time.

[0108] Table 2 Initial material conditions for the two experiments

[0109]

[0110] The mixed design of the experiments was determined using Design Expert 13. The specific designs of the two experiments are shown in Table 3, totaling 14 groups. The independent variable was the amount of each strain added, and the target response was lipid degradation efficiency. Based on the substrate volume, the inoculum level in both experiments was approximately 1%, equivalent to a total inoculum volume of 6 mL, meaning the total amount of strains added was 6 mL, with each strain added ranging from 0 to 6 mL. The cell concentration of all six strains was adjusted to 1.0 × 10¹. 0 CFU / mL.

[0111] Table 3

[0112]

[0113] Oil degradation mostly occurs during the high-temperature period of composting, and changes become less noticeable in the later stages. Therefore, to improve experimental efficiency, analyzing data from 27 days prior is sufficient to illustrate the oil degradation situation.

[0114] In this experiment, 50 g of uniform compost samples were collected on days 0, 3, 7, 20, and 27 of composting and returned to the laboratory for refrigeration. The samples were used to test physicochemical properties and were stored at 4°C.

[0115] The lipid degradation efficiency of each group is shown in Table 4. In terms of average lipid degradation efficiency, the fungal group > bacterial group > bacterial-fungal group. This is because in the first experiment, the bacterial and fungal groups used the same initial material with a lipid content of 11.93%, while in the second experiment, the initial material had a lipid content of 27.87%. Higher lipid content makes degradation more difficult. The actual lipid degradation amount was slightly higher in the bacterial-fungal group than in the fungal group.

[0116] Table 4

[0117]

[0118] Based on the oil degradation efficiency, the fitting results are shown in Table 5. The analysis of variance results show that the actual R... 2All three models exceeded 95%, indicating that they fit the actual data well. Furthermore, R... 2 The difference between the adjusted value and the predicted value is no more than 0.2, indicating that all three fitting equations have good statistical significance.

[0119] Table 5. Polynomial equations for the three groups of microbial agent compound experiments.

[0120]

[0121] The results obtained through response surface fitting are as follows: Figure 1~6 As shown. Among them Figure 1 , 2 3 and 3 represent the lipid degradation efficiency of the bacterial group, fungal group, and bacterial-fungal group response values, respectively. Figure 4 , 5 6 represents the expected value for the bacterial group, fungal group, and bacterial-fungal group, respectively, and the highest point of each surface or curve represents the optimal solution. The results of the three sets of experiments show that the optimal ratio for the bacterial group is 2.30 mL. A. swelling 1.57 mL P. geniculata and 2.13 mL L. rhizovicinus The corresponding optimal lipid degradation efficiency was 31.47%; the optimal ratio for the fungal group was 1.82 mL. S. cylindrosporum 1.93 mL F. proliferatum and 2.25 mL S. lanosoniveum The optimal lipid degradation efficiency was 44.13%; the optimal ratio of bacteria and fungi was 1.85 mL of bacteria and 4.15 mL of fungi, with an optimal lipid degradation efficiency of 20.08%.

[0122] Example 3

[0123] Example 3 validated the compound microbial agent of Example 2 using compost, including:

[0124] The experiment was conducted in a self-developed 60 L fermenter (400 mm in diameter and 450 mm in height), using a mixture of kitchen waste and corn stalks as compost (the wet weight ratio of kitchen waste to corn stalks was 4:1, the moisture content was approximately 55-65%, the carbon-to-nitrogen ratio (C / N) was 20-30, and the pH was 4-7). To facilitate turning the compost, the material filling rate was approximately 80%, therefore the actual material volume was approximately 48 L.

[0125] Four experimental groups were set up: blank control (CK), inoculated with compound bacteria, inoculated with compound fungi, and inoculated with compound bacteria-fungus. The activity of all six bacterial suspensions was adjusted to 2×10⁶. 12 The CFU / mL inoculum concentration was the same as that in Example 1, and the inoculum concentration was 5% (w / w).

[0126] Experimental Group 1: Using bacterial solution as inoculum, the inoculum ratio was 38.3% (v / v). A. tumefaciens 26.1% (v / v) P. geniculata, And 35.5% (v / v) L. rhizovicinus ;

[0127] Experimental group 2: Using fungal solution as inoculum 30.3% (v / v) S. cylindrosporum, 32.2% (v / v) F. proliferatum, And 37.5% (v / v) S. lanosoniveum ;

[0128] Experimental group 3: Using a bacterial-fungal mixed microbial solution as an inoculum, 11.83% (v / v) A. swelling 8.10% (v / v) P. geniculata 10.97% (v / v) L. rhizovicinus 20.9% (v / v) S. cylindrosporum 22.3% (v / v) F. proliferatum , and 25.9% (v / v) S. woolly ;

[0129] Blank control group: No microbial agents were applied.

[0130] During fermentation, the ventilation rate of the compost pile was maintained at 0.2 L / (min·kg) dry matter. At days 0, 3, 7, 14, 21, 28, 35, and 42 of composting, 200 g homogeneous compost samples were collected from the top, middle, and bottom of the fermenter to determine oil degradation efficiency. The ventilation system, controlled by a time relay, operated on a 30-minute ventilation, 30-minute shutdown cycle throughout the fermentation process.

[0131] The results showed that after 42 days of fermentation, with an initial oil content of 20%, the oil degradation rate was 44.3% in the blank control group, 56.8% in the bacterial inoculation group, 66.5% in the fungal inoculation group, and 75.6% in the bacterial-fungal inoculation group. The bacterial-fungal inoculation group had the strongest oil degradation ability, indicating that the compounding results of Example 1 were relatively accurate and verifying that it is feasible to use the simple centroid method to compound the bacterial agent.

[0132] In the description of this specification, references to terms such as "one embodiment," "some embodiments," "example," "detailed description," or "some examples," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example.

[0133] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A composite microorganism for the aerobic composting and oil degradation of kitchen waste, characterized in that, include: Agrobacterium tumefaciens Agrobacterium tumefaciens Curvular Pseudomonas Pseudomonas geniculata Near root flavobacterium Luteibacter rhizovicinus Cylindrica monopermanente Simplicillium cylindrosporum Fusarium moniliforme Fusarium proliferatum ,and Simplicillium lanosoniveum ; The *Acinetobacter irradiata* Luteibacter rhizovicinus It was deposited on July 5, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 27740. The Cyclosporium monopergenum Simplicillium cylindrosporum It was deposited on July 5, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 40761. The exfoliated Fusarium Fusarium proliferatum It was deposited on November 20, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 40988. The Simplicillium lanosoniveum It was deposited on November 20, 2023, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 40987.

2. The composite microorganism according to claim 1, characterized in that, The Agrobacterium tumefaciens Agrobacterium tumefaciens The activity is not less than 10 10 CFU / mL; The curved Pseudomonas Pseudomonas geniculata The activity is not less than 10 10 CFU / mL; The *Acinetobacter irradiata* Luteibacter rhizovicinus The activity is not less than 10 10 CFU / mL; The Cyclosporium monopergenum Simplicillium cylindrosporum The activity is not less than 10 10 CFU / mL; The exfoliated Fusarium Fusarium proliferatum The activity is not less than 10 10 CFU / mL; The Simplicillium lanosoniveum The activity is not less than 10 10 CFU / mL.

3. The composite microorganism according to claim 1, characterized in that, The Agrobacterium tumefaciens Agrobacterium tumefaciens The 16S rDNA sequence is shown in SEQ ID NO:

1. The curved Pseudomonas Pseudomonas geniculata The 16S rDNA sequence is shown in SEQ ID NO:

2. The *Acinetobacter irradiata* Luteibacter rhizovicinus The 16S rDNA sequence is shown in SEQ ID NO:

3. The Cyclosporium monopergenum Simplicillium cylindrosporum The 18S rDNA sequence is shown in SEQ ID NO:

4. The exfoliated Fusarium Fusarium proliferatum The 18S rDNA sequence is shown in SEQ ID NO:

5. The Simplicillium lanosoniveum The 18S rDNA sequence is shown in SEQ ID NO:

6.

4. A compound microbial agent for the aerobic composting and oil degradation of kitchen waste, characterized in that, include: Agrobacterium tumefaciens Agrobacterium tumefaciens Inoculant, Pseudomonas curvatureii Pseudomonas geniculata Inoculant, *Bacillus repens* Luteibacter Inoculant, Cyclospora monophylla Simplicillium cylindrosporum Inoculant, Fusarium moniliforme Fusarium proliferatum Bacterial agents, and Simplicillium lanosoniveum Bacterial agent.

5. The compound microbial agent according to claim 4, characterized in that, Based on the volume fraction with the same number of live bacteria, The Agrobacterium tumefaciens Agrobacterium tumefaciens The amount of bacterial agent is 10-20 parts; The curved Pseudomonas Pseudomonas geniculata The amount of bacterial agent is 5-15 parts; The *Acinetobacter irradiata* Luteibacter rhizovicinus The amount of bacterial agent is 8-18 parts; The Cyclosporium monopergenum Simplicillium cylindrosporum The amount of bacterial agent is 15-30 parts; The exfoliated Fusarium Fusarium proliferatum The amount of bacterial agent is 18-30 parts; The Simplicillium lanosoniveum The amount of bacterial agent is 20-30 parts.

6. The compound microbial agent according to claim 4, characterized in that, The Agrobacterium tumefaciens Agrobacterium tumefaciens In bacterial agents Agrobacterium tumefaciens The number of active units is not less than 10 10 CFU / mL; The curved Pseudomonas Pseudomonas geniculata In bacterial agents Pseudomonas geniculata The number of active units is not less than 10 10 CFU / mL; The *Acinetobacter irradiata* Luteibacter rhizovicinus In bacterial agents Luteibacter rhizovicinus The number of active units is not less than 10 10 CFU / mL; The Cyclosporium monopergenum Simplicillium cylindrosporum In bacterial agents Simplicillium cylindrosporum The number of active units is not less than 10 10 CFU / mL; The exfoliated Fusarium Fusarium proliferatum In bacterial agents Fusarium proliferatum The number of active units is not less than 10 10 CFU / mL; The Simplicillium lanosoniveum In bacterial agents Simplicillium lanosoniveum The number of active units is not less than 10 10 CFU / mL.

7. A method for aerobic composting and oil degradation of kitchen waste, characterized in that, include: Mix the compound microorganisms as described in any one of claims 1 to 3 or the compound microbial agent as described in any one of claims 4 to 6 with kitchen waste and straw to form a mixed compost. The mixed compost is fermented to degrade the grease in the kitchen waste.

8. The method according to claim 7, characterized in that, Assuming the oil content in the kitchen waste is 15% to 25%, after 42 days of fermentation, the oil will be degraded by at least 60%.

9. The application of the composite microorganisms according to any one of claims 1 to 3 or the composite microbial agents according to any one of claims 4 to 6 in the field of aerobic composting and oil degradation of kitchen waste.

Images