A pCAMBIA1300-miniRNA3-BC-NLP Pya Vectors and construction methods and their application in high resistance to cucumber mosaic virus

By constructing the pCAMBIA1300-miniRNA3-BC-NLPPya vector, the NLPPya protein was used to form pores on the plasma membrane to activate plant defense, thus solving the problem of cucumber mosaic virus infection and achieving efficient and green virus control.

CN120505357BActive Publication Date: 2025-11-14INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510722705.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-30
Publication Date
2025-11-14
Estimated Expiration
2045-05-30

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively control cucumber mosaic virus infection without affecting plant growth, and traditional methods may lead to environmental pollution and drug resistance problems.

Method used

The pCAMBIA1300-miniRNA3-BC-NLPPya vector was constructed. By efficiently inducing NLPPya protein expression in plants, the protein forms transient pores on the plasma membrane, leading to cell necrosis and thereby activating the plant's defense mechanism against viral infection.

Benefits of technology

This study achieves efficient inhibition of cucumber mosaic virus infection without affecting plant growth, providing a green, drug-free disease resistance strategy that reduces viral damage without inducing drug resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120505357B_ABST
    Figure CN120505357B_ABST
Patent Text Reader

Abstract

This invention discloses a pCAMBIA1300-miniRNA3-BC-NLP Pya Vector and construction method and its application in high resistance to cucumber mosaic virus: The vector is miniRNA3-BC-NLP. Pya Construct the pCAMBIA1300 vector backbone, containing miniRNA3-BC and NLP. Pya The gene sequences are shown in SEQ ID NO:2 and 5. This invention discovered miniRNA3-BC-NLP. Pya It can effectively inhibit CMV infection and reduce the harm caused by CMV without the need for any drugs. It is a highly efficient and green disease control technology that can provide a new strategy for the prevention and control of cucumber mosaic virus and similar viruses.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a pCAMBIA1300-miniRNA3-BC-NLP. Pya Vectors, construction methods, and their application in highly resistant cucumber mosaic virus. Background Technology

[0002] Cucumber mosaic virus (CMV) is one of the most damaging plant viruses, belonging to the genus *Cucumovirus* within the family Bromoviridae. CMV virus particles have an icosahedral symmetry structure, approximately 29 nanometers in diameter, and their genome consists of three single-stranded positive-sense RNAs (RNA1, RNA2, and RNA3). RNA1-encoded RNA1a and RNA2-encoded RNA2a together form the viral replicase complex, responsible for viral genome replication. RNA2-encoded RNA2b is a multifunctional protein that acts as a gene silencing repressor. RNA3-encoded MP protein is responsible for viral motility. RNA3-encoded CP protein encapsulates the viral RNA to form protective viral particles. This virus has a wide host range, infecting over 1200 species of dicotyledonous and monocotyledonous plants, including many important economic crops such as cucumber, tomato, pepper, tobacco, and banana. CMV is primarily transmitted non-persistently by aphids, but can also be spread through mechanical contact and seeds. After viral infection, typical symptoms in plants include mosaic patterns, yellowing, leaf deformities, and stunting, which can lead to yield reductions of 30%-100% in severe cases. This virus exhibits significant genetic diversity, and multiple strains have been identified. Novel control methods based on molecular technologies such as RNA interference and gene editing can avoid problems such as environmental pollution and drug resistance, achieving disease resistance.

[0003] The double-stranded RNA structure upstream of the start codon uAUG in TBF1 mRNA (uAUG-ds) inhibits protein translation, while immune-induced RNA helicase can unwind uAUG-ds, promoting the translation of defense proteins. The 5'UTR region of TBF1 contains uAUG-ds, named B-uAUG-ds (containing 105 nucleotides). Class 1 uAUG-ds are named C-uAUG-ds (containing 54 nucleotides). B-uAUG-ds and C-uAUG-ds tandemly are named BC-uAUG-ds. NLP from the plant pathogenic oomycete *Pythium aphanidermatum* PyaProteins can form transient pores in lipid membranes, leading to membrane breakdown and cell lysis, activating plant defense gene expression, and ultimately inducing cell necrosis. This plant defense activation mechanism triggered by cell damage is similar to the activation process of inflammasomes in vertebrates. This invention enables the specific induction of immune-related protein expression by pathogen infection, thereby conferring plant resistance without affecting plant growth. Summary of the Invention

[0004] The purpose of this invention is to provide a pCAMBIA1300-miniRNA3-BC-NLP Pya Vectors and construction methods, and their application in highly resistant cucumber mosaic virus (CMV). This invention discovers a highly efficient CMV-induced miniRNA3-BC-NLP. Pya Controlled NLP Pya Highly efficient expression, thereby enabling miniRNA3-BC-NLP Pya Imparting high resistance to CMV infection to Arabidopsis thaliana is of great significance for the prevention and control of CMV and also provides a reference for the prevention and control of viruses.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] A pCAMBIA1300-miniRNA3-BC-NLP Pya The method for constructing the carrier includes the following steps:

[0007] (1) MiniRNA3 and miniRNA3-BC were artificially synthesized, and their sequences are shown in SEQ ID NO: 1-2. The 5'UTR region of TBF1 contains uAUG-ds, named B-uAUG-ds (105nt). The Class 1 uAUG-ds containing 54nt is named C-uAUG-ds. The concatenation of B-uAUG-ds and C-uAUG-ds is named BC-uAUG-ds, and its sequence is shown in SEQ ID NO: 3. Using the artificially synthesized miniRNA3 and miniRNA3-BC as templates, a specific PCR band was obtained using primer F / R-miniRNA3. The sequence of F / R-miniRNA3 is shown in SEQ ID NO: 6-7;

[0008] F-miniRNA3:GAAGTTTCATTTCATTTGGAGAGG gtaatcttaccactgtgtgtgtg

[0009] R-miniRNA3:TACGAACGAAAGCTCGGATCC agctctcccttagccatccg

[0010] The PCR target band was constructed into the pCAMBIA1300 vector linearized with SacI and BamHI to obtain vectors containing pCAMBIA1300-miniRNA3 and miniRNA3-BC.

[0011] (2) To clarify whether CMV efficiently induces the expression of proteins controlled by miniRNA3-BC, GFP, which emits green fluorescent protein under ultraviolet light, was used as a candidate protein to evaluate the effect of CMV-induced expression. Using TMV-GFP as a template, the GFP nucleotide sequence was amplified using primers F-GFP / R-GFP, resulting in a specific PCR band; the GFP sequence is shown in SEQ ID NO: 4. The sequences of F-GFP / R-GFP are shown in SEQ ID NO: 9-10:

[0012] F-GFP: CAGTTTGCTGCTACTTCTGGT ATGGCAAGTAAAGGAGAAGAAC

[0013] R-GFP: CTAATTAAGTTTCGAGTGTTTTATTTGTATAGTTCATCCATGCCA

[0014] The PCR fragment of GFP was constructed into the pCAMBIA1300 vector linearized with MluI and XbaI to obtain the vectors pCAMBIA1300-miniRNA3-GFP and miniRNA3-BC-GFP.

[0015] (3) The vectors pCAMBIA1300-miniRNA3-GFP and miniRNA3-BC-GFP were transformed into EHA105 Agrobacterium competent cells. Positive Agrobacterium colonies were identified using primers F-GFP / R-pCAM, and the sequences are shown in SEQ ID NO: 9 and 8. Agrobacterium containing pCAMBIA1300-miniRNA3-GFP and miniRNA3-BC-GFP were inoculated into tobacco leaves. The GFP fluorescence intensity, GFP protein accumulation, and GFP mRNA level confirmed that miniRNA3-BC-GFP could more effectively inhibit GFP protein accumulation and could efficiently initiate GFP expression via CMV.

[0016] (4) Using artificially synthesized NLP Pya As a template, primer F-NLP was used. Pya / R-NLP PyaAmplifying NLP Pya Nucleotide sequence analysis yielded a specific PCR band; NLP Pya The sequence is shown in SEQ ID NO: 5. F-NLP Pya / R-NLP Pya Its sequence is shown in SEQ ID NO: 11-12:

[0017] F-NLP Pya :aattgagtcgagtcACGCGT ATGGTGAGGTTTGTTAGCGCATTG

[0018] R-NLP Pya :ctgggaacacggaaTCTAGATCA TTGAAAGAAAGCCTTCACGAGTTTATC

[0019] NLP Pya The PCR fragment was constructed into the pCAMBIA1300 vector linearized with MluI and XbaI to obtain pCAMBIA1300-miniRNA3-BC-NLP. Pya The carrier.

[0020] The pCAMBIA1300-miniRNA3-BC-NLP of this invention Pya The application of the vector in highly resistant cucumber mosaic virus is as follows:

[0021] (1) The pCAMBIA1300-miniRNA3-BC-NLP Pya Agrobacterium and Agrobacterium containing EV (empty vector) or CMV were co-inoculated onto tobacco leaves. Results showed that 2.5 days post-inoculation, NLP controlled by miniRNA3-BC increased. Pya It can be specifically induced by CMV and cause cell necrosis, thus giving plants resistance to CMV infection.

[0022] (2) Use the dip-flower method to transfer miniRNA3-BC-NLP Pya Transforming Arabidopsis thaliana to prepare transgenic plants, the obtained miniRNA3-BC-NLP Pya Positive transgenic plants. Observations 20 days after inoculation revealed that, compared to healthy plants, both Col-0 and miniRNA3-BC-GFP transgenic Arabidopsis thaliana inoculated with CMV exhibited typical CMV symptoms (mosaic and dwarfism) in their systemic leaves. Meanwhile, miniRNA3-BC-NLP inoculated with CMV... PyaThe transgenic Arabidopsis showed no systemic viral symptoms in its leaves, and its phenotype was completely identical to that of healthy Col-0 plants. qRT-PCR analysis revealed significantly higher CMV RNA accumulation in Col-0 and miniRNA3-BC-GFP transgenic Arabidopsis, while it was significantly higher in CMV-inoculated miniRNA3-BC-NLP transgenic Arabidopsis. Pya CMV mRNA was not detected in transgenic Arabidopsis.

[0023] Compared with the prior art, the outstanding effect of the present invention is as follows:

[0024] This invention realizes miniRNA3-BC-NLP Pya It does not induce cell necrosis, while CMV infection can efficiently induce NLP. Pya The expression of this gene induces cell necrosis, leading to the discovery of miniRNA3-BC-NLP. Pya It can effectively inhibit CMV infection and reduce the harm caused by CMV without the need for any drugs. It is a highly efficient and green disease control technology that can provide a new strategy for the prevention and control of cucumber mosaic virus and similar viruses.

[0025] The following description, in conjunction with the accompanying drawings and specific embodiments, illustrates the pCAMBIA1300-miniRNA3-BC-NLP of the present invention. Pya The vector and construction method, as well as their application in highly resistant cucumber mosaic virus, will be further explained. Attached Figure Description

[0026] Figure 1 This is a schematic diagram of miniRNA3 and its derived vectors.

[0027] (A) Schematic diagram of the CMV genome.

[0028] (B) Schematic diagram of miniRNA3-related vectors. The blue lines represent the viral sequence of CMV RNA3.

[0029] MiniRNA3 consists of the 5' UTR of CMV RNA3, the first 102 nucleotides of the MP protein, the subgenomic promoter sGP618 of CP, and a 3' untranslated region, with a total length of 1,160 nucleotides. Restriction endonuclease sites MluI and XbaI are located downstream of sGP618. The 5' UTR region of TBF1 contains uAUG-ds, named B-uAUG-ds (105 nt). A Class 1 uAUG-ds containing 54 nt is named C-uAUG-ds. The concatenation of B-uAUG-ds and C-uAUG-ds is named BC-uAUG-ds. The purple square at the 3' end represents HDV-RZ.

[0030] Figure 2 This study aimed to efficiently induce the expression of GFP protein under the control of miniRNA3-BC through CMV infection.

[0031] (A) GFP fluorescence intensity shows that CMV induces miniRNA3-BC-GFP to produce bright GFP. The sample carrying miniRNA3-BC-GFP (OD) 600 Agrobacterium (=0.5) and those carrying empty vectors (EV) or CMV (final OD of each viral chain) 600 =0.2, total OD 600 Agrobacterium (0.6%) was co-infiltrated into leaves of *Nicotiana benthamiana*. Two days after inoculation, the infiltrated leaves were photographed under ultraviolet light using a yellow filter, followed by Western blot and qRT-PCR analysis. GFP and miniRNA3-GFP were used as controls in the experiment.

[0032] (B) Western blot analysis confirmed that CMV induces high expression of GFP protein in miniRNA3-BC-GFP. Two days after inoculation, samples were tested using anti-GFP, anti-Actin, and anti-CMV CP antibodies, with Actin serving as a control. The GFP protein accumulation shown in the left-hand image was quantitatively analyzed using IMAGEJ software and expressed as mean ± standard error (SEM, n=3). Significant differences were determined using Duncan's multiple range test (P<0.05, using IBM SPSS STATISTICS software).

[0033] (C)qRT-PCR validated the efficient transcription of GFP mRNA induced by CMV under the control of miniRNA3-BC-GFP. Error bars represent mean ± standard deviation (SD) (n = 3 biological replicates).

[0034] Figure 3 miniRNA3-BC-NLP Pya It endows Arabidopsis thaliana with high resistance to CMV.

[0035] (A) CMV efficiently induces miniRNA3-BC-NLP Pya Controlled NLP Pya It expresses and induces cell necrosis.

[0036] (B) CMV inoculation of wild-type Arabidopsis thaliana and miniRNA3-BC-NLP Pya Symptoms of transgenic Arabidopsis thaliana plants after 20 days, with the scale indicating a distance of 2cm.

[0037] (C) Wild-type and miniRNA3-BC-NLP inoculated with CMV PyaqRT-PCR detection in Arabidopsis thaliana revealed miniRNA3-BC-NLP. Pya The mRNA level of CMV in Arabidopsis thaliana was significantly lower than that in wild type, reaching almost undetectable levels. The significance of the difference was determined by Duncan's multiple range test (P<0.05, using IBM SPSS STATISTICS software). Detailed Implementation

[0038] A pCAMBIA1300-miniRNA3-BC-NLP Pya The construction of the vector and its application in highly resistant cucumber mosaic virus are as follows:

[0039] (a) MiniRNA3 and miniRNA3-BC were artificially synthesized, and their sequences are shown in SEQ ID NO: 1-2. The 5'UTR region of TBF1 contains uAUG-ds, named B-uAUG-ds (105nt). The Class 1 uAUG-ds containing 54nt is named C-uAUG-ds. The concatenation of B-uAUG-ds and C-uAUG-ds is named BC-uAUG-ds, and its sequence is shown in SEQ ID NO: 3.

[0040] (ii) Using artificially synthesized miniRNA3 and miniRNA3-BC as templates, a specific PCR band was obtained using primer F / R-miniRNA3; the specific PCR target band was purified by agarose gel electrophoresis and then excised from the gel. The sequence of F / R-miniRNA3 is shown in SEQ ID NO: 6-7;

[0041] F-miniRNA3:GAAGTTTCATTTCATTTGGAGAGG gtaatcttaccactgtgtgtgtg

[0042] R-miniRNA3:TACGAACGAAAGCTCGGATCC agctctcccttagccatccg

[0043] The target PCR band was constructed into the SacI and BamHI-linearized pCAMBIA1300 vector and transformed into DH5α competent E. coli cells. The identification primers were F-miniRNA3 / R-pCAM. Correct clones were then amplified.

[0044] Plasmids were extracted and sequenced using R-pCAM primers. The sequence is shown in SEQ ID NO: 8.

[0045] R-pCAM: CACAGTAAATTACAAGCACAAC

[0046] This yields vectors containing pCAMBIA1300-miniRNA3 and pCAMBIA1300-miniRNA3-BC, as follows: Figure 1 As shown.

[0047] (III) To clarify whether CMV efficiently induces the expression of proteins controlled by miniRNA3-BC, GFP, which emits green fluorescent protein under ultraviolet light, was used as a candidate protein to evaluate the effect of CMV-induced expression.

[0048] 1. Using TMV-GFP as a template, the GFP nucleotide sequence was amplified using primers F-GFP / R-GFP to obtain a specific PCR band. The specific PCR target band was purified by agarose gel electrophoresis and gel extraction. The GFP sequence is shown in SEQ ID NO: 4. The sequences of F-GFP / R-GFP are shown in SEQ ID NO: 9-10.

[0049] F-GFP: CAGTTTGCTGCTACTTCTGGT ATGGCAAGTAAAGGAGAAGAAC

[0050] R-GFP: CTAATTAAGTTTCGAGTGTTTTATTTGTATAGTTCATCCATGCCA

[0051] 2. 600 ng pCAMBIA1300-miniRNA3 and miniRNA3-BC plasmids, 1 μL MluI, 1 μL XbaI, 2 μL 10×FastDigest Green Buffer; the remaining volume was adjusted to 20 μL with ddH2O; digestion was performed at 37℃ for 4 h, followed by 80℃ for 10 min, and then frozen at -20℃.

[0052] 3. Digest 1 μL of the backbone of pCAMBIA1300-miniRNA3 and pCAMBIA1300-miniRNA3-BC plasmids with MluI and XbaI, add 2 μL of the fragment amplified by F-GFP / R-GFP, 5 μL of 2×Master Assembly Mix from Sino-American Taihe Company, and bring the total volume to 10 μL with ddH2O. Incubate at 50℃ for 15 min.

[0053] 4. Transform 10 μL of the ligation product into Escherichia coli DH5α, use kanamycin as an antibiotic selection molecule, select single clones for colony PCR identification and sequencing to confirm whether the fragment has been ligated into the vector.

[0054] Identify the primers F-GFP / R-pCAM, with sequences shown in SEQ ID NO: 9 and 8; expand the correct clones, extract plasmids, and sequence them using R-pCAM primers.

[0055] This yields a vector containing pCAMBIA1300-miniRNA3-GFP and pCAMBIA1300-miniRNA3-BC-GFP, as follows: Figure 1 As shown.

[0056] (iv) The vectors pCAMBIA1300-miniRNA3-GFP and pCAMBIA1300-miniRNA3-BC-GFP were transformed into EHA105 Agrobacterium competent cells. Positive Agrobacterium colonies were identified using primers F-GFP / R-pCAM, with sequences shown in SEQ ID NOs: 9 and 8. Agrobacterium cells containing pCAMBIA1300-miniRNA3-GFP and miniRNA3-BC-GFP were inoculated into tobacco leaves. Two days after injection, as... Figure 2 As shown in Figure A, compared to EV, CMV induced strong GFP fluorescence and high levels of GFP protein accumulation in regions inoculated with miniRNA3-GFP or miniRNA3-BC-GFP. Figure 2 AB), although the GFP mRNA level of miniRNA3-BC-GFP is lower than that produced by miniRNA3-GFP ( ). Figure 2 C). Western blot and qRT-PCR analyses showed that, under CMV-free conditions, miniRNA3-BC-GFP did not affect GFP mRNA levels compared to miniRNA3-GFP, but further reduced GFP protein accumulation. Figure 2 B-2C).

[0057] (v) Because miniRNA3-BC-GFP can more effectively inhibit the accumulation of GFP protein and can initiate GFP expression through CMV, pCAMBIA1300-miniRNA3-BC is selected to be incorporated into NLP. Pya .

[0058] 1. Using artificially synthesized NLP Pya As a template, primer F-NLP was used. Pya / R-NLP Pya Amplifying NLP Pya Nucleotide sequences were analyzed to obtain a specific PCR band; the specific PCR target band was purified by agarose gel electrophoresis and gel extraction; NLP Pya The sequence is shown in SEQ ID NO: 5. F-NLP Pya / R-NLP Pya Its sequence is shown in SEQ ID NO: 11-12:

[0059] F-NLP Pya :aattgagtcgagtcACGCGT ATGGTGAGGTTTGTTAGCGCATTG

[0060] R-NLP Pya :ctgggaacacggaaTCTAGATCATTGAAAGAAAGCCTTCACGAGTTTATC

[0061] 2. 600 ng pCAMBIA1300-miniRNA3-BC plasmid, 1 μL MluI, 1 μL XbaI, 2 μL 10×FastDigestGreen Buffer; the remaining volume was adjusted to 20 μL with ddH2O; digested at 37℃ for 4 h, then at 80℃ for 10 min, and frozen at -20℃.

[0062] 3. 1 μL of the pCAMBIA1300-miniRNA3-BC plasmid backbone was digested with MluI and XbaI, and then processed by F-NLP. Pya / R-NLP Pya 2 μL of the amplified fragment, 5 μL of 2×Master Assembly Mix from Sino-American Taihe Company, and ddH2O were added to bring the total to 10 μL. The mixture was reacted at 50 °C for 15 min.

[0063] 4. Transform 10 μL of the ligation product into Escherichia coli DH5α, use kanamycin as an antibiotic selection molecule, select single clones for colony PCR identification and sequencing to confirm whether the fragment has been ligated into the vector.

[0064] Identification primer F-NLP Pya / R-pCAM, sequences as shown in SEQ ID NO: 11 and 8; the correct clone was cultured, plasmids were extracted, and sequenced using R-pCAM primers.

[0065] Thus, pCAMBIA1300-miniRNA3-BC-NLP was obtained. Pya carriers, such as Figure 1 As shown.

[0066] (vi) Containing pCAMBIA1300-miniRNA3-BC-NLP Pya Agrobacterium and Agrobacterium containing EV (empty vector) or CMV were co-inoculated onto tobacco leaves. Results showed that 2.5 days after inoculation, miniRNA3-BC-NLP... PyaLeaves co-inoculated with EV did not induce cell necrosis, while leaves co-inoculated with CMV showed obvious cell necrosis. Figure 3 As shown in Figure A, this indicates NLP regulated by miniRNA3-BC. Pya It can be specifically induced by CMV, which may confer resistance to CMV infection in plants.

[0067] (vii) Using the dip-flower method to transfer pCAMBIA1300-miniRNA3-BC-NLP Pya Transforming Arabidopsis thaliana to prepare transgenic plants, the obtained miniRNA3-BC-NLP Pya Positive transgenic plants #5 and #11. CMV was inoculated into miniRNA3-BC-NLP via mechanical inoculation. Pya Transgenic Arabidopsis thaliana, Col-0 wild-type, and miniRNA3-BC-GFP transgenic Arabidopsis thaliana were observed 20 days after inoculation. Compared with healthy plants, the systemic leaf symptoms (mosaic and dwarfism) of Col-0 and miniRNA3-BC-GFP transgenic Arabidopsis thaliana inoculated with CMV were observed. Meanwhile, the miniRNA3-BC-NLP transgenic Arabidopsis thaliana inoculated with CMV... Pya The transgenic Arabidopsis thaliana showed no systemic viral symptoms in its leaves, and its phenotype was completely identical to that of healthy Col-0 plants. Figure 3 As shown in Figure B. qRT-PCR analysis revealed significantly higher CMV RNA accumulation in Col-0 and miniRNA3-BC-GFP transgenic Arabidopsis thaliana, while it was lower in CMV-inoculated miniRNA3-BC-NLP. Pya CMV mRNA was not detected in transgenic Arabidopsis thaliana, such as Figure 3 As shown in C. These results indicate that miniRNA3-BC-NLP Pya It can confer resistance to CMV infection in Arabidopsis thaliana.

[0068] RNA was extracted using the Trizol method, and cDNA was obtained by reverse transcription. Using cDNA as a template, qRT-PCR was performed to detect GFP mRNA using primers qPCR-GFP-F / R, as shown in SEQ ID NO:13-14. CMV RNA levels were detected using primers qPCR-CMV-F / R, as shown in SEQ ID NO:15-16.

[0069] qPCR-GFP-F: CAATGTATACATCACGGCAGAC

[0070] qPCR-GFP-R:TTTCGAAAGGGCAGATTGTG

[0071] qPCR-CMV-F: TGTAAAGGATTCCGAGGTCA

[0072] qPCR-CMV-R:TCCTCCGAAGTCTAAGACGAG

[0073] Total protein from plants was extracted using the urea method, and GFP protein was detected by Western blot.

[0074] The above experimental results show that this invention utilizes miniRNA3, BC-uAUG-ds, and NLP. pya It endows Arabidopsis thaliana with high resistance to CMV infection.

[0075] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A pCAMBIA1300-miniRNA3-BC-NLP Pya The method for constructing a carrier is characterized by, Includes the following steps: (1) Using artificially synthesized miniRNA3-BC as a template, a specific PCR band was obtained using primer F / R-miniRNA3; the PCR target band was constructed into the pCAMBIA1300 vector linearized with SacI and BamHI to obtain the pCAMBIA1300-miniRNA3-BC vector; wherein, miniRNA3-BC is shown in SEQ ID NO:2; the sequence of F / R-miniRNA3 is shown in SEQ ID NO:6-7; F-miniRNA3:GAAGTTTCATTTCATTTGGAGAGG gtaatcttaccactgtgtgtgtg R-miniRNA3: TACGAACGAAAGCTCGGATCC agctctcccttagccatccg; (2) using artificially synthesized NLP Pya As a template, primer F-NLP was used. Pya / R-NLP Pya Amplifying NLP Pya Nucleotide sequences were analyzed to obtain a specific PCR band; among which, NLP... Pya The sequence is shown in SEQ ID NO: 5; F-NLP Pya / R-NLP Pya Its sequence is shown in SEQ ID NO: 11-12: F-NLP Pya :aattgagtcgagtcACGCGT ATGGTGAGGTTTGTTAGCGCATTG R-NLP Pya :ctgggaacacggaaTCTAGA TCA TTGAAAGAAAGCCTTCACGAGTTTATC NLP Pya The PCR fragment was constructed into the MluI and XbaI linearized pCAMBIA1300-miniRNA3-BC vector to obtain pCAMBIA1300-miniRNA3-BC-NLP. Pya The carrier.

2. The pCAMBIA1300-miniRNA3-BC-NLP obtained by the construction method of claim 1 Pya Carrier.

3. The pCAMBIA1300-miniRNA3-BC-NLP according to claim 2 Pya Application of vectors in the prevention and control of cucumber mosaic virus infection.

4. The pCAMBIA1300-miniRNA3-BC-NLP according to claim 3 Pya The application of the vector in the prevention and control of cucumber mosaic virus infection is characterized by: Agrobacterium containing the pCAMBIA1300-miniRNA3-BC-NLPPya vector was inoculated onto tobacco leaves.

5. The pCAMBIA1300-miniRNA3-BC-NLP according to claim 3 Pya The application of the vector in the prevention and control of cucumber mosaic virus infection is characterized by: Use the dip-flower method with pCAMBIA1300-miniRNA3-BC-NLP Pya Agrobacterium vector was used to transform Arabidopsis thaliana to prepare transgenic plants, obtaining pCAMBIA1300-miniRNA3-BC-NLP. Pya Positive transgenic plants.

Citation Information

Patent Citations

  • Cucumber mosaic virus induced gene silencing system and application thereof

    CN104388463A

  • KR20240072888A