Preparation method and application of nano-formulation for preventing and treating cucumber mosaic virus on melon
By using nano-formulations targeting the SLCCNV genome sequence and combining ZnO nanocarriers with dsRNA, the stability and cost issues in SLCCNV control were resolved, achieving efficient and green control of melons.
Patent Information
- Application Number
- CN202511627543.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-07
- Publication Date
- 2026-02-03
- Estimated Expiration
- 2045-11-07
AI Technical Summary
Existing technologies for controlling Chinese pumpkin leaf curl virus (SLCCNV) suffer from several drawbacks, including susceptibility to external interference, high labor costs, severe chemical pesticide contamination, and poor stability and short-term effectiveness of RNAi technology in natural environments.
A nano-formulation specifically targeting the SLCCNV genome sequence was developed. The target gene fragment DNA-A-AV2 was transcribed into dsRNA and combined with zinc oxide (ZnO) nanocarriers. The dsRNA was then applied to melon leaves and its stability and long-term sustained release were achieved through endocytosis, thereby enhancing the plant's disease resistance.
It achieves precise and efficient control of SLCCNV, enhances the disease resistance of melons, and the use of nanocarriers avoids pollution from chemical pesticides, is compatible with existing cultivation processes, and reduces costs.
Smart Images

Figure CN121065190B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of agricultural biotechnology, and relates to a preparation method and application of a nano-formulation for preventing and treating Squash leaf curl China virus on melon. BACKGROUND
[0002] Squash leaf curl China virus (SLCCNV) is a newly emerging cucurbit crop virus in Asia, belonging to the genus Begomovirus of the family Geminiviridae, and is transmitted by the whitefly Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae). Bemisia tabaci The two genomic components of SLCCNV are designated DNA-A and DNA-B. DNA-A contains six open reading frames (ORFs), including two virion-sense ORFs (AV1 and AV2) and four complementary-sense ORFs (AC1, AC2, AC3 and AC4); DNA-B contains two ORFs, BV1 and BC1.
[0003] The prevention and treatment of SLCCNV currently mainly relies on integrated pest and disease management (IPM) and chemical agents, and there is no widely available disease-resistant variety. As of now, the prevention and treatment mainly uses virus-free seedlings, eliminates the introduction of infected seedlings from areas where SLCCNV or whiteflies exist, sets up mulch film or ground film, isolates whiteflies during seedling stage, removes field residues as soon as possible after harvesting, implements crop rotation, and timely changes the use of drugs during the key period of rotation to reduce the transmission of viruses in the soil. However, the limitations of the current prevention and treatment methods are that the flexibility of cultivation management is not enough, the prevention and control effect is easily disturbed by the outside world, and the labor cost is high. The use of chemical pesticides not only leads to the development of whitefly resistance to drugs, but also aggravates the harm of crop pesticide pollution to human health and disrupts the ecological balance of farmland.
[0004] As a small-molecule RNA-mediated gene silencing mechanism, RNAi technology has triggered revolutionary breakthroughs in the field of life sciences since its discovery. The core of the antiviral effect of RNAi technology is "precise silencing", which is the core advantage that distinguishes it from traditional antiviral methods. It is a truly green and environmentally friendly method for preventing and treating viruses, and has promoted the development of many fields such as agricultural antiviral research, virus mechanism research, and antiviral drug research and development. However, the poor stability and short timeliness of dsRNA in the natural environment have become the key problems restricting the wide application and development of RNAi technology in the field of agricultural antiviral research.
[0005] Given the high susceptibility of dsRNA to degradation in natural environments, using nanocarriers as dsRNA delivery media has become a hot research topic. Currently, various nanocarriers, such as metal-organic frameworks (MOFs), zinc oxide (ZnO), chitosan (CSNPs), layered hydrogen peroxide (LDH), and lipid nanoparticles (LNPs), have been shown to improve the stability and delivery efficiency of dsRNA. Among these, ZnO-loaded dsRNA applied to leaves significantly increases dsRNA stability and timeliness, shields against nucleases, effectively inhibits dsRNA degradation, and enhances the plant's efficiency in dsRNA absorption, thereby effectively strengthening the plant's resistance to viruses. Furthermore, the addition of nanocarriers effectively promotes endosome escape from endocytosis, enhances gene silencing, and enables highly efficient dsRNA delivery.
[0006] Based on the above, this invention has developed a nanopesticide that specifically targets the SLCCNV genome sequence, aiming to achieve precise, green, and efficient control of SLCCNV and enhance the disease resistance of melons. Summary of the Invention
[0007] This invention develops a nano-formulation that specifically targets the genome sequence of Chinese pumpkin leaf curl virus (SLCCNV) in order to achieve precise, green, and efficient control of SLCCNV and enhance the disease resistance of melon plants.
[0008] One of the objectives of this invention is to provide one or more target gene fragments that can precisely and efficiently prevent and control viruses.
[0009] The second objective of this invention is to obtain the corresponding dsRNA by transcribing the target gene fragment.
[0010] The third objective of this invention is to combine the dsRNA of the transcribed target gene fragment with a nanocarrier to prepare a nanopesticide.
[0011] The above-mentioned objective of the present invention is achieved through the following technical solution:
[0012] The first aspect of the present invention provides a target gene segment for the prevention and control of Chinese pumpkin leaf curl virus, wherein the target gene segment is selected from the DNA-A-AV2 gene of the Chinese pumpkin leaf curl virus genome, and its nucleotide sequence is shown in SEQ ID NO.1.
[0013] A second aspect of the present invention provides a vector containing the above-described target gene segment.
[0014] Furthermore, the vector is an RNA interference vector, or the vector is a gene expression vector that transcribes the target gene segment to obtain dsRNA.
[0015] In a preferred embodiment of the present invention, the RNA interference vector can be an L4440 dual T7 promoter expression vector. This vector is carbenicillin resistant, has two T7 promoters, and a multiple cloning site is located between the two T7 promoters. A target gene fragment is inserted between the two T7 promoters to construct a recombinant vector. This recombinant vector is then transformed into the *E. coli* strain HT115(DE3) expressing T7 RNA polymerase. This strain lacks RNase III, thus preventing dsRNA degradation. T7 promoter transcription is induced by IPTG (isopropyl-β-D-mercaptogalactoside). The left and right T7 promoters transcribe the sense and antisense strands of the target gene fragment, respectively, and the two RNA strands form dsRNA through base pairing. This dsRNA can then be applied to melons to prevent and control viruses.
[0016] A third aspect of the present invention provides dsRNA transcribed from the target gene region having the nucleotide sequence of SEQ ID NO 1, wherein the dsRNA consists of the nucleotide sequence shown in SEQ ID NO 2 and a nucleotide sequence that is inversely complementary to the nucleotide sequence shown in SEQ ID NO 2.
[0017] A fourth aspect of this invention provides a dsRNA nanoparticle formulation for the prevention and treatment of SLCCNV, comprising the aforementioned dsRNA and a nanocarrier; wherein the nanocarrier is zinc oxide. When applied to melon leaves using the nanocarrier as a delivery mediator, the stability and long-lasting sustained-release properties of the dsRNA can be effectively improved.
[0018] As a specific preferred embodiment of the present invention, the dsRNA is mixed with different nanocarriers in different proportions, calculated by mass ratio. The mass ratio of dsRNA to ZnO is 1:30. This ratio ensures that the nanocarrier is fully loaded with dsRNA and is also the optimal ratio in terms of cost-effectiveness.
[0019] The fifth aspect of the present invention provides the application of the above-mentioned target gene segment, the above-mentioned dsRNA, or the above-mentioned dsRNA nanoparticle formulation in the prevention and control of Chinese pumpkin leaf curl virus in melons.
[0020] As one possible implementation method of the present invention, the present invention provides a specific method for applying the above-mentioned nano-pesticide to melon leaves to control SLCCNV:
[0021] (1) First, we screened for efficient target gene fragments of the SLCCNV genome. By reviewing the literature and comparing the conserved sequences of the virus on the NCBI website, we finally identified SLCCNV-DNA-A-AV2.
[0022] (2) The above-mentioned RNA interference vector is used to induce the transcription of the target gene fragment into its corresponding dsRNA.
[0023] (3) Combine dsRNA with nanocarriers in the above-mentioned optimal matching ratio to form nanopesticides, thereby increasing the stability of dsRNA.
[0024] (4) By friction inoculation, nano-pesticides are applied to melon leaves. Through the endocytosis of the plant's own cells, the nano-pesticides are absorbed into the plant cells. At this time, dsRNA can play its precise targeting role, interfering with the normal expression of the SLCCNV gene, thereby achieving the effect of preventing and controlling the virus.
[0025] Detailed description of the overall technical solution of the present invention
[0026] To obtain the target gene fragment with the best antiviral effect, a pair of specific primers were designed based on the SLCCNV genome sequence to amplify the above-mentioned genome fragment, introducing primers at both ends of the target fragment sequence. Hind III and Sac I. Two restriction endonuclease sites were added for subsequent ligation with the L4440 vector. The target fragment was amplified, electrophoresed, and gel-cleaved to obtain the DNA-A-AV2 gene fragment of the SLCCNV genome, whose nucleotide sequence corresponds to SEQ ID NO.1. The L4440 vector was then... Hind III and Sac I. After digestion with two restriction endonucleases, the multiple target fragments were cloned into the digested vectors to construct RNA interference vectors. The constructed vectors were transformed into competent E. coli (DH5α) cells, plated on LB solid culture plates containing carbenicillin resistance, single colonies were picked, and PCR was performed for positive detection. The DNA of positive bacterial samples was sequenced, and plasmids from the samples with correct sequencing results were extracted and transformed into HT115 (DE3) for subsequent induction of dsRNA expression.
[0027] This invention utilizes the L4440 expression vector, which has two T7 promoters for efficient transcription initiation. The target gene fragment is inserted between the two T7 promoters. Under the induction of IPTG (approximately 0.6 mmol / L), T7 RNA polymerase drives bidirectional transcription at both T7 promoters. The two transcribed single-stranded RNAs form dsRNA of the target gene fragment through base pairing. Because the *E. coli* HT115(DE3) strain lacks RNase III enzyme activity, the induced dsRNA is protected from RNase degradation, ensuring dsRNA yield.
[0028] After transforming the RNA interference vector into *E. coli* HT115(DE3), strains with correct sequencing results were selected and inoculated into LB liquid medium containing tetracycline resistance. Large-scale culture was then initiated by IPTG induction. Total RNA was extracted from the bacteria using the Trizol method. After RNA digestion with DNase I and S1 Nuclease, the integrity of dsRNA was detected by agarose gel electrophoresis. The results showed that the dsRNA bands were clear, intact, and consistent with the expected size.
[0029] Indoor efficacy evaluation results showed that the nano-formulation prepared by combining ZnO and dsRNA-AV2 at a mass ratio of 30:1 exhibited the best control effect against SLCCNV, superior to other combinations. At this mass ratio, the nanocarrier could completely adsorb dsRNA, significantly enhancing the stability of dsRNA on the plant surface, solving the problem of rapid dsRNA degradation, and achieving long-term sustained release of dsRNA, continuously acting on the plant. When the mass ratio was lower than this, the control effect slightly decreased.
[0030] The beneficial effects of this invention are:
[0031] (1) Targeted, precise and efficient: Using the core pathogenic gene DNA-A-AV2 of the virus as the target, the virus gene is precisely silenced by dsRNA, which significantly inhibits the replication and spread of the virus and has a better prevention and control effect than naked dsRNA.
[0032] (2) Breakthrough in technical bottlenecks: ZnO nanocarriers can shield nucleases from degrading dsRNA, achieving long-term sustained release, and can still inhibit viruses 14 days after spraying; and promote plant absorption, improve gene silencing efficiency, with the best 1:30 ratio balancing effect and cost.
[0033] (3) Adaptable to agricultural applications: It can be applied by conventional methods such as spraying, without the need for complex equipment, and is compatible with existing cultivation processes, making up for the shortcomings of traditional cultivation management (high cost and poor flexibility) and chemical pesticides (resistance and pollution).
[0034] (4) Green, safe and environmentally friendly: The ingredients contain biological dsRNA, which has no risk of pesticide residue and does not harm human health; it has strong targeting, does not kill beneficial organisms, protects farmland ecology, and meets the needs of green agriculture. Attached Figure Description
[0035] Figure 1 dsRNA was induced by different concentrations of IPTG (mmol / L); M: DL2000; 1. 0 mmol / L; 2. 0.2 mmol / L; 3. 0.4 mmol / L; 4. 0.6 mmol / L; 5. 0.8 mmol / L.
[0036] Figure 2Screening for the optimal ratio of ZnO loaded with dsRNA; M: DL2000; 1. dsRNA; 2. ZnO; 3-10: dsRNA and ZnO were loaded at mass ratios of 1:1; 1:5; 1:10; 1:15; 1:20; 1:25; 1:30; 1:35 respectively.
[0037] Figure 3 To detect the expression level of virus CP in leaves 14 days after spraying nano-pesticides using Western blot.
[0038] Figure 4 The bar chart was used to analyze the expression level of virus CP in leaves 14 days after the application of nano-pesticides. Detailed Implementation
[0039] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.
[0040] Explanation of the sequence list:
[0041] SEQ ID.NO.1:
[0042] ATGAATAAAGCGGCCATTCGTATAATATTACCGAATGGCCGCGCGATTTTTTATGTGGGCCCTCGACCAATGAAATTCACGCTACATGGCTTATTTATTATGCGGGGACCATTAAATAGACTTCCGCCCCAAGTTTTGAACCACACCATGTGGGATCCACTTATGCACGAATTCCCTGAAAGTGTTCATGGTCTAAGGTGCATGCTAGCGGTGAAATATCTTCAGGAGGTGGAAAAAACATATTCTCCGGACACAGTCGGCTACGATCTTGTCCGCGATCTCATCCTAGTTCTCCGCGCAAAGAATTATGTCGAAGCGACCAGCCGATATTATCATTTCAACTCCCGCGTCGAAGGTACGCCGACGTCTCAACTTCGACAGCCCCTATGTTTCCCGTGCAGTTGTCCCCATTGCCCGCGTCACAAAGGGAAAGGCCTGGACAAACAGGCCGATGAACAGAAAACCAAAGATGTACAGGATGTATAG
[0043] SEQ ID.NO.2:
[0044] AUGAAUAAAGCGGCCAUUCGUAUAAUAUUACCGAAUGGCCGCCGAUUUUUUAUGUGGGCCCUCGACCAAUGAAAUUCACGCUACAUGGCUUAUUUAUUAUGCGGGGACCAUUAAAUAGAC UUCCGCCCCAAGUUUUGAACCACACCAUGUGGGAUCCACUUAUGCACGAAUUCCCUGAAAGUGUUCAUGGUCUAAGGUGCAUGCUAGCGGUGAAAUAUCUUCAGGAGGUGGAAAAAACAUAU UCUCCGGACACAGUCGGCUACGAUCUUGUCCGCGAUCUCAUCCUAGUUCCCGCGCAAAGAAUUAUGUCGAAGCGACCAGCCGAUAUUAUCAUUUCAACUCCCGCGUCGAAGGUACGCCGA CGUCUCAACUUCGACAGCCCCUAUGUUUCCCGGCAGUUGUCCCCAUUGCCCGCGUCACAAAGGGAAAGGCCUGGACAAACAGGCCGAUGAACAGAAAACCAAAGAUGUACAGGAUGUAUAG
[0045] SEQ ID.NO.3:
[0046] TCGACGGTATCGATAAGCTTAAATATCTTCAGGAGGTGG
[0047] SEQ ID.NO.4:
[0048] TATCATCGATGAATTCGAGCTCTTGGTTTTCTGTTCATCG Example 1
[0049] This embodiment involves amplifying the target gene fragment for the prevention and control of SLCCNV, inducing the corresponding dsRNA, combining the nanocarrier and dsRNA in a certain mass ratio to form a nanomedicine, applying it to the plant, and evaluating the prevention and control effect of the nanomedicine by detecting the SLCCNV content in the plant.
[0050] 1.1 Materials and Methods
[0051] (1) Plant materials
[0052] The melon variety used in this invention is Guomi 2029-25. The seeds were germinated for two days at 28℃ in an environment with sufficient moisture and oxygen. After germination, the seeds were transplanted into a vermiculite-nutrient soil (1:1, v / v) mixed substrate and cultured until the four-leaf stage under the following conditions: light intensity of 50 μmol·m⁻²·s⁻¹, photoperiod of 16 h light / 8 h dark, and temperature of 27±1℃.
[0053] (2) Strains and plasmids
[0054] Strains: Escherichia coli used in this invention ( Escherichia coli Both HT115 (DE3) and DH5α are preserved in our laboratory and used for various experimental studies.
[0055] The SLCCNV invasive clone of Agrobacterium with the His tag is preserved in our laboratory.
[0056] (3) Preparation of relevant solutions
[0057] LB (Luria-Bertani) medium: Tryptone 10 g / L, Yeast extract 5 g / L, Sodium chloride (NaCl) 10 g / L, add ddH2O to a final volume of 1 L. Sterilize at 120°C for 20 min, store at room temperature.
[0058] 50 mg / mL carbenicillin: Add 50 g of carbenicillin sodium to 0.8 L of distilled water in a suitable container. Continue adding distilled water until the volume is 1 L. Filter sterilize using a 0.22 μm filter. Store at -20°C for later use.
[0059] The zinc oxide (ZnO) nano solution is preserved in our laboratory.
[0060] 1.2 Amplification of target gene fragments and construction of RNA interference vectors
[0061] Based on the sequence of the SLCCNV-DNA-A-AV2 gene, a pair of specific primers were designed, and primers were introduced at both ends of the primers. Hind III and Sac I restriction enzyme sites were used to amplify the target gene fragments by PCR. The amplification products were detected by 1% agarose gel electrophoresis, then recovered from the gel and purified. Specific primer information is shown in Table 1.
[0062] Table 1 Specific primer information
[0063]
[0064] use Hind III andSac The L4440 vector was digested with restriction endonuclease I. After 2 hours of digestion, the product was detected by 1% agarose gel electrophoresis, recovered from the gel, and purified to obtain the linearized L4440 vector. The digestion system is shown in Table 2.
[0065] Table 2 Double enzyme digestion system
[0066]
[0067] The recovered sequence product and the linearized vector were ligated using C115 ligase to clone the gene sequence into the linearized vector. The ligation system is shown in Table 3. The reaction was carried out at 50℃ for 20 min.
[0068] Table 3 Connection System
[0069]
[0070] The conjugated vector was transferred into E. coli ( E. coli DH5α. Remove DH5α competent cells from -80℃ and immediately place them on ice. After 5 minutes, once the bacterial block has thawed, add 10µL of ligation product and gently mix by tapping the bottom of the EP tube (avoid pipetting). Incubate on ice for 25 minutes. Heat shock at 42℃ for 45 seconds, then immediately return to ice and incubate for 2 minutes, avoiding shaking. Add approximately 700 μL of antibiotic-free sterile LB medium to the EP tube, mix well, and incubate at 37℃, 200 rpm for 1 hour. Centrifuge at 5000 rpm for 1 minute to collect the cells, discarding most of the supernatant. Gently resuspend the bacterial block using the remaining supernatant and spread it onto LB medium containing the appropriate antibiotic. Dry the culture plate in a laminar flow hood, then invert it in a 37℃ incubator and incubate for at least 15 hours. After monoclonal bacteria grow on the culture plate, select 6-8 monoclonal samples for PCR positive monoclonal detection. Sequencing is performed on the DNA of the positive samples. Plasmids are extracted from the samples with correct sequencing results and stored at -20℃ for later use.
[0071] 1.3 Escherichia coli ( E. coli Transformation of HT115 (DE3) competent cells
[0072] Remove HT115(DE3) competent cells from -80°C. After the bacterial clump thaws, quickly add the plasmid to the competent cells and incubate on ice for 25 min. Heat shock at 42°C for 45 seconds, then immediately place on ice and incubate for 2 min, avoiding shaking. Add approximately 700 µL of sterile LB medium to an EP tube, mix well, and incubate at 37°C, 200 rpm for 1 h. Centrifuge at 5000 rpm for 1 min, discard a large amount of supernatant, and gently resuspend the bacterial pellet by pipetting. Spread the pellet onto LB agar plates containing Amp antibiotic. Once the plates are dry and no liquid drips, seal the plates with sealing film and incubate at 37°C for at least 15 h.
[0073] After monoclonal bacteria have grown, select a monoclonal sample for PCR testing. Sequencing of the positive samples will be performed, and samples with correct sequencing results will be preserved at -80℃ for later use.
[0074] 1.4 dsRNA-induced expression
[0075] Add 100 µL of HT115(DE3) RNAi interference vector to 5 ml of LB medium containing Amp antibiotic, and incubate overnight at 37°C with a shaker at 220 rpm. Add 1–5 ml of the overnight culture to 100 ml of LB medium containing Amp antibiotic, and incubate at 37°C with a shaker at 220 rpm until OD≈0.5. Add approximately 0.6 mmol / L IPTG, and incubate at 25°C with a shaker at 160 rpm for approximately 8 hours.
[0076] Total RNA was extracted using the Trizol method, and the specific steps are as follows:
[0077] Collect the bacterial cells after 8 hours of induction into a 2 ml enzyme-free EP tube, centrifuge at 7500 rpm for 2 min at 4°C, discard the supernatant, add 1 ml Trizol, vortex to mix, incubate at room temperature for 5 min, then add 200 µL chloroform, vortex to mix, and incubate at room temperature for 5 min. Centrifuge at 12000 rpm for 15 min at 4°C. At this point, the liquid in the EP tube has separated into three layers: a colorless aqueous phase on top, a middle layer mainly containing DNA, and a bottom layer mainly containing protein. Transfer the colorless aqueous phase on top to a new enzyme-free EP tube, add 250 µL isopropanol, vortex to mix, and incubate at room temperature for 10 min. Centrifuge at 12000 rpm for 10 min at 4°C, discard the supernatant, wash the precipitate with 75% ethanol solution, centrifuge at 7500 rpm for 5 min at 4°C, discard the supernatant, open the EP tube cap, and dry the RNA at room temperature for 5 min. Then add 30 µL enzyme-free water to dissolve the RNA.
[0078] Two-enzyme digestion of RNA
[0079] First, the RNA was digested with DNase I, as shown in Table 4. Then, it was digested with S1 Nuclease, as shown in Table 5.
[0080] Table 4 DNase I Digestion System
[0081]
[0082] Table 5 S1 Nuclease Purification System
[0083]
[0084] 1.5 Screening for the optimal ratio of dsRNA to nanocarrier
[0085] dsRNA-ZnO nanopesticides were prepared using the target gene fragment DNA-A-AV2 from the SLCCNV genome. The migration of the prepared nanopesticides was detected by 1% agarose gel electrophoresis to determine the preparation quality and dsRNA loading. If the dsRNA was completely loaded onto the nanocarrier, no free-migrating bands would be observed during gel electrophoresis. Conversely, if no bands were observed, it indicated that the dsRNA was not completely loaded.
[0086] Screening of 1.6-nanometer pesticide efficacy
[0087] ZnO was loaded with dsRNA at the optimal mass ratio and applied to melon leaves at the four-leaf stage. One day later, SLCCNV infectious clones were injected. After 14 days, system leaves were collected, and the expression level of the virus was detected by Western blot to screen the stability and effectiveness of the nano-pesticide.
[0088] 2. Experimental Results
[0089] 2.1 High-efficiency target gene fragment amplification of SLCCNV and construction of RNAi interference vector
[0090] This invention utilizes the L4440 vector, which contains dual T7 promoters. The target gene fragment is inserted between the two T7 promoters via restriction enzyme sites. Under IPTG induction, the target gene fragment can be efficiently transcribed by RNA polymerase, making it an excellent expression vector for in vitro induced expression of dsRNA. The HT115(DE3) strain contains tetracycline resistance and lacks RNase III enzyme activity, which contributes to the stability and large-scale induction of dsRNA expression.
[0091] An RNAi interference vector was constructed using the L4440 vector plasmid via homologous recombination. Hind III and SacAfter digesting the L4440 vector with enzyme I, the SLCCNV target gene fragment with added homologous arms was ligated into the linearized L4440 vector using homologous recombination to construct an RNAi interference vector. The ligation product was transformed into DH5α, and single colonies were picked and PCR was used to verify successful vectorization. After successful DNA sequencing, the correct recombinant vector plasmid was transformed into HT115(DE3), and dsRNA expression was induced after successful sequencing.
[0092] IPTG-induced dsRNA expression. 5 ml of activated HT115(DE3) bacterial culture containing the recombinant vector plasmid was expanded to 100 ml. Experimental results showed that when cultured at 37℃ and 220 rpm in a shaker until OD≈0.5, adding approximately 0.6 mmol / L IPTG for about 8 hours resulted in the highest number of bacterial cells collected for total RNA extraction. The control group used HT115(DE3) with an empty L4440 vector, and the same experimental procedures were performed, collecting bacterial cells and extracting total RNA. Figure 1 ).
[0093] 2.2 Screening of the optimal ratio of nano-pesticides
[0094] By combining dsRNA of the SLCCNV target gene fragment with ZnO nanocarriers, the optimal mass ratio of dsRNA to ZnO nanocarriers was screened.
[0095] To determine the optimal loading ratio of dsRNA to ZnO, experiments were conducted with different mass ratios of dsRNA to ZnO, including dsRNA:ZnO = 1:1; 1:5; 1:10; 1:15; 1:20; 1:25; 1:30; and 1:35. Naked dsRNA and ZnO were used as controls. Detection was performed by 1% agarose gel electrophoresis. The results showed that when the mass ratio of dsRNA to ZnO was 1:30, ZnO completely loaded the dsRNA. Figure 2 ).
[0096] 2.3 Analysis of SLCCNV virus load and RNAi interference effect in melon plants after dsRNA treatment
[0097] Total protein was extracted from melon leaves, and the expression level of SLCCNV virus was detected by Western blot. Figure 3 After spraying dsRNA, the expression levels of key genes in the SLCCNV genome were significantly reduced compared to the control group without dsRNA application, indicating that dsRNA has a significant effect on virus control and inhibits virus spread to some extent. This suggests that the combination of dsRNA and nanocarriers to form a nanopesticide, when applied to melon leaves, has an inhibitory effect on virus expression.
[0098] 2.4 Analysis of the persistence of action of nano-sized formulations
[0099] dsRNA-AV2-ZnO complex was applied to melon leaves at the four-leaf stage, and an infectious SLCCNV clone was injected one day later. Total protein was extracted from the systemic leaves 14 days later, and the expression levels of key SLCCNV viruses were detected by Western blot. Figure 4 Compared with control plants, the viral expression level in plants treated with nanopesticides was significantly reduced, and the effect of controlling the virus was longer-lasting than that of dsRNA. This indicates that the nanocarrier can be absorbed into the plant cell and work together with dsRNA to target the virus, better protecting dsRNA from enzymatic degradation and significantly enhancing the stability of dsRNA.
[0100] In summary, dsRNA targeting gene fragments designed based on the SLCCNV genome has a certain control effect on SLCCNV. Nanopesticides based on dsRNA-AV2 testing have a certain effect on controlling SLCCNV and enhancing the timeliness and stability of dsRNA. dsRNA-AV2-ZnO has a better prospect in controlling SLCCNV.
Claims
1. A dsRNA for preventing and controlling Chinese pumpkin leaf curl virus, characterized in that, The dsRNA sequence is the nucleotide fragment from position 214 to 467 of SEQ ID NO.
1.
2. A dsRNA nanoformation for the prevention and control of pumpkin leaf curl virus in China, characterized in that, It is composed of the dsRNA described in claim 1 and a nanocarrier; the nanocarrier is zinc oxide.
3. The dsRNA nanoformation according to claim 2, characterized in that, The mass ratio of dsRNA to zinc oxide is 1:
30.
4. The application of the dsRNA according to claim 1 or the dsRNA nanoformation according to any one of claims 2-3 in the prevention and control of Chinese pumpkin leaf curl virus on melons.
Citation Information
Patent Citations
DsRNA nanocrystallization preparation for preventing and treating areca yellows as well as preparation method and application of dsRNA nanocrystallization preparation
CN120700003A