Lipid-lowering pharmaceutical composition targeting angpt13 gene

Abstract

The invention provides a lipid-lowering pharmaceutical composition, the lipid-lowering pharmaceutical composition contains sgRNA (small guide ribonucleic acid), and the sgRNA is targeted to an angpt13 gene. A modified pAAV2-CMV-lugcas9-HF plasmid containing the sgRNA is loaded into an AAV8 vector, in-vivo gene editing is carried out on an LDLR <- / -> mouse, the angpt13 expression of the mouse liver and the blood lipid level of the mouse can be remarkably reduced, the sgRNA is good in specificity, and miss target is not detected.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to a nucleic acid lipid-lowering drug. Background Art

[0002] Obesity and its related metabolic disorders have become a global public health problem in recent decades (CHOOI YC, DING C, MAGKOs F The epidemiology of obesity [J]. Metabolism, 2019, 92: 6-10 DOI: 101016a. Metabol. 2018.09.005). Lipid metabolism disorders can induce a variety of chronic diseases, including atherosclerosis, cardiovascular disease, type 2 diabetes, aging, and non-alcoholic fatty liver disease (RADAELLI MG, MARTUCCI F, PERRA S, et al. NAFLD / NASH in patients with type 2 diabetes and related treatment options [J]. Journal of Endocrinological Investigation, 2018, 41(5): 509-521.). Both genetic and environmental factors can lead to obesity, and long-term unhealthy dietary patterns can also increase the incidence of obesity in humans (ZHUY, BAI J, ZHOUYR, et al Water-soluble and alkali-soluble Polysaccharides from bittermelon inhibited lipid accumulation in HepG2 cells and Caenorhabditis elegans[J]. International Journal of Biological Macromolecules, 2020, 166: 155-165.).Some anti-obesity drugs are commonly used to reduce lipid accumulation, but they have many side effects, such as liver dysfunction (SAOKAEWS, KANCHANASUWAN S, APISARNTHANARAKP, et al. Clinical risk scoring for predicting non-alcoholic fatty liver disease in metabolic syndrome patients (NAFLD-MS score) [J]. Liver International, 2017, 37(10): 1535-1543.) or gastrointestinal discomfort (BAYS HE, ANGELAF, SANDRAC, et al. Anti-obesity medications and investigational agents: an Obesity Medicine Association (OMA) Clinical Practice Statement (CPS) 2022 [J]. Obesity Pillars, 2022, 2: 100018.). People are paying more and more attention to exploring some safe lipid-lowering methods.

[0003] angptl3 is a secreted glycoprotein with a molecular weight of approximately 70 kD and belongs to the angiopoietin-like protein family. It consists of a signal peptide (SP), an N-terminal coiled-coil domain (CCD), and a C-terminal fibrinogen-like domain (FLD). Angptl3 is primarily expressed in the liver, with a small amount also expressed in human kidney tissue. It is currently known that angptl3 regulates lipid metabolism, is associated with insulin resistance, and participates in angiogenesis and stem cell proliferation. Its genetic polymorphism is closely associated with the occurrence of hyperlipidemia and coronary artery disease in humans. The CCD domain at the N-terminus of angptl3 is a key domain in regulating lipid metabolism. Studies have found that the N-terminal coiled-coil domain of angptl3 can effectively inhibit the activity of lipoprotein lipase (LPL) and regulate lipid metabolism (Zhu Miaomiao, Zhou Jie, Qin Yanwen. Research progress on the role of the angiopoietin-like protein family in lipid metabolism [J]. Journal of Cardiopulmonary and Vascular Diseases, 2018, 037(005): 486-489.). Its C-terminal fibrinogen-like domain can induce endothelial cell adhesion and promote angiogenesis in vivo, which is closely related to the body's blood sugar, blood lipids and insulin resistance. After angptl3 is released into the blood circulation, it is recognized and cleaved by proprotein convertase, and then activated to play its role (Kersten, Sander. Angiopoietin-like 3 in lipoprotein metabolism [J]. Nature Reviews Endocrinology, 2017). In vitro, angptl3 inhibits the phospholipase activity of EL through the heparin binding site in its N-terminal domain. This enzyme hydrolyzes high-density lipoprotein phospholipids (HDL-PL), thereby reducing the level of plasma high-density lipoprotein cholesterol (HDL-C) and participating in the regulation of plasma HDL-PL and HDL-C levels in humans and rodents (Shimamura M, Matsuda M, Yasumo H, et al. Angiopoietin-like protein 3 regulates plasma HDL cholesterol through suppression of endothelial lipase [J]. Arterioscler Thromb Vasc Biol, 2007, 27 (2): 366-372.). In addition, angptl3 deficiency leads to decreased plasma low-density lipoprotein cholesterol (LDL-C) levels. Familial hypobetalipoproteinemia (FHBL2) is a rare recessive disease associated with loss of function of the angptl3 gene mutation, resulting in decreased serum LDL-C levels.

[0004] angptl3 is a relatively safe target. Gene editing of angptl3 is simpler and more selective. Compared to base substitution at a fixed site, we only need to create a frameshift mutation in the angptl3 gene through CRISPR / Cas9 to render the angptl3 protein nonfunctional, which provides us with more target selection possibilities. Therefore, based on the lipid-regulating function of angptl3, angptl3 is a very promising gene editing target for lipid-lowering. Summary of the Invention

[0005] The present invention provides an sgRNA that can effectively target the angtpl3 gene. Based on this, the present invention is completed.

[0006] In a first aspect, the present invention provides a lipid-lowering pharmaceutical composition, comprising an sgRNA, the nucleotide sequence of which is CTACACTACAAGTTAAAAAC as shown in SEQ ID NO 13, and the sgRNA targets the angptl3 gene.

[0007] Furthermore, one or more pharmaceutically acceptable carriers or excipients may be added to the pharmaceutical composition.

[0008] Furthermore, the carrier material includes but is not limited to one or more of a water-soluble carrier material, a poorly soluble carrier material and / or an enteric carrier material.

[0009] Furthermore, the water-soluble carrier material includes but is not limited to one or more of polyethylene glycol, polyvinyl pyrrolidone and / or organic acid.

[0010] Furthermore, the poorly soluble carrier material includes but is not limited to one or more of ethyl cellulose and / or cholesterol stearate.

[0011] Furthermore, the enteric carrier material includes but is not limited to one or more of cellulose acetate phthalate and / or carboxymethyl ethyl cellulose.

[0012] Furthermore, the pharmaceutical composition can be prepared into a variety of dosage forms, including but not limited to one or more of tablets, capsules, pellets, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal agents, buccal tablets, suppositories and / or lyophilized powder injections.

[0013] Furthermore, the pharmaceutical composition can be administered via injection, cavity administration, respiratory tract administration or mucosal administration.

[0014] Furthermore, the injection administration includes subcutaneous injection, intravenous injection, intramuscular injection and intracavitary injection, etc.; the cavity administration includes rectal or vaginal administration; and the respiratory tract administration includes nasal administration.

[0015] In a second aspect, the present invention provides an expression vector comprising an sgRNA, the nucleotide sequence of the sgRNA being shown as SEQ ID NO 13, and the sgRNA targeting the angptl3 gene.

[0016] Furthermore, the expression vector can be a plasmid.

[0017] In a third aspect, the present invention provides a nucleic acid composition comprising sgRNA, the nucleotide sequence of which is shown in SEQ ID NO 13, and the sgRNA targets the angptl3 gene.

[0018] In a fourth aspect, the present invention provides a use of the expression vector according to the second aspect or the composition according to the third aspect in the preparation of a lipid-lowering drug.

[0019] Furthermore, one or more pharmaceutically acceptable carriers or excipients may be added to the drug.

[0020] Furthermore, the carrier material includes but is not limited to one or more of a water-soluble carrier material, a poorly soluble carrier material and / or an enteric carrier material.

[0021] Furthermore, the water-soluble carrier material includes but is not limited to one or more of polyethylene glycol, polyvinyl pyrrolidone and / or organic acid.

[0022] Furthermore, the poorly soluble carrier material includes but is not limited to one or more of ethyl cellulose and / or cholesterol stearate.

[0023] Furthermore, the enteric carrier material includes but is not limited to one or more of cellulose acetate phthalate and / or carboxymethyl ethyl cellulose.

[0024] Furthermore, the drug can be prepared into a variety of dosage forms, including but not limited to one or more of tablets, capsules, pellets, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal agents, buccal tablets, suppositories and / or lyophilized powder injections.

[0025] Furthermore, the drug can be administered via injection, cavity administration, respiratory tract administration or mucosal administration.

[0026] Furthermore, the injection administration includes subcutaneous injection, intravenous injection, intramuscular injection and intracavitary injection, etc.; the cavity administration includes rectal or vaginal administration; and the respiratory tract administration includes nasal administration.

[0027] Beneficial effects

[0028] The lipid-lowering pharmaceutical composition of the present invention contains an sgRNA that effectively targets the angptl3 gene. The modified pAAV2-CMV-slugcas9-HF plasmid containing this sgRNA was loaded into an AAV8 vector and used for in vivo gene editing in LDLR- / - mice. This sgRNA showed high specificity, with no off-target effects detected. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 is the editing efficiency of the six sites;

[0030] Figure 2 For gRNA2 off-target analysis;

[0031] Figure 3 Comparison of serum lipids T-CHO, TG, and LDL-C in mice of normal diet group, high-fat experimental group, and high-fat control group;

[0032] Figure 4 The angptl3 protein levels in the livers of mice in the normal diet group, high-fat experimental group, and high-fat control group;

[0033] Figure 5 The levels of liver enzymes ALT and AST in mice in the normal diet group, high-fat experimental group and high-fat control group. DETAILED DESCRIPTION

[0034] The following is a further description of specific embodiments of the present invention. It should be noted that the description of these embodiments is intended to facilitate understanding of the present invention and does not constitute a limitation of the present invention. In addition, the technical features involved in the embodiments described below may be combined with each other as long as they do not conflict with each other.

[0035] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0036] Explanation of terms:

[0037] Competent cells: Physical and chemical methods are used to induce cells to absorb DNA molecules from their surroundings, placing them in a physiological state optimal for uptake and storage of foreign DNA. The main principle is to increase cell permeability through treatment. Intuitively, this creates pores on the cell membrane, allowing foreign genes or vectors to enter the competent cells. Due to the fluidity of the cell membrane, these pores are repaired by the cells themselves.

[0038] N2a cells, also known as Neuro-2a, are mouse-derived neuroblastoma cells. Currently, this cell line is primarily cultivated in the laboratory as a cell model for in vitro pathological studies.

[0039] Example 1 Screening for frameshift mutation sites with PAM sequences in angptl3

[0040] 1. Screen suitable frameshift mutation sites in the mouse angptl3 gene and use the online gene editing efficiency prediction tool http: / / www.deephf.com / index / # / Predict to predict the editing efficiency of the selected sites. The six sites with the highest predicted efficiency were selected. The nucleotide sequences of the six sites are as follows:

[0041] Grna1-r: SEQ ID NO 1: CACCGAGTCCATGACCCAGCTGCAG

[0042] Grna1-f: SEQ ID NO 2: AAACctgcagctgggtcatggactC

[0043] Grna2-r: SEQ ID NO 3: CACCGCTACACTACAAGTTAAAAAC

[0044] Grna2-f: SEQ ID NO 4: AAACgtttttaacttgtagtgtagC

[0045] Grna3-r: SEQ ID NO 5: CACCGAGAAGACAGCCCTTCAACAC

[0046] Grna3-f: SEQ ID NO 6: AAACgtgttgaagggctgtcttctC

[0047] Grna4-r: SEQ ID NO 7: CACCGCACTACAAGTTAAAAAACGAG

[0048] Grna4-f: SEQ ID NO 8: AAACctcgtttttaacttgtagtgC

[0049] Grna5-r: SEQ ID NO 9: CACCGTTAAGTCCATGACCCAGCTG

[0050] Grna5-f: SEQ ID NO 10: AAACcagctgggtcatggacttaaC

[0051] Grna6-r: SEQ ID NO 11: CACCGATGAAAGGTCTGGATCCACT

[0052] Grna6-f: SEQ ID NO 12: AAACagtggatccagacctttcatC

[0053] 2. Construction of SlugCas9 plasmid expressing corresponding gRNA

[0054] 1) Oligo DNA synthesis: BasI is the restriction site of plasmid slugcas9-HF, and the sequence of synthesized oligo DNA is: Oligo-F: 5'-sticky end (CACC) + G + N20-3'

[0055] Oligo-R: 5'-sticky end (AAAC) + N20- + C-3';

[0056] 2) Oligo DNA annealing: After synthesis, it needs to be annealed in a PCR instrument to form a double-stranded structure;

[0057] 3) Oligo DNA annealing and ligation:

[0058] i. Plasmid linearization

[0059] ii. Gum recovery and purification

[0060] The digested samples were subjected to agarose gel electrophoresis to recover DNA fragments of the target size.

[0061] iii. After the ligation reaction, add T4 DNA ligase and store at -20℃.

[0062] 4) Chemically competent transformation

[0063] Thaw the DH5α chemical competent medium, add the ligation product to the thawed competent medium, mix well, and then place on ice. After heat shocking the competent cells, move them to ice and let them stand; add antibiotic-free liquid LB medium to the competent cells; take the bacterial liquid and directly plate it or concentrate it by centrifugation, discard the supernatant, and resuspend the remaining liquid and plate it; incubate the plate overnight.

[0064] 5) Bacterial clone verification: Colonies grown on plates, shaken by themselves, or after plasmid extraction can be sequenced and the sequencing results compared with the plasmid map.

[0065] 3. Plasmid transfection into N2a cells to verify editing efficiency

[0066] 1) N2a cell culture and transfection;

[0067] 2) Genomic DNA was extracted for Sanger sequencing and T7EI digestion was used to verify the editing efficiency. N2A cells were transfected with the pAAV2-CMV-slugcas9-HF plasmid containing sgRNA, and the cell DNA was collected. The editing efficiency of sgRNAs with different sequences was determined using the T7EI digestion method.

[0068] 4. Off-target analysis using guide-seq

[0069] 1) The slugcas9-gRNA expression plasmid and oligo DNA were simultaneously transfected into N2A cells. After culture, the cells were harvested and genomic DNA was extracted using the QIAGEN genome extraction kit;

[0070] 2) Genomic DNA was placed in an eight-tube strip and water was added. The genome was then sheared using the NEBnext Ultra II FSDNA module, the ends were blunted, and A-tailed. The sheared DNA was purified and recovered using AMPure XP magnetic beads. The DNA was eluted and recovered, the adapter was connected, and USERTM Enzyme was added. The mixture was mixed evenly and placed in a PCR instrument for reaction. The mixture was purified and recovered using AMPure XP magnetic beads, and the recovered DNA was used as a template for next-generation sequencing library construction.

[0071] 5. Experimental results

[0072] like Figure 1-2 As shown, gRNA2 had the highest editing efficiency. Sanger sequencing of the G2-edited DNA verified the editing efficiency, demonstrating that sgRNA2 targeted ANGPTL3 well and achieved high editing efficiency. No off-target effects were observed using Guide-Seq.

[0073] Example 2 Verification of Editing Efficiency and Therapeutic Effect in LDLR- / - Hypercholesterolemia Mouse Model

[0074] 1. Experimental methods

[0075] 1) Package AAV8-SlugCas9-HF-sgRNA, amplify the virus, and obtain a viral titer of approximately 1012 v.g / ml.

[0076] 2) High-fat mouse model

[0077] LDLR- / - mice were randomly divided into three groups: a normal diet group, a high-fat experimental group, and a high-fat control group. The high-fat group was fed a western diet (D12108C feed). Blood was collected from the jaw at 6 weeks of age for measurement of T-CHO, TG, and LDL-C.

[0078] 3) The high-fat experimental group was injected with AAV8-SlugCas9-HF-sgRNA once in the tail vein at 1011 v.g / mouse at 6 weeks of age, while the high-fat control group was injected with an equal amount of empty viral vector. The mice were killed 2 weeks after the injection.

[0079] 2. Experimental results

[0080] like Figure 3 As shown in the figure, the serum lipids T-CHO, TG, and LDL-C in the high-fat experimental group were significantly lower than those in the high-fat control group. Figure 4 As shown in the results, the liver angptl3 protein level of mice in the high-fat experimental group was significantly reduced, and the serum angptl3 level was also reduced. Figure 5 As shown, there was no significant increase in liver enzymes ALT and AST.

Claims

1. A lipid-lowering pharmaceutical composition, comprising an sgRNA, the nucleotide sequence of which is shown in SEQ ID NO 13, and the sgRNA targets the angptl3 gene.

2. The pharmaceutical composition according to claim 1, further comprising one or more pharmaceutically acceptable carriers or excipients, wherein the carrier material includes but is not limited to one or more water-soluble carrier materials, poorly soluble carrier materials and / or enteric-soluble carrier materials.

3. The pharmaceutical composition according to claim 1 can be prepared into various dosage forms, including but not limited to one or more of tablets, capsules, dripping pills, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal preparations, buccal tablets, suppositories and / or lyophilized powder injections.

4. The pharmaceutical composition according to claim 1, wherein the pharmaceutical composition can be administered by injection, cavity administration, respiratory tract administration or mucosal administration; the injection administration includes subcutaneous injection, intravenous injection, intramuscular injection and intracavitary injection, etc.; the cavity administration includes rectal or vaginal administration; the respiratory tract administration includes nasal administration.

5. An expression vector comprising an sgRNA, the nucleotide sequence of the sgRNA being shown in SEQ ID NO 13, wherein the sgRNA targets the angptl3 gene. The vector according to claim 5 , wherein the expression vector is a plasmid.

7. A nucleic acid composition, comprising sgRNA, the nucleotide sequence of which is shown in SEQ ID NO 13, and the sgRNA targets the angptl3 gene.

8. Use of the expression vector according to claim 5 or the composition according to claim 7 in the preparation of lipid-lowering drugs.

9. The pharmaceutical composition according to claim 8, wherein the drug can be prepared into various dosage forms, including but not limited to one or more of tablets, capsules, dripping pills, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal preparations, buccal tablets, suppositories and / or lyophilized powder injections.

10. The drug according to claim 9, wherein the drug can be administered by injection, cavity administration, respiratory tract administration or mucosal administration; the injection administration includes subcutaneous injection, intravenous injection, intramuscular injection and intracavitary injection, etc.; the cavity administration includes rectal or vaginal administration; the respiratory tract administration includes nasal administration.

Images