Use of siRNA in the preparation of a postprandial hyperglycemia treatment preparation

Abstract

The application discloses application of siRNA in preparation of postprandial hyperglycemia treatment preparation and belongs to the technical field of biology. By analyzing maltase-glucoamylase mRNA sequences of human and mice, siRNA sequences for silencing maltase-glucoamylase protein expression are designed, and unmodified siRNA and siRNA with 2'-OMe and 2'-F base modification are synthesized. The two kinds of siRNA are transfected into human small intestinal mucosal epithelial cells by liposomes, the silencing efficiency of the unmodified siRNA on the MGAM gene is 81.54%, and the silencing efficiency of the siRNA with base modification on the MGAM gene is 82.09%. The two kinds of siRNA are injected intravenously into type 2 diabetes model mice, and the expression of maltase-glucoamylase can be effectively silenced, postprandial hyperglycemia is reduced, the stability of the siRNA with base modification is improved, the drug efficacy time can be prolonged, and the drug use frequency is reduced.

Description

Technical Field

[0001] The present invention belongs to the field of biological technology, and in particular relates to an application of siRNA in preparing a preparation for treating postprandial hyperglycemia. Background Art

[0002] Type 2 diabetes mellitus (T2DM) is a chronic metabolic disease that may be caused by impaired insulin secretion, glucose and lipid metabolism, or related metabolic imbalances. This leads to elevated blood sugar and abnormal lipid metabolism, accompanied by a series of inflammatory and stress responses, resulting in irreversible damage to the body. Its most prominent pathological feature is a decrease in insulin's ability to regulate glucose metabolism, accompanied by decreased insulin secretion due to defective pancreatic β-cell function. This decrease in insulin's ability to regulate glucose metabolism in insulin target tissues is one of the primary pathogenesis of T2DM.

[0003] Hyperglycemia (persistently elevated fasting or postprandial blood sugar levels) not only affects individuals with diabetes but, if left uncontrolled for a long time, can cause extensive damage to organs throughout the body and even be life-threatening. Postprandial hyperglycemia is not only an early sign of diabetes but, if left uncontrolled for a long time, can damage multiple organs throughout the body and even increase the risk of death. The main antidiabetic drugs used clinically to control postprandial hyperglycemia are α-glucosidase inhibitors, with acarbose and voglibose being representative. α-glucosidase inhibitors act by competitively inhibiting α-glucosidase enzymes in the brush border of the small intestine, delaying carbohydrate breakdown and thereby lowering postprandial blood sugar. They should be taken immediately before meals (with the first bite of food) three times daily. However, some patients with hyperglycemia are insensitive to or intolerant of α-glucosidase inhibitors.

[0004] Alpha-glucosidases are carbohydrate-degrading enzymes primarily found in the small intestinal epithelial cells (the brush border of the intestinal mucosa). They are responsible for breaking down disaccharides (such as sucrose and maltose) and oligosaccharides into monosaccharides (such as glucose) for absorption. Maltase-glucoamylase (MGAM) is the major isoform of α-glucosidase and is located in the brush border of the small intestine. Small interfering RNA (siRNA), a short double-stranded RNA molecule typically consisting of 20-25 nucleotides, plays a key role in RNA interference (RNAi), effectively and specifically silencing target gene expression. In recent years, siRNA drugs have become a research hotspot due to their remarkable efficacy, and several siRNA drugs have been marketed globally. Using siRNA technology to interfere with maltase-glucoamylase expression can downregulate dietary carbohydrate metabolism, effectively lowering postprandial blood glucose levels and playing a crucial role in the treatment of type 2 diabetes. By searching for siRNA targets on maltase-glucoamylase, it is hoped that siRNA drugs can be developed through rational design to replace traditional oral α-glucosidase drugs, providing new medication options for patients who are intolerant to chemical drugs as a supplementary medication for the treatment of type 2 diabetes. Summary of the Invention

[0005] The purpose of the present invention is to provide an application of siRNA in the preparation of a preparation for treating postprandial hyperglycemia, thereby utilizing siRNA to reduce the harm of postprandial hyperglycemia.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] First, the present invention provides an application of siRNA in preparing a preparation for treating postprandial hyperglycemia, wherein the nucleotide sequence of the positive chain of the siRNA is SEQ ID NO.1.

[0008] Furthermore, the nucleotide sequence of the siRNA antisense strand is SEQ ID NO.2.

[0009] Furthermore, the siRNA is unmodified siRNA when used as a short-acting preparation.

[0010] Furthermore, the siRNA is a base-modified siRNA when used as a long-acting preparation.

[0011] Secondly, the present invention provides a base-modified siRNA, wherein the first and second bases of the sense strand of the siRNA are modified with 2'-OMe.

[0012] Furthermore, 2'-F modifications are introduced into bases 16, 18, and 20 of the siRNA antisense strand.

[0013] Furthermore, the 17th base of the siRNA antisense strand is modified with 2'-OMe.

[0014] The beneficial effects of the present invention are:

[0015] By analyzing the mRNA sequences of human and mouse maltase-glucoamylase, this study designed siRNA sequences for silencing maltase-glucoamylase protein expression. Unmodified siRNA and siRNA modified with 2'-OMe and 2'-F bases were synthesized. Both siRNAs were transfected into human small intestinal epithelial cells via liposomes. The unmodified siRNA achieved an 81.54% silencing efficiency against the MGAM gene, while the modified siRNA achieved an 82.09% silencing efficiency. Intravenous injection of both siRNAs into type 2 diabetes model mice effectively silenced maltase-glucoamylase expression and reduced postprandial hyperglycemia to normal levels. The base-modified siRNA exhibits enhanced stability, extending its duration of efficacy and reducing the need for dosing. The unmodified siRNA of this invention can be used as a short-acting formulation, while the base-modified siRNA can be used as a long-acting formulation. Both can be used in treatments for postprandial hyperglycemia to effectively control postprandial blood sugar levels. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a graph showing the results of a siRNA silencing efficiency test on the MGAM gene in human small intestinal mucosal epithelial cells;

[0017] Figure 2 This is the experimental result of siRNA on the postprandial blood glucose of mice. DETAILED DESCRIPTION

[0018] The following is a more detailed description of the present invention, which is illustrated by examples. It should be understood that these examples are merely examples of the present invention, and their purpose is to illustrate the principles and functions of the present invention, but not to limit the scope of protection of the present invention.

[0019] Example 1 Maltase-Glucoamylase (MGAM) siRNA Design

[0020] In order to design an siRNA that can effectively inhibit the translation of maltase-glucoamylase (MGAM) mRNA into active maltase-glucoamylase, and at the same time evaluate the blood sugar-lowering effect of siRNA in a hyperglycemic mouse model, an siRNA was designed that has a silencing effect on the expression of MGAM protein in both humans and mice. The sequences of Homo sapiens maltase-glucoamylase (MGAM) mRNA and Mus musculus maltase-glucoamylase (MGAM) mRNA genes were retrieved in GenBank with reference to EU937529.1, NM_001368875.1, NM_001171003.1, XM_006506046.4, XM_006506045.3, XM_006506044.2, XM_011241330.1, XM_006506048.1, XM_006506047.1, XM_006506042.1, NM_004668.3, NM_001365693.1, XM_054359301.1 , XM_054359300.1, XM_054359299.1, ,XM_047421014.1, XM_024446990.2, XM_017012772.2, The designed siRNA sequences are as follows:

[0021] Sense strand: 5′-AACACAAAUGCAGGAUUCACA-3′;

[0022] Antisense strand: 5′-UGUGAAUCCUGCAUUUGUGUUAA-3′.

[0023] The product was commissioned to be synthesized and purified by Sangon Biotech (Shanghai) Co., Ltd.

[0024] To improve the stability of siRNA, reduce off-target effects and reduce immune response, 2'-OMe modification was introduced at the 1st and 2nd bases of the sense strand; 2'-F modification was introduced at the 16th, 18th and 20th bases of the antisense strand, and 2'-OMe modification was introduced at the 17th base. And entrusted Shengong Bioengineering (Shanghai) Co., Ltd. to synthesize and purify.

[0025] Example 2 Effect of siRNA on the expression level of maltase-glucoamylase of human small intestinal epithelial cells

[0026] (1) Cell plating Human small intestinal mucosal epithelial cells were inoculated in a 6-well plate, 2 mL of cell culture medium containing 1-2 x 10 5 cells was added to each well, and cultured in a 37°C carbon dioxide incubator until approximately 60% confluence. At the same time, blank controls (NC group), unmodified siRNA group and base-modified siRNA group were set up, each with 4 wells.

[0027] (2) Preparation of transfection solution: Prepare the following two solutions in an EP tube, A solution: dilute unmodified siRNA and base-modified siRNA to a final concentration of 50 nM with 125 μL Opti-MEM™ medium, and add 5 μL P3000™ reagent and mix well, B solution: 125 μL Opti-MEM™ medium with 7.5 μL Lipofectamine™ 3000 reagent, mix well. Gently mix A and B solutions, and incubate at room temperature for 10-15 minutes to form siRNA-lipid complex.

[0028] (3) Transfection preparation: rinse the cells twice with 2 mL of serum-free culture medium, then add 1 mL of serum-free culture medium.

[0029] (4) Transfection: slowly add the siRNA-lipid complex to the culture medium, shake well, and incubate at 37°C in a carbon dioxide incubator for 6 hours. Remove the serum-free transfection solution and replace it with normal culture medium for continued culture.

[0030] (5) Culture conditions: continue to culture in a 37°C, 5% CO2 incubator for 48 hours.

[0031] (6) Verification of mRNA level silencing efficiency: total RNA was extracted 48 hours after transfection (Trizol method). Reverse transcription to cDNA, MGAM fluorescent quantitative PCR was performed with MGAMf / MGAMr primers, and GAPDH fluorescent quantitative PCR was performed with GAPDHf / GAPDHr primers as an internal reference gene.

[0032] MGAMf: TTATGTGGCCTTCCCAGACT;

[0033] MGAMr:GGTTCATTCATATCAATCCA.

[0034] GAPDHf: AGCAAGAGCACAAGAGGAAG;

[0035] GAPDHr:TCTACATGGCAACTGTGAG.

[0036] (7) Calculate the silencing efficiency (ΔΔCt method, compared with negative control).

[0037] ΔCt experimental group = Ct target gene (experimental group) - Ct internal reference gene;

[0038] ΔCtNC group = CtNC group - Ct internal reference gene;

[0039] ΔΔCt=ΔCt experimental group-ΔCt NC group;

[0040] KD%=(1-2 -ΔΔCt )×100%.

[0041] from Figure 1 The results showed that the silencing efficiency of the unmodified siRNA on the MGAM gene was 81.54%, and the silencing efficiency of the base-modified siRNA on the MGAM gene was 82.09%. Both the siRNA before and after modification could achieve a good MGAM gene silencing effect, and the difference between the two was not significant.

[0042] Example 3 Construction of diabetic mouse model

[0043] Sixty healthy male Kunming mice weighing approximately 20 g were housed in a 12-hour light / dark cycle at a temperature of 25–30°C, a relative humidity of 45–55%, and acclimated for one week. Following this acclimation period, the mice were fasted for 12 hours with or without water, and their blood glucose levels were measured. After removing mice with abnormal blood glucose levels, 10 mice were randomly selected from the control group. The remaining mice were treated with streptozotocin (STZ) to establish a type 2 diabetes model. The control group mice were intraperitoneally injected with citrate buffer, while the remaining mice were intraperitoneally injected with 80 mg / kg STZ for three consecutive days. Three days after STZ injection, the mice were fasted for 12 hours with or without water, and their fasting blood glucose levels were measured. A fasting blood glucose level greater than 11.1 mmol / L was considered a successful model.

[0044] Example 4 Effects of siRNA on Blood Glucose Levels in Diabetic Model Mice

[0045] Primer siRNA is designed in the homologous region of human and mouse MGAM genes, and the effect of siRNA on blood glucose levels can be evaluated in diabetic model mice.

[0046] (1) According to the modeling conditions and the principle of similar blood sugar levels, the experimental mice were divided into 4 groups, with 6 mice in each group, namely the normal control group (NC), the diabetic model group (MC), the unmodified siRNA group, and the base-modified siRNA group.

[0047] (2) All mice in each group were fed a high-starch diet at 7:00 AM and 7:00 PM daily with free access to water. After 7 days of high-starch diet feeding, the unmodified siRNA group and the base-modified siRNA group were each intravenously injected with 100 μL of siRNA-liposome complex. Blood glucose levels were measured 30 minutes after feeding on the day of injection and every other day thereafter. The growth of the mice was observed and recorded.

[0048] from Figure 2 The results showed that the postprandial blood glucose levels of the normal control group were less than 11.1 mmol / L throughout the experimental period; the postprandial blood glucose levels of the diabetic model group fluctuated between 24.44 and 27.74 mmol / L; the postprandial blood glucose levels of the mice dropped to around 15.7 mmol / L on the second day after injection of unmodified siRNA and base-modified siRNA, and dropped to below 11.1 mmol / L on the fourth day, reaching normal values; the normal blood glucose level of the unmodified siRNA group could be maintained until the sixth day, rising to 12.87 on the eighth day, and then rising rapidly day by day, reaching the level of the diabetic model group on the 14th day; the normal blood glucose level of the base-modified siRNA group could be maintained until the tenth day, rising to 13.30 on the 12th day, and then rising slowly to 17.62 on the 20th day, which was significantly lower than that of the diabetic model group. It can be seen that both the unmodified siRNA and the base-modified siRNA of the present invention can effectively silence the expression of maltase-glucoamylase and reduce postprandial hyperglycemia. The base-modified siRNA has improved stability, which can prolong the duration of efficacy and reduce the number of medications. The unmodified siRNA of the present invention can be used as a short-acting preparation, and the base-modified siRNA can be used as a long-acting preparation. When used in a preparation for treating postprandial hyperglycemia, it can effectively control postprandial blood sugar levels.

Claims

1. An application of siRNA in preparing a preparation for treating postprandial hyperglycemia, characterized in that: The nucleotide sequence of the siRNA sense strand is SEQ ID NO.1, and the nucleotide sequence of the antisense strand is SEQ ID NO.

2.

2. The use according to claim 1, characterized in that The siRNA is unmodified siRNA when used as a short-acting preparation.

3. The use according to claim 1, characterized in that The siRNA is a base-modified siRNA when used as a long-acting preparation. The base modification sites of the siRNA are 2'-OMe modification at bases 1 and 2 of the sense chain, 2'-F modification at bases 16, 18, and 20 of the antisense chain, and 2'-OMe modification at base 17 of the antisense chain.

Images