Use of a coding gene of a maize MYB transcription factor ZmMYBIF35 in regulating drought tolerance of a plant
By overexpressing the maize MYB transcription factor ZmMYBIF35 gene, the problem of physiological metabolic damage in maize under drought stress was solved, which enhanced the drought resistance and physiological adaptability of maize plants and promoted the breeding of new stress-resistant maize varieties.
Patent Information
- Application Number
- CN202510824782.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-19
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2045-06-19
AI Technical Summary
In the current technology, the response mechanism of maize to drought stress is unclear, and the functions of most MYB proteins have not been elucidated, which leads to impaired physiological metabolism and reduced yield in maize under drought conditions. In addition, frequent drought events affect food security.
By overexpressing the maize MYB transcription factor ZmMYBIF35 gene, we can use genetic engineering technology to create crop varieties with enhanced drought resistance, regulate the drought resistance of plants, and enhance their physiological adaptability under drought conditions.
Overexpression of the ZmMYBIF35 gene significantly improved the drought resistance of maize plants, enhanced their physiological adaptability and recovery ability under drought conditions, and provided a theoretical basis and application value for new stress-resistant maize varieties.
Smart Images

Figure CN120519503B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of genetic engineering and crop genetic breeding, and particularly relates to application of a coding gene of a maize MYB transcription factor ZmMYBIF35 in regulating drought tolerance of a plant. BACKGROUND
[0002] Maize (Zea mays L.) is an important food, feed and industrial raw material crop in the world, but its production has long been facing the severe challenge of drought stress. According to statistics, drought causes maize yield reduction of 20%-50% globally. Drought stress destroys maize physiological metabolism through multidimensional mechanisms: drought at the seedling stage inhibits root development, leading to reduced water absorption efficiency; drought at the tasseling stage causes asynchronous development of male and female spikes, directly affecting pollination success rate; in addition, drought-induced accumulation of reactive oxygen species (ROS) causes peroxidation of cell membrane lipids, and increased content of malondialdehyde (MDA) further aggravates oxidative damage. With the intensification of global climate change, extreme drought events occur frequently, and therefore, it is an urgent need to analyze the molecular mechanism of drought resistance of maize to ensure food security.
[0003] MYB proteins are a class of transcription factors with conserved structural characteristics, and their core functions depend on the MYB domain composed of 1-4 repeat units (R). Each repeat unit is folded into three alpha-helices, and the second and third helices form a hydrophobic core through a "helix-turn-helix" (HTH) conformation, containing three key tryptophan residues, which are responsible for recognizing and binding to specific sequences in the major groove of DNA (such as MYB recognition elements). According to the number of repeat units, MYB proteins are divided into four categories: 1R-MYB, R2R3-MYB, 3R-MYB, and 4R-MYB. Among them, R2R3-MYB is the most widely distributed subclass in plants, and its C-terminal variable regulatory domain (such as acidic amino acid clusters) confers its transcriptional activation or inhibition function, and is widely involved in drought response, secondary metabolism and other processes.
[0004] In maize, 203 members of the MYB family have been identified, but only 16 have been clearly assigned drought resistance function, and 48 members are predicted to be related to drought resistance through phylogenetic tree, indicating a huge potential and unknown field of their functional research. For example, ZmMYB86 enhances drought tolerance by regulating ethylene signaling pathway genes (ZmERF-107, ZmEIN3). However, the functions of most MYB proteins have not been analyzed, and the synergistic mechanism of MYB proteins with other signaling pathways (such as ABA, ROS metabolism) is still unclear. Therefore, the exploration and development of maize MYB transcription factor genes will have important significance for breeding new drought-resistant maize varieties and improving maize yield. In view of this, the application provides application of a coding gene of a maize MYB transcription factor ZmMYBIF35 in regulating drought tolerance of a plant. SUMMARY
[0005] The application aims at providing an application of a coding gene of a corn MYB transcription factor ZmMYBIF35 in regulating drought tolerance of plants to solve the above problems.
[0006] The application achieves the above-mentioned purposes through the following technical solutions.
[0007] The application provides an application of a coding gene of a corn MYB transcription factor ZmMYBIF35 in regulating drought tolerance of plants.
[0008] As a further optimization scheme of the application, the CDS sequence of the coding gene of the transcription factor ZmMYBIF35 is shown in SEQ ID NO. 1, and the genomic sequence is shown in SEQ ID NO. 2.
[0009] As a further optimization scheme of the application, the amino acid sequence of the transcription factor ZmMYBIF35 is shown in SEQ ID NO. 3.
[0010] As a further optimization scheme of the application, the ZmMYBIF35 gene positively regulates drought tolerance of crop plants.
[0011] As a further optimization scheme of the application, in the process of plant breeding, a crop variety with overexpression of the ZmMYBIF35 gene is created by using genetic engineering technology, and then a crop variety with enhanced drought tolerance is obtained.
[0012] As a further optimization scheme of the application, in the process of plant breeding, a crop variety with normal expression of the ZmMYBIF35 gene is screened from a natural ecological type.
[0013] As a further optimization scheme of the application, the crop is corn.
[0014] The application has the following beneficial effects.
[0015] The application analyzes the corn plants with overexpression of the ZmMYBIF35 gene, finds that the ZmMYBIF35 gene can regulate drought tolerance of plants, and overexpression of the ZmMYBIF35 gene can enhance drought tolerance of plants, thereby providing important theoretical significance and application value for creating new germplasm of corn and molecular breeding of corn. BRIEF DESCRIPTION OF DRAWINGS
[0016] Figure 1 is an evolutionary tree analysis diagram of ZmMYBIF35;
[0017] Figure 2 is a schematic diagram of subcellular localization of ZmMYBIF35 protein in corn protoplast (nuclear localization signal mCherry is a nuclear marker);
[0018] Figure 3 is the phenotype verification of overexpression of ZmMYBIF35 in yeast INVSC1 cells under drought stress;
[0019] Figure 4 is the induced expression pattern analysis of ZmMYBIF35 under drought stress;
[0020] Figure 5 is the phenotype analysis and physiological and biochemical index determination before and after drought treatment under soil culture conditions. DETAILED DESCRIPTION
[0021] It is necessary to point out here that the following detailed description is only used to further illustrate the application and cannot be understood as limiting the scope of protection of the application. Those skilled in the art can make some non-essential improvements and adjustments to the application according to the above application content.
[0022] It should be noted that the corn inbred line KN5585 used in the following examples was purchased from Jiangsu Biotech Co., Ltd.; the INVSC1 yeast strain was from Weidi Biology; the primers used were synthesized by Shanghai Shengong Biological Co., Ltd.; sequencing was performed by Tongyong Biological Co., Ltd.; various restriction endonucleases, ligase, pEASY-Blunt Simple, DNA Marker, Taq DNA polymerase, dNTPs, etc. used in the experiment were purchased from Takara Co., Ltd.; the reverse transcription kit was purchased from Promega Co., Ltd.; the plasmid extraction kit, gel recovery kit and genome extraction kit were purchased from Quanshijin Biotechnology Co., Ltd., and the methods were performed according to the instructions.
[0023] The methods used in the following examples are conventional methods known to those skilled in the art unless otherwise specified. The reagents not specifically specified are commercially available products.
[0024] Example 1 Construction of Phylogenetic Tree of Corn ZmMYBIF35 Gene
[0025] The CDS sequence, genomic sequence and protein sequence of ZmMYBIF35 gene were obtained by searching the NCBI database, as shown in SEQ ID NO. 1, SEQ ID NO. 2 and SEQ ID NO. 3, respectively. Then the MEGA11 software was used to construct the phylogenetic tree (as shown in Figure 1 ) to analyze the evolutionary relationship.
[0026] Example 2 Subcellular Localization of ZmMYBIF35
[0027] 1. Construction of Subcellular Localization Vector of ZmMYBIF35
[0028] In order to understand the expression of ZmMYBIF35 protein, a subcellular localization fusion expression vector was constructed. pCAMBIA1305 (p1305) was used as a backbone, and GFP green fluorescent protein was used as a reporter gene to construct a p1305-35S-ZmMYBIF35-GFP fusion expression vector. When designing gene primers, the stop codon of the gene was removed, and XbaI and BamHI were used as enzyme digestion sites for upstream and downstream primers. The primers were synthesized by a GenScript Biotech company. The primer sequences are as follows:
[0029] SEQ ID NO. 4:
[0030] 1305-F: GTCCGGAGCTAGCTCTAGAATGGGGAGGGCGCCGT;
[0031] SEQ ID NO. 5:
[0032] 1305-R: CCTTGCTCACCATGGATCCGAGATTGTCCAGGAAGAAGAGGTC.
[0033] 2. Corn protoplast extraction
[0034] (1) The B73 corn seeds were grown in the dark for about 2 weeks, and the yellowing seedlings with good growth were taken 1.5 g, and the leaf veins were removed. The small leaf strips were cut into 0.2 mm thin strips in a dark environment using a scalpel;
[0035] (2) The cut small leaf strips were placed in the pre-prepared enzyme solution (15 mL), and the tweezers were used to completely immerse them;
[0036] (3) The vacuum pump was used to extract in the dark for 30 minutes to accelerate the full contact of the enzyme solution and the cell wall;
[0037] (4) Incubate at room temperature using a horizontal shaker at 40 rpm, and enzymatically digest for 6 hours in the dark;
[0038] (5) Pre-cool a certain amount of W5 solution and an empty sterile 50 mL round-bottom centrifuge tube (ice bath);
[0039] (6) Rinse the 100-mesh metal sieve with W5, and filter and dilute the protoplast-containing enzyme solution;
[0040] (7) Adjust the acceleration and deceleration of the refrigerated centrifuge to low, 100 g, 4°C centrifugation for 2 minutes, and aspirate the supernatant. Add 5 mL of ice-precooled W5 solution, and slowly tilt the centrifuge tube to mix it;
[0041] (8) Darkly place on ice for 30 minutes, and centrifuge again at 100 g, 4°C for 2 minutes;
[0042] (9) Darkly remove W5 solution as much as possible, and add appropriate amount of MMG solution according to the amount of the precipitate, and resuspend the protoplasts by the same method. Check the state and quantity of the protoplasts in the solution under a microscope on a hemocytometer, so that the final concentration is not less than 1 x 106 / mL;
[0043] (10) Add 5 μg of recombinant plasmid DNA and 5 μg of localization signal (the concentration is preferably more than 500 ng / μL) to a 2 mL round-bottom EP tube;
[0044] (11) Add 100 μL of protoplasts (about 2 x 104) and mix gently;
[0045] (12) Add 120 μL (the volume is the sum of the volumes of steps 10 and 11) of PEG 4000 solution and mix gently;
[0046] (13) Perform induction on ice in the dark, and select the transformation time according to the expression amount, generally for 1 hour;
[0047] (14) Dilute the transformation mixture with 480 μL (four times the volume added in step 12) of W5 solution at room temperature, and mix gently to terminate the transformation reaction;
[0048] (15) Centrifuge for 2 minutes at room temperature, try to remove the supernatant, and then rinse once with W5 solution and centrifuge to remove the supernatant;
[0049] (16) Resuspend the cells with W1 / W5 solution, and then transfer them to a multi-well tissue culture dish and wrap them with tin foil;
[0050] (17) Culture the protoplasts at room temperature for 24-36 hours, and then observe them with a laser confocal microscope.
[0051] The results are shown in Figure 2 , and the ZmMYBIF35-GFP fusion protein is specifically localized in the nucleus, and its fluorescence signal completely coincides with the nuclear localization signal, confirming that ZmMYBIF35 is a nuclear localization protein.
[0052] Example 3 Verification of ZmMYBIF35 yeast overexpression phenotype
[0053] 1. Construction of overexpression vector
[0054] The ZmMYBIF35 gene was constructed into the pYES2-NTB expression vector using the pYES2-NTB empty vector as a control, and the primer sequences used are as follows:
[0055] SEQ ID NO. 6:
[0056] NTB-F: ATAAGGTACCTAAGGATCCATGGGGAGGGCGCCG;
[0057] SEQ ID NO.7:
[0058] NTB-R: CTGGATATCTGCAGAATTCCTAGAGATTGTCCAGGAAGAAGA.
[0059] 2. Yeast transformation and overexpression phenotype verification
[0060] (1) Prepare a series of SG-Ura (galactose instead of glucose) liquid medium containing 0 mM, 30 mM, 60 mM, 90 mM, 120 mM and 135 mM PEG 3350;
[0061] (2) Transform the recombinant vector pYES2-NTB-ZmMYBIF35 and the empty vector pYES2-NTB into the INVSC1 yeast strain, respectively;
[0062] (3) For each transformation, suspend the cells with 200 μL of sterile water, mix gently as much as possible, and spread on SG-Ura deficient selection plates and incubate at 30°C for 3 days;
[0063] (4) Pick single colonies and inoculate into SG-Ura liquid medium for expansion culture;
[0064] (5) When the OD600 value of the bacterial solution reaches 0.8-1.0, take 200 mL of bacterial solution into SG-Ura liquid medium containing different concentrations of PEG 3350 for stress treatment for 24 hours, then plate and invert in a constant temperature incubator at 30°C for 2-3 days. Observe the experimental results and take photos.
[0065] The results are shown in Figure 3 , which demonstrate that overexpression of ZmMYBIF35 can significantly improve the tolerance of yeast cells under drought stress.
[0066] Drought induction analysis of ZmMYBIF35 with 20% PEG 6000 showed that Figure 4 , after drought stress, the expression of ZmMYBIF35 gradually increased, reaching a maximum after 6 hours, and then gradually decreased.
[0067] Example 4: Obtaining and identifying ZmMYBIF35 transgenic lines
[0068] 1. pCAMBIA3301-GUS vector information
[0069] The pCAMBIA3301-GUS vector is 11.32 kb in size and mainly includes the Ka antibiotic resistance gene, replication elements, a Bar gene selection gene driven by the CaMV 35S promoter, a GUS sequence driven by the CaMV 35S promoter, and a target gene DNA sequence driven by the Ubi promoter. Because it contains the Bar gene, it can be detected later using a specific rapid Bar gene test strip.
[0070] 2. Construction of the carrier
[0071] Using the T4 ligase method, the pCAMBIA3301-GUS vector was first digested to linearize it, and then the ZmMYBIF35 gene DNA fragment was ligated into the pCAMBIA3301-GUS vector. After the vector was verified to be correct, it was sent to Weimi Biotechnology (Jiangsu) Co., Ltd. for genetic transformation using the KN5585 strain as the genetic background.
[0072] 3. Screening for positive seedlings
[0073] Cut a tender corn leaf about 0.5cm long and place it in a 1.5mL centrifuge tube. Add an appropriate amount of pure water and grind it thoroughly with a grinder until the liquid is turbid and homogenized. Then insert the test strip upright into the centrifuge tube, making sure the liquid level does not exceed the detection area. After a clear band appears, read and record the test results within 8 to 10 minutes. Two ZmMYBIF35 overexpression lines, OE3 and OE4, were screened out.
[0074] 4. Phenotypic verification and physiological and biochemical index determination of ZmMYBIF35 overexpression lines
[0075] The KN5585 line with uniform grain size was selected as the control group, and two ZmMYBIF35 overexpressing lines, OE3 and OE4, were selected as the experimental groups. Both lines were subjected to 14 days of natural drought treatment, followed by rehydration. After 14 days of natural drought treatment, leaves of each line under drought stress were collected for physiological index measurement and photography.
[0076] like Figure 5 As shown, after 14 days of natural drought treatment, the KN5585 strain exhibited typical drought stress symptoms, including leaf dehydration, curling, and yellowing, while the OE3 and OE4 strains maintained better growth. After 7 days of rehydration, the OE3 and OE4 strains showed strong recovery ability, while the KN5585 strain showed wilting and drying. Figure 5 A), the survival rates of OE3 and OE4 strains were also higher than those of KN5585 ( Figure 5 (B) demonstrates significant drought resistance advantages;
[0077] Meanwhile, the relative conductivity of all plants showed an upward trend, but the relative conductivity of KN5585 strain was significantly higher than that of OE3 and OE4 strains Figure 5 C); the relative water content of all plants decreased, but the water content of OE3 and OE4 strains was significantly higher than that of KN5585 strain Figure 5 D);
[0078] The above results fully prove that the drought tolerance phenotype of the transgenic strain is caused by overexpression of the ZmMYBIF35 gene.
[0079] The above examples only express several embodiments of the present application, and the description is more specific and detailed, but it cannot be understood as limiting the scope of the patent of the present application. It should be pointed out that for ordinary skilled persons in the art, without departing from the concept of the present application, several modifications and improvements can be made, which belong to the protection scope of the present application.
Claims
1. Application of a coding gene of a maize MYB transcription factor ZmMYBIF35 in regulating drought tolerance of a plant, characterized in that, The ZmMYBIF35 gene positively regulates drought tolerance of a crop plant, which is corn; A CDS sequence of a coding gene of the transcription factor ZmMYBIF35 is shown in SEQ ID NO. 1, and an amino acid sequence of the transcription factor ZmMYBIF35 is shown in SEQ ID NO.
3.
2. Use according to claim 1, characterized in that, In the process of plant breeding, a crop variety with overexpression of the ZmMYBIF35 gene is created by using genetic engineering technology, and then a crop variety with enhanced drought tolerance is obtained.