Method for relieving lupus nephritis by using DMH2 to block BMPR2

Blocking the BMPR2 signaling pathway by DMH2 solves the problem that BMPR2 cannot be targetedly regulated in the prior art, effectively treating lupus nephritis, significantly alleviating the proliferation and activation of glomerular endothelial cells, and improving the pathological status of lupus nephritis.

CN120519573APending Publication Date: 2025-08-22THE AFFILIATED SIR RUN RUN SHAW HOSPITAL OF SCHOOL OF MEDICINE ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510651308.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-20
Publication Date
2025-08-22

AI Technical Summary

Technical Problem

The prior art lacks effective methods to target BMPR2 to treat lupus nephritis, which cannot effectively inhibit the proliferation and activation of glomerular endothelial cells, resulting in serious pathological manifestations of lupus nephritis.

Method used

DMH2 is used as a selective inhibitor of BMPR2 to inhibit the activation of endothelial cells by blocking the BMP/Smad signaling pathway. The inhibitory effect of DMH2 on BMPR2 is verified by single cell nucleus sequencing, urinary ELISA detection, renal histopathology analysis, immunofluorescence chemical analysis, cell culture research, real-time quantitative PCR detection and protein assay.

Benefits of technology

It significantly alleviates the clinical and pathological manifestations of lupus nephritis, reduces glomerular endothelial cell proliferation and sclerosis, inhibits abnormal proliferation and activation of endothelial cells, and improves the pathological progress of lupus nephritis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120519573A_ABST
    Figure CN120519573A_ABST
Patent Text Reader

Abstract

The invention relates to a method for relieving lupus nephritis by blocking BMPR2 (bone morphogenetic protein receptor 2) by DMH2 (dimethyl H2), which comprises single cell nucleus sequencing, urine ELISA (enzyme-linked immuno sorbent assay) detection, kidney histopathologic analysis, immunofluorescence chemical analysis, cell culture research, real-time quantitative PCR (polymerase chain reaction) detection, protein determination and statistical analysis, a plurality of events related to glomerular endothelial cell proliferation and activation are inhibited by utilizing the inhibition effect of DMH2 on BMPR2, the lupus nephritis is remarkably relieved, the DMH2 targeting the BMPR2 becomes a treatment strategy for resisting the lupus nephritis and delaying the progress of the lupus nephritis, and the application has the advantages that a new method for treating the lupus nephritis is developed, and the effect of relieving the lupus nephritis is good.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of biological treatment of systemic lupus erythematosus, and in particular to a method for alleviating lupus nephritis by blocking BMPR2 with DMH2. Background Art

[0002] Systemic lupus erythematosus (SLE) is a chronic diffuse connective tissue disease caused mainly by abnormal activation of the immune system, which attacks its own tissues. The treatment of SLE usually relies on multiple therapies, including drug therapy, phototherapy and lifestyle changes; commonly used drug treatments mainly include non-steroidal anti-inflammatory drugs, antimalarial drugs, immunosuppressive drugs and corticosteroids. Although SLE cannot be completely cured at present, most patients can control their symptoms and improve their quality of life through reasonable treatment and management.

[0003] Lupus nephritis (LN) is a common and serious complication of systemic lupus erythematosus (SLE) and one of the important causes of renal failure. The pathological characteristics of lupus nephritis include abnormal activation and excessive proliferation of glomerular endothelial cells, which eventually lead to glomerular sclerosis. Therefore, studying the key mechanisms of abnormal activation and proliferation of glomerular endothelial cells is crucial for the treatment of lupus nephritis.

[0004] Among them, BMPR2 (bone morphogenetic protein receptor type II), as an important regulatory factor of the BMP signaling pathway, plays a key role in regulating the proliferation and activation of glomerular endothelial cells. DMH2 is a selective inhibitor of BMPR2. It inhibits the activation of endothelial cells by specifically blocking the BMP / Smad signaling pathway. However, there is currently no targeted regulation method for BMPR2 to promote the advancement of lupus nephritis treatment methods. Summary of the Invention

[0005] In view of this, the present invention proposes a method for alleviating lupus nephritis by blocking BMPR2 using DMH2, which is applied to the field of biological treatment technology for systemic lupus erythematosus. Through the inhibitory effect of DMH2 on BMPR2, the technical problems that there is currently no effective treatment method targeting BMPR2, the multiple events related to glomerular endothelial cell proliferation and activation cannot be inhibited, and lupus nephritis cannot be significantly alleviated are solved.

[0006] In order to achieve the above technical objectives, the specific technical solutions adopted by the present invention are:

[0007] A method for alleviating lupus nephritis by blocking BMPR2 using DMH2 comprises the following steps:

[0008] S1, single cell nucleus sequencing;

[0009] S2, urine ELISA test;

[0010] S3, renal histopathological analysis;

[0011] S4, immunofluorescence analysis;

[0012] S5. Cell culture studies, including cell proliferation and cell migration assays;

[0013] S7, real-time quantitative PCR detection;

[0014] S8, protein determination;

[0015] S9. Statistical analysis.

[0016] Furthermore, step S1 includes the following steps:

[0017] S101. Mouse and human kidney tissues were collected and prepared into single cell nuclear suspensions, including tissue homogenization, filtration, and nuclear extraction methods.

[0018] S102. Single-nucleus sequencing of samples was performed using the commercial 10X Genomics sequencing platform to obtain high-throughput transcriptome data.

[0019] S103: The raw data obtained from sequencing were quality controlled and low-quality nuclei were removed. Preliminary data processing was also performed, including filtering, removal of double nuclei, and batch effect correction.

[0020] S104. Use the Seurat package in R language to analyze the processed single-cell nucleus data.

[0021] Furthermore, step S2 includes the following steps:

[0022] S201, 24-hour urine collection from mice in the control group, lupus nephritis group, and DMH2-treated group;

[0023] S202, centrifuge at 1500 g for 10 minutes to remove cells and impurities that may be present in the urine sample;

[0024] S203. According to the instructions of the ELISA kit, the urine creatinine and albumin levels in the sample are measured respectively;

[0025] S204. Calculate the urine albumin to creatinine ratio (ACR) to evaluate changes in renal function in different treatment groups.

[0026] Furthermore, step S2 includes the following steps:

[0027] S301, the kidneys were fixed in 4% paraformaldehyde (PFA) overnight, dehydrated and embedded in paraffin, and then cut into 3 μm sections transversely;

[0028] S302. After deparaffinization, the kidney sections were stained with HE.

[0029] Furthermore, step S4 includes the following steps:

[0030] S401. Mouse kidney tissue was freshly frozen and 8-10 μm thick frozen sections were prepared on a microtome and mounted on glass slides.

[0031] S402, the slices were dried naturally at room temperature for 30 minutes;

[0032] S403, gently wash the dried sections in 1× PBS to remove excess freezing medium;

[0033] S404, permeabilize tissue sections with 0.1% Triton-X 100 at room temperature for 10 minutes;

[0034] S405, sections were blocked in 5% normal goat serum for 1 hour to reduce nonspecific binding;

[0035] S406. Incubate the slides with anti-Bmpr2 (1:200) and anti-Cd31 (1:100) antibodies at 4°C overnight;

[0036] S407. The next day, the sections were washed with PBS and incubated with Alexa Fluor-labeled secondary antibodies at room temperature for 1 hour.

[0037] S408. Finally, the cell nuclei were stained with DAPI and the signals were observed under a fluorescence microscope.

[0038] Furthermore, step S5 includes the following steps:

[0039] S501. Grow normal mouse glomerular endothelial cells in DMEM supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin solution and culture in a 37°C, 5% CO2 incubator.

[0040] S502, subculture the cells at 60% to 80% confluence using 0.25% trypsin-0.02% EDTA;

[0041] S503, transfecting cells with a chronic virus containing Bmpr2 according to the supplier's instructions, and further culturing after transfection;

[0042] S504, after transfection, cells were treated with 2 μM DMH2 for 24 h;

[0043] S505. After 24 hours, cells were collected for Transwell l cell migration assay, real-time cell analysis system cell proliferation analysis, qRT-PCR analysis and WB analysis.

[0044] Furthermore, step S6 includes the following steps:

[0045] S601. Extract total RNA from tissues or cells using RNA isoPlus reagent.

[0046] S602, reverse transcription of cDNA using PrimeScript™ RT Master Mix;

[0047] S603, real-time PCR amplification using SYBR Green PCR Master Mix and ABI 7500 real-time PCR detection system;

[0048] The temperature cycling conditions were 95°C for 10 min, 95°C for 15 s, and 60°C for 1 min. The relative expression levels of mRNA were normalized to β-actin and calculated using the 2-ΔΔCT method. The required primers were designed and synthesized by Sangon Biotech Co., Ltd.

[0049] Furthermore, in step S7, the specific steps are as follows:

[0050] S701. Homogenize tissue or cell lysate using RIPA buffer containing 1x protease inhibitor and 1x phosphatase inhibitor;

[0051] S702, then centrifuging the sample at 5000 rpm for 30 minutes;

[0052] S703, determine the protein concentration using a BCA protein assay kit;

[0053] S704 and equivalent samples were used for antibodies against BMPR2 (1:500), ID1 (1:500), ID3 (1:500), SMAD1 (1:500), pSMAD1 (1:500), and β-actin (1:500), followed by the addition of HRP-conjugated secondary antibodies (1:5000);

[0054] S705, immunoreactive bands were visualized using the Amersham Biosciences ECL detection system;

[0055] S706. Perform optical density analysis by measuring the intensity of the bands and normalize them to the corresponding β-actin bands using Quantity One software.

[0056] Furthermore, step 8 includes the following steps:

[0057] S801, all quantitative values ​​are expressed as mean ± standard error of the mean SEM;

[0058] S802, statistical differences between the two groups were analyzed by two-tailed Student t test using GraphPad Prism;

[0059] S803. One-way analysis of variance was used for comparison among multiple groups, where P < 0.05 was considered statistically significant.

[0060] By adopting the above technical solution, the present invention can also bring the following beneficial effects:

[0061] 1. The present invention discloses a method for alleviating lupus nephritis by blocking BMPR2 with DMH2. BMPR2 significantly alleviates the clinical and pathological manifestations of lupus nephritis. ACR is considered a key indicator of the severity of lupus nephritis, and its content increases significantly after treatment. Glomerular endothelial cell proliferation and glomerulosclerosis are the core pathological manifestations of lupus nephritis. DMH2 treatment can significantly improve the pathological manifestations of glomerular endothelial cell proliferation and glomerulosclerosis in lupus nephritis, thereby inferring the status of glomerular endothelial cell proliferation and glomerulosclerosis.

[0062] 2. The present invention mentions a method of using DMH2 to block BMPR2 to alleviate lupus nephritis. BMPR2 is an important receptor on the surface of endothelial cells and plays a role in promoting endothelial cell proliferation and activation. Single cell nuclear RNA sequencing analysis confirmed that BMPR2 expression was significantly increased in glomerular endothelial cells of lupus patients and lupus nephritis mice. At the same time, immunofluorescence staining, WB and qRT-PCR analysis of lupus mice also confirmed this. This shows that DHM2, as a specific inhibitor of BMPR2, can effectively inhibit BMPR2-mediated abnormal proliferation of lupus nephritis endothelial cells, thereby alleviating the occurrence of lupus nephritis and delaying its progression.

[0063] 3. The present invention mentions a method for alleviating lupus nephritis by blocking BMPR2 with DMH2. It has been demonstrated that DMH2 can significantly reduce the transcription levels of Vcam1 and Icam1, the activation products of glomerular endothelial cells, thereby effectively improving lupus nephritis. The pharmacological action of DMH2 blocking BMPR2 can inhibit several events related to abnormal proliferation of glomerular endothelial cells and significantly alleviate lupus nephritis. It has the advantage of good therapeutic effect and is of groundbreaking significance for the treatment of lupus nephritis. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0065] Figure 1 This is a flow chart of a method for diagnosing lupus nephritis based on BMPR2 gene expression in the invention;

[0066] Figure 2 This is a bubble diagram of the expression of key genes for glomerular endothelial cell proliferation and migration in humans and mice in Example 1;

[0067] Figure 3 This is a bubble diagram showing the expression of the gene Bmpr2 in different endothelial cell subtypes in Example 1;

[0068] Figure 4 This is an immunofluorescence staining image of BMPR2 expression in the kidneys of control and lupus mice in Example 1;

[0069] Figure 5 The bar graph is a relative quantification of mRNA of Bmpr2 and its downstream genes in the kidneys of control and lupus mice in Example 1;

[0070] Figure 6 The bar graph is a relative quantification of mRNA of Bmpr2 and its downstream genes in the kidneys of control and lupus mice in Example 1;

[0071] Figure 7 This is the position distribution map of RNA sequencing analysis of single cell nuclei in Example 1;

[0072] Figure 8 This is a bar graph showing changes in urine ACR in lupus mice after treatment with DMH2 in Example 1;

[0073] Figure 9 This is a Western blot image showing the expression of BMPR2 and its downstream related proteins in the kidneys of lupus mice after DMH2 treatment in Example 1;

[0074] Figure 10 This is a bar graph showing the relative quantification of Bmpr2 and its downstream genes mRNA in the kidneys of lupus mice after DMH2 treatment in Example 1;

[0075] Figure 11 This is a microscopic observation of the glomerular endothelial cells cultured in vitro after DMH2 intervention in Example 1;

[0076] Figure 12This is a bar graph showing the effect of DMH2 treatment on the migration rate of glomerular endothelial cells in vitro in Example 1;

[0077] Figure 13 This is a bar graph showing the effect of in vitro DMH2 treatment on the proliferation activity of glomerular endothelial cells in Example 1;

[0078] Figure 14 This is a bar graph showing the mRNA levels of Bmpr2 and its downstream genes in glomerular endothelial cells treated with DMH2 in vitro in Example 1. DETAILED DESCRIPTION

[0079] The embodiments of the present invention are described in detail below with reference to the accompanying drawings.

[0080] The following describes the embodiments of the present invention through specific examples. Those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, in the absence of conflict, the following embodiments and features in the embodiments can be combined with each other. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0081] It should be noted that various aspects of the embodiments within the scope of the appended claims are described below. It should be apparent that the aspects described herein can be embodied in a wide variety of forms, and any specific structure and / or function described herein is merely illustrative. Based on the present invention, it should be understood by those skilled in the art that an aspect described herein can be implemented independently of any other aspect, and two or more of these aspects can be combined in various ways. For example, any number of aspects described herein can be used to implement an apparatus and / or practice a method. In addition, other structures and / or functionalities other than one or more of the aspects described herein can be used to implement this apparatus and / or practice this method.

[0082] It should also be noted that the illustrations provided in the following embodiments are merely schematic illustrations of the basic concept of the present invention. The illustrations only show components related to the present invention and are not drawn according to the number, shape, and size of components in actual implementation. In actual implementation, the type, quantity, and proportion of each component may be changed arbitrarily, and the component layout may also be more complex.

[0083] Additionally, in the following description, specific details are provided to provide a thorough understanding of the examples. However, one skilled in the art will appreciate that the aspects described can be practiced without these specific details.

[0084] Example 1

[0085] like Figure 1 As shown, a method for alleviating lupus nephritis by blocking BMPR2 using DMH2 comprises the following steps:

[0086] S1, single cell nucleus sequencing;

[0087] The specific steps include:

[0088] S101. Mouse and human kidney tissues were collected and prepared into single cell nuclear suspensions, including tissue homogenization, filtration, and nuclear extraction methods.

[0089] S102. Single-nucleus sequencing (snRNA-seq) of samples was performed using the commercial 10X Genomics sequencing platform to obtain high-throughput transcriptome data.

[0090] S103: The raw data obtained from sequencing were quality controlled and low-quality nuclei were removed. Preliminary data processing was also performed, including filtering, removal of double nuclei, and batch effect correction.

[0091] S104. Use the Seurat package in R language to analyze the processed single-cell nucleus data.

[0092] S2, urine ELISA test;

[0093] The specific steps include:

[0094] S201, 24-hour urine collection from mice in the control group, lupus nephritis group, and DMH2-treated group;

[0095] S202, centrifuge at 1500 g for 10 minutes to remove cells and impurities that may be present in the urine sample;

[0096] S203. According to the instructions of the ELISA kit, the urine creatinine and albumin levels in the sample are measured respectively;

[0097] S204. Calculate the urine albumin to creatinine ratio (ACR) to evaluate changes in renal function in different treatment groups.

[0098] S3, renal histopathological analysis;

[0099] The specific steps include:

[0100] S301, the kidneys were fixed in 4% paraformaldehyde (PFA) overnight, dehydrated and embedded in paraffin, and then cut into 3 μm sections transversely;

[0101] S302. After deparaffinization, the kidney sections were stained with HE.

[0102] S4, immunofluorescence analysis;

[0103] The specific steps include:

[0104] S401. Mouse kidney tissue was freshly frozen and 8-10 μm thick frozen sections were prepared on a microtome and mounted on glass slides.

[0105] S402, the slices were dried naturally at room temperature for 30 minutes;

[0106] S403, gently wash the dried sections in 1× PBS to remove excess freezing medium;

[0107] S404, permeabilize tissue sections with 0.1% Triton-X 100 at room temperature for 10 minutes;

[0108] S405, sections were blocked in 5% normal goat serum for 1 hour to reduce nonspecific binding;

[0109] S406. Incubate the slides with anti-Bmpr2 (1:200) and anti-Cd31 (1:100) antibodies at 4°C overnight;

[0110] S407. The next day, the sections were washed with PBS and incubated with Alexa Fluor-labeled secondary antibodies at a dilution of 1:500 for 1 hour at room temperature.

[0111] S408. Finally, the cell nuclei were stained with DAPI and the signals were observed under a fluorescence microscope.

[0112] S5, cell culture studies;

[0113] The specific steps include:

[0114] S501. Grow normal mouse glomerular endothelial cells in DMEM supplemented with 10% bovine serum and 1% penicillin-streptomycin solution and culture in a 37°C, 5% CO2 incubator.

[0115] S502, subculture the cells at 60% to 80% confluence using 0.25% trypsin-0.02% EDTA;

[0116] S503, transfecting cells with a chronic virus containing Bmpr2 according to the supplier's instructions, and further culturing after transfection;

[0117] S504, after transfection, cells were treated with 2 μM DMH2 for 24 h;

[0118] S505. After 24 hours, cells were collected for Transwell l cell migration assay, real-time cell analysis system cell proliferation analysis, qRT-PCR analysis, and WB analysis.

[0119] S6, real-time quantitative PCR;

[0120] The specific steps include:

[0121] S601. Extract total RNA from tissues or cells using RNA isoPlus reagent.

[0122] S602, reverse transcription of cDNA using PrimeScript™ RT Master Mix;

[0123] S603, real-time PCR amplification using SYBR Green PCR Master Mix and ABI 7500 real-time PCR detection system;

[0124] The temperature cycling conditions were 95 °C for 10 min, 95 °C for 40 cycles for 15 s, and 60 °C for 1 min;

[0125] The relative expression levels of mRNA were normalized to β-actin and calculated using the 2-ΔΔCT method. The required primers were designed and synthesized by Sangon Biotech Co., Ltd. The primer sequences are shown in Table 1:

[0126] Table 1 Primer sequences used in the study

[0127] Primer name Primer sequences Id1 F CCTAGCTGTTCGCTGAAGGC Id1 R CTCCGACAGACCAAGTACCAC Id3 F CTGTCGGAACGTAGCCTGG Id3 R GTGGTTCATGTCGTCCAAGAG Vcam1 F AGTTGGGGATTCGGTTGTTCT Vcam1 R CCCCTCATTCCTTACCACCC Icam1 F GTGATGCTCAGGTATCCATCCA Icam1 R CACAGTTCTCAAAGCACAGCG Bmpr2 F TTGGGATAGGTGAGAGTCGAAT Bmpr2 R TGTTTCACAAGATTGATGTCCCC Mki67F ATCATTGACCGCTCCTTTAGGT Mki67R GCTCGCCTTGATGGTTCCT Pcna F TTTGAGGCACGCCTGATCC Pcna R GGAGACGTGAGACGAGTCCAT β-actin F TGCTGTCCCTGTATGCCTCTG β-actin R TGATGTCACGCACGATTTCC

[0128] S7, protein determination;

[0129] The specific steps are as follows:

[0130] S701. Homogenize tissue or cell lysate using RIPA buffer containing 1x protease inhibitor and 1x phosphatase inhibitor.

[0131] S702, then centrifuging the sample at 5000 rpm for 30 minutes;

[0132] S703, determine the protein concentration using a BCA protein assay kit;

[0133] S704 and equivalent samples were used for antibodies against BMPR2 (1:500), ID1 (1:500), ID3 (1:500), SMAD1 (1:500), pSMAD1 (1:500), and β-actin (1:500), followed by the addition of HRP-conjugated secondary antibodies (1:5000);

[0134] S705, immunoreactive bands were visualized using the Amersham Biosciences ECL detection system.

[0135] S706. Perform optical density analysis by measuring the intensity of the bands and normalize them to the corresponding β-actin bands using Quantity One software.

[0136] S8. Statistical analysis;

[0137] Includes the following:

[0138] S801, all quantitative values ​​are expressed as mean ± standard error of the mean SEM;

[0139] S802, statistical differences between the two groups were analyzed by two-tailed Student t test using GraphPad Prism;

[0140] S803. One-way ANOVA was used for comparison among multiple groups; P < 0.05 was considered statistically significant.

[0141] By performing the corresponding methods from S1 to S8, the following results are obtained:

[0142] (1) Regarding the expression of BMPR2 in human and mouse glomerular endothelial cells;

[0143] The expression of BMPR2 in human and mouse endothelial cells was observed by analyzing single cell nuclear RNA sequencing. Figure 2 As shown in Figure 2, single cell nuclear RNA sequencing analysis showed that BMPR2 expression was increased in human and mouse endothelial cells. Figure 3 These data indicate that BMPR2 is primarily expressed on glomerular endothelial cells in humans and mice. These data suggest that the development of lupus nephritis is accompanied by increased expression of BMPR2 on glomerular endothelial cells.

[0144] (2) Verification of increased BMPR2 expression in a lupus nephritis mouse model;

[0145] The increased expression of Bmpr2 was verified by immunofluorescence staining, Western blotting, and qRT-PCR. Figure 4As shown in Figure 2, Bmpr2 expression was significantly increased in glomerular endothelial cells of both early and late lupus mice. Figure 5 Western blot analysis confirmed that the protein expression levels of Bmpr2 and its downstream molecules ID1, ID3, and pSMAD1 were significantly upregulated in lupus mice. Figure 6 qRT-PCR also further confirmed that the expression level of Bmpr2 at the transcriptional level was significantly increased. At the same time, the transcription of Bmpr2 downstream molecules Id1, Id3, pSmad1, endothelial cell proliferation markers Mki67, Pcna, and endothelial cell activation markers Vcam1 and Icam1 was also significantly increased, indicating that the increased expression of Bmpr2 is related to the occurrence and development of lupus nephritis.

[0146] (3) DMH2 improved ACR and renal pathology in lupus nephritis mice;

[0147] We treated lupus nephritis mice with DMH2 and collected urine from them for comparison with that of the control group. Figure 7 As shown in the study, DMH2 treatment was found to be effective in reducing the ACR in lupus mice, which is often used to measure the severity of lupus nephritis. Figure 8 As shown, HE staining demonstrated that DMH2 treatment significantly reduced glomerular endothelial cell proliferation and significantly improved glomerulosclerosis in lupus mice compared with the treatment group.

[0148] (4) DMH2 inhibits the activation of glomerular endothelial cells in mice with lupus nephritis;

[0149] The effects of DMH2 on BMPR2 downstream molecules were further examined by WB and qRT-PCR. The results showed that after DMH2 treatment, the protein levels of BMPR2 downstream products in lupus nephritis were significantly reduced. Figure 9 As shown in Figure 2, their mRNA levels were also significantly decreased after DMH2 treatment, as shown in Figure 2. Figure 10 This provides strong evidence that DMH2 treatment can alleviate lupus nephritis through BMPR2 and inhibit the abnormal proliferation and activation of endothelial cells.

[0150] (5) DMH2 can inhibit the activity and phenotypic transformation of glomerular endothelial cells;

[0151] After overexpression of Bmpr2 in mouse glomerular endothelial cells, the migration activity of endothelial cells was significantly increased, and this phenomenon was significantly improved after treatment with DMH2. Figure 11 and Figure 12 As shown in Figure 2, DMH2 can also effectively inhibit the increase in Bmpr2-mediated glomerular endothelial cell proliferation activity. Figure 13These results demonstrate that DMH2 can inhibit the proliferation and migration activity of glomerular endothelial cells through Bmpr2.

[0152] (6) DMH2 can inhibit the abnormal activation of glomerular endothelial cells;

[0153] We detected markers of BMPR2-mediated abnormal activation of glomerular endothelial cells by WB and qRT-PCR, such as Figure 14 As shown in the results, we found that after DMH2 treatment, the increase in Id1, Id3 and transcription of glomerular endothelial cells was significantly inhibited. At the same time, DMH2 treatment also reduced the transcription of glomerular endothelial cell proliferation markers Mki 67, Pcna and endothelial cell activation markers Vcam1 and Icam1. These data indicate that DMH2 can effectively inhibit the abnormal proliferation and activation of endothelial cells mediated by BMPR2.

[0154] This study demonstrates that DMH2 significantly alleviates the clinical and pathological manifestations of lupus nephritis. ACR, considered a key indicator of lupus nephritis severity, is significantly increased in lupus mice and significantly improved in DMH2-treated lupus mice. Furthermore, glomerular endothelial cell proliferation and glomerulosclerosis are core pathological manifestations of lupus nephritis, and DMH2 treatment can significantly improve these pathological manifestations.

[0155] This study demonstrates that BMPR2 is a key receptor on the surface of endothelial cells, playing a role in promoting endothelial cell proliferation and activation. Single-cell nuclear RNA sequencing analysis confirmed that BMPR2 expression is significantly increased in glomerular endothelial cells from lupus patients and mice with lupus nephritis. This finding was also confirmed by immunofluorescence staining, Western blot, and qRT-PCR analysis of lupus mice. In vivo and in vitro experiments confirmed that DHM2, as a specific inhibitor of BMPR2, can effectively inhibit BMPR2-mediated abnormal proliferation of lupus nephritis endothelial cells, thereby alleviating the onset and delaying the progression of lupus nephritis.

[0156] This example demonstrates that DMH2 can significantly reduce the transcription levels of glomerular endothelial cell activation products Vcam1 and Icam1, thereby improving lupus nephritis. The pharmacological action of DMH2 blocking BMPR2 can inhibit several events related to abnormal proliferation of glomerular endothelial cells and significantly alleviate lupus nephritis.

[0157] In summary, the present invention inhibits multiple events related to glomerular endothelial cell proliferation and activation by utilizing the inhibitory effect of DMH2 on BMPR2, and significantly alleviates lupus nephritis. By targeting DMH2 of BMPR2, it becomes a therapeutic strategy to combat lupus nephritis and delay the progression of lupus nephritis, which has the advantages of developing new methods for treating lupus nephritis and alleviating lupus nephritis with good effects. The above is only a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or replacements that can be easily thought of by any technician familiar with this technical field within the technical scope disclosed by the present invention should be covered within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be based on the scope of protection of the claims.

Claims

1. A method for alleviating lupus nephritis by blocking BMPR2 using DMH2, characterized in that: The steps are as follows: S1, single cell nucleus sequencing; S2, urine ELISA test; S3, renal histopathological analysis; S4, immunofluorescence analysis; S5, cell culture studies; S6, real-time quantitative PCR detection; S7, protein determination; S8. Statistical analysis; In step S5, the cell culture study includes cell proliferation and cell migration assays.

2. The method of claim 1, wherein: The step S1 includes the following steps: S101. Mouse and human kidney tissues were collected and prepared into single cell nuclear suspensions, including tissue homogenization, filtration, and nuclear extraction methods. S102. Single-nucleus sequencing of samples was performed using the commercial 10X Genomics sequencing platform to obtain high-throughput transcriptome data. S103: The raw data obtained from sequencing were quality controlled and low-quality nuclei were removed. Preliminary data processing was also performed, including filtering, removal of double nuclei, and batch effect correction. S104. Use the Seurat package in R language to analyze the processed single-cell nucleus data.

3. The method of claim 2, wherein: The step S2 includes the following steps: S201, 24-hour urine collection from mice in the control group, lupus nephritis group, and DMH2-treated group; S202, centrifuge at 1500 g for 10 minutes to remove cells and impurities that may be present in the urine sample; S203. According to the instructions of the ELISA kit, the urine creatinine and albumin levels in the sample are measured respectively; S204. Calculate the urine albumin-to-creatinine ratio (ACR) to evaluate changes in renal function in different treatment groups.

4. The method of claim 3 for alleviating lupus nephritis by blocking BMPR2 with DMH2, wherein: The step S2 includes the following steps: S301, the kidneys were fixed in 4% paraformaldehyde (PFA) overnight, dehydrated and embedded in paraffin, and then cut into 3 μm sections transversely; S302. After deparaffinization, the kidney sections were stained with HE.

5. The method of claim 4 for alleviating lupus nephritis by blocking BMPR2 with DMH2, characterized in that: The step S4 includes the following steps: S401. Mouse kidney tissue was freshly frozen and 8-10 μm thick frozen sections were prepared on a microtome and mounted on glass slides. S402, the slices were dried naturally at room temperature for 30 minutes; S403, gently wash the dried sections in 1× PBS to remove excess freezing medium; S404, permeabilize tissue sections with 0.1% Triton-X100 at room temperature for 10 minutes; S405, sections were blocked in 5% normal goat serum for 1 h to reduce nonspecific binding; S406. Incubate the slides with anti-Bmpr2 (1:200) and anti-Cd31 (1:100) antibodies at 4°C overnight; S407. The next day, the sections were washed with PBS and incubated with AlexaFluor-labeled secondary antibodies at room temperature for 1 hour. S408. Finally, the cell nuclei were stained with DAPI and the signals were observed under a fluorescence microscope.

6. The method of claim 5 for alleviating lupus nephritis by blocking BMPR2 with DMH2, characterized in that: The step S5 includes the following steps: S501. Grow normal mouse glomerular endothelial cells in DMEM supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin solution and culture in a 37°C, 5% CO2 incubator. S502, subculture the cells at 60% to 80% confluence using 0.25% trypsin-0.02% EDTA; S503, transfecting cells with a chronic virus containing Bmpr2 according to the supplier's instructions, and further culturing after transfection; S504, after transfection, cells were treated with 2 μM DMH2 for 24 h; S505. After 24 hours, cells were collected for Transwell cell migration assay, real-time cell analysis system cell proliferation analysis, qRT-PCR analysis, and WB analysis.

7. The method of claim 6, wherein: The step S6 includes the following steps: S601. Extract total RNA from tissues or cells using RNA isoPlus reagent. S602, reverse transcription of cDNA using PrimeScript™ RT Master Mix; S603, real-time PCR amplification using SYBR Green PCR Master Mix and ABI 7500 real-time PCR detection system; The temperature cycling conditions were first cycling at 95°C for 10 min, then cycling at 95°C for 15 s, and finally cycling at 60°C for 1 min. The relative expression levels of mRNA were normalized to β-actin and calculated using the 2-ΔΔCT method. The required primers were designed and synthesized by Sangon Biotech Co., Ltd.

8. The method of claim 7, wherein: In step S7, the specific steps are as follows: S701. Homogenize tissue or cell lysate using RIPA buffer containing 1x protease inhibitor and 1x phosphatase inhibitor; S702, then centrifuging the sample at 5000 rpm for 30 minutes; S703, determine the protein concentration using a BCA protein assay kit; S704 and equivalent samples were used for antibodies against BMPR2 (1:500), ID1 (1:500), ID3 (1:500), SMAD1 (1:500), pSMAD1 (1:500), and β-actin (1:500), followed by the addition of HRP-conjugated secondary antibodies (1:5000); S705, immunoreactive bands were visualized using the Amersham Biosciences ECL detection system; S706. Perform optical density analysis by measuring the intensity of the bands and normalize them to the corresponding β-actin bands using Quantity One software.

9. The method of claim 8, wherein: The step S8 includes the following steps: S801, all quantitative values ​​are expressed as mean ± standard error of the mean SEM; S802, statistical differences between the two groups were analyzed by two-tailed Student t test using GraphPad Prism; S803. One-way analysis of variance was used for comparison among multiple groups, where P < 0.05 was considered statistically significant.