Microrna-134 biomarkers

Abstract

The present invention relates to the field of secondary markers for microRNA activity, and in particular, the present invention relates to the identification of Serpin1 as mRNA that is inhibited by microRNA-134 in neuronal cells and the use of Serpin1 mRNA or protein as a biomarker for microRNA-134 modulation, the biomarkers are such as biomarkers for antisense oligonucleotide inhibitors of microRNA-134.

Description

[0001] This invention is a divisional application of Chinese application number "201980055057.2", date of entry into China on February 22, 2021, and the invention name is "MicroRNA-134 Biomarker". Technical Field

[0002] The present invention relates to the field of secondary markers for microRNA activity, and in particular, to the identification of Serpine 1 as an mRNA that is inhibited by microRNA-134 in neuronal cells and the use of Serpine 1 mRNA or protein as a biomarker for microRNA-134 regulation, such as a biomarker for antisense oligonucleotide inhibitors of microRNA-134. Serpine 1 is also known as Serpin E1; PLANH1; PAI-1. Background Art

[0003] MicroRNAs (miRNAs) are a class of non-coding RNAs that regulate gene expression post-transcriptionally, and microRNAs can regulate the expression of hundreds of mRNAs.

[0004] Davis et al., Nucleic Acid Research 2009, Vol. 37, doi:10.1093 / nar / gkn904 discuss the importance of evaluating secondary endpoints as they are crucial for the interpretation of miRNA inhibition studies.

[0005] As described in WO2013 / 045652, microRNA-134 has been suggested as a therapeutic target for the treatment of epilepsy based on the close association between temporal lobe epilepsy (TLE) and increased expression of miRNA-134, as well as experimental evidence that LNA anti-miR targeting microRNA-134 suppressed epilepsy-induced seizure activity and hippocampal activity in rodent models (Jimenez-Mateos et al., 2012; Jimenez-Mateos et al., 2015; and Reschke et al., 2017). Notably, silencing miR-134 after status epilepticus in rats reduced the occurrence of spontaneous seizures by 86% in a toxin-free model of acquired epilepsy using the transepithelial pathway stimulation model (Reschke et al., 2017). MicroRNA-134 has been suggested as a therapeutic agent for the treatment of cerebral ischemic injury (Khoshnam et al., Journal of Stroke 2017;19(2):166-187).

[0006] WO2007 / 112754 discloses LNA anti-miRs targeting hsa-miR-134, such as 5'TgGtcAAccAgTcAC3', where uppercase letters represent β-D-oxy-LNA nucleosides, lowercase letters represent DNA nucleosides, LNA cytosines are 5-methylcytosines, and all internucleoside linkages are phosphorothioate internucleoside linkages. LNA anti-miRs targeting microRNA-134 are used in examples as cholesterol-conjugated or unconjugated compounds. WO2009043353 discloses short, all-LNA phosphorothioate oligonucleotides targeting microRNA-134.

[0007] Therefore, it would be beneficial to develop therapeutics targeting microRNA-134 for the treatment of epilepsy. This raises a major problem because although microRNA-134 inhibition reduces the severity of epileptic symptoms, little is known about the underlying mechanisms involved, in particular which mRNAs are regulated by miR-134 or which subsets are involved in disease regulation. This knowledge is required to provide the necessary biomarkers that will allow the identification and development of effective microRNA-134 inhibitor therapeutics and monitoring their effects on microRNA-134 activity in vitro and in vivo. Serpine-1 mRNA has many putative microRNA target binding sites in the 3'UTR, including see TargetScanHuman, which shows annotation of poorly conserved sites for microRNA-134 ( http: / / www.targetscan.org / cgi-bin / vert_72 / view_gene.cgi?rs= ENST00000223095.4&taxid=9606&members=&subset=1&showcnc=1&shownc=1&shownc_nc= 1&showncf1=0#miR-134-5p ).

[0008] The present invention is based on the identification of Serpine 1 (PAI-1) as a robust mRNA target for microRNA-134 in primary neurons and its use as a biomarker for microRNA-134 inhibition. Summary of the Invention

[0009] The present invention provides a method for determining the activity [potency or efficacy, inhibition level] of a microRNA-134 modulator in cells such as neuronal cells, comprising the step of determining the level of Serpine 1 biomarker in the cells to which the microRNA-134 modulator is added.

[0010] The present invention provides a method for identifying a subject suffering from a neurological disease, such as a neurological disease associated with seizures (e.g., epilepsy, such as epileptic encephalopathy or cerebral ischemic injury), who may benefit from administration of a therapeutic agent comprising a microRNA-134 modulator, such as an antagonist, comprising the steps of:

[0011] a) measuring the level of a Serpine 1 biomarker in a sample obtained from the subject;

[0012] b) comparing to at least one reference level of said Serpine 1 biomarker;

[0013] c) to identify whether the subject is likely to benefit from administration of a therapeutic agent comprising a microRNA-134 modulator, such as an antagonist.

[0014] The present invention provides a method for determining the efficacy of a therapeutic agent that is a microRNA-134 modulator, such as an antagonist, in a subject, the method comprising the steps of:

[0015] a) measuring the level of a Serpine 1 biomarker in a sample obtained from a subject who has previously been administered a therapeutic agent that is a microRNA-134 modulator, such as an antagonist;

[0016] b) comparing to at least one reference level of said Serpine 1 biomarker;

[0017] c) to identify the therapeutic efficacy of said microRNA-134 modulators, such as antagonists.

[0018] The present invention provides a method for diagnosing a neurological disease, such as a neurological disease associated with epileptic seizures (e.g., epilepsy, such as epileptic encephalopathy or cerebral ischemic injury), which is suitable for treatment with a microRNA-134 antagonist therapeutic agent, comprising the following steps:

[0019] a. measuring the level of Serpine 1 biomarker in a sample obtained from the subject;

[0020] b. comparing with at least one reference level of the Serpine 1 biomarker;

[0021] c. to identify whether the subject has a neurological disease suitable for treatment with a microRNA-134 antagonist therapeutic agent, such as a neurological disease associated with epileptic seizures (eg, epilepsy, such as epileptic encephalopathy).

[0022] The above method may be an in vitro method.

[0023] The present invention provides a method for treating a neurological disease in a subject in need of treatment with a microRNA-134 antagonist therapeutic agent, such as a neurological disease associated with seizures (e.g., epilepsy, such as epileptic encephalopathy or cerebral ischemic injury), comprising one of the above-described methods of the present invention (or methods disclosed or claimed herein), followed by administering to the subject an effective dose of the microRNA-134 antagonist therapeutic agent. In some embodiments, the neurological disease is epilepsy. In some embodiments, the neurological disease is cerebral ischemic injury.

[0024] The present invention provides a method for treating neurological epileptic seizures in a subject in need of treatment with a microRNA-134 antagonist therapeutic agent, the method comprising one of the above-mentioned methods of the present invention (or the methods disclosed or claimed herein), followed by the step of administering to the subject an effective dose of the microRNA-134 antagonist therapeutic agent.

[0025] The present invention provides a method for treating cerebral ischemic injury in a subject in need of treatment with a microRNA-134 antagonist therapeutic agent, the method comprising one of the above-mentioned methods of the present invention (or the methods disclosed or claimed herein), followed by the step of administering to the subject an effective dose of the microRNA-134 antagonist therapeutic agent.

[0026] The present invention provides a method for prophylactically treating a neurological disease, such as a neurological disease associated with epileptic seizures, in a subject in need of prophylactic treatment with a microRNA-134 antagonist prophylactic therapeutic agent, comprising one of the above-described methods of the present invention (or methods disclosed or claimed herein), followed by administering an effective dose of the microRNA-134 antagonist therapeutic agent to the subject in need of prophylactic treatment. In some embodiments, the neurological disease is epilepsy. In some embodiments, the neurological disease is cerebral ischemic injury.

[0027] The present invention provides a method for prophylactically treating a neurological epileptic seizure in a subject in need of treatment with a microRNA-134 antagonist prophylactic therapeutic agent, the method comprising one of the above-mentioned methods of the present invention (or the methods disclosed or claimed herein), followed by the step of administering an effective dose of the microRNA-134 antagonist therapeutic agent to the subject in need of prophylactic treatment.

[0028] The present invention provides an in vitro use of a Serpine 1 biomarker assay for measuring microRNA-134 modulation, such as microRNA-134 inhibition.

[0029] The present invention provides an in vitro use of a Serpine 1 biomarker assay as a companion diagnostic for a microRNA-134 modulator, such as an antagonist, therapeutic agent, e.g., a microRNA-134 antagonist therapeutic agent, for use in the treatment of a neurological disease, such as a neurological disease associated with seizures (e.g., epilepsy, such as epileptic encephalopathy or cerebral ischemic injury).

[0030] The present invention provides an in vitro use of a Serpine 1 biomarker for determining the likely response of a subject suffering from a neurological disease, such as a neurological disease associated with seizures (e.g., epilepsy, such as epileptic encephalopathy or cerebral ischemic injury), to a therapeutic agent comprising a microRNA-134 modulator.

[0031] The present invention provides an in vitro use of a Serpine 1 biomarker assay as a companion diagnostic for a microRNA-134 modulator, such as an antagonist, therapeutic agent, for example, a microRNA-134 antagonist therapeutic agent for use in the treatment of neurological epileptic seizures and / or cerebral ischemic injury.

[0032] The present invention provides an in vitro use of a Serpine 1 biomarker for determining the likely response of a subject suffering from a neurological seizure, such as epilepsy such as epileptic encephalopathy or seizures associated with cerebral ischemic injury, to a therapeutic agent comprising a microRNA-134 modulator.

[0033] The present invention provides a method for determining the activity of an exogenously administered microRNA-134 modulator in a cell, the method comprising the step of determining the level of Serpine 1 mRNA, Serpine 1 protein, or Serpine 1 activity in the cell to which the microRNA-134 modulator has been administered. It will be understood that in some embodiments, the activity is measured in an extract obtained from the cell.

[0034] The present invention provides a use of a Serpine 1 mRNA assay, a Serpine 1 protein assay or a Serpine 1 activity assay as a biomarker for microRNA-134 modulation, such as microRNA-134 inhibition.

[0035] The present invention provides a use of Serpine 1 mRNA, Serpine 1 protein or Serpine 1 activity as a microRNA-134 antagonist therapeutic agent, such as a microRNA-134 antagonist therapeutic agent for use as a companion diagnostic in the treatment of nervous system diseases, such as nervous system diseases associated with epileptic seizures (such as epilepsy or cerebral ischemic injury).

[0036] The present invention provides a use of Serpine 1 mRNA, Serpine 1 protein or Serpine 1 activity as a microRNA-134 antagonist therapeutic agent, such as a microRNA-134 antagonist therapeutic agent for a companion diagnostic used in the treatment of neurological epileptic seizures.

[0037] The present invention provides a use of a Serpine 1 antibody for determining the level of Serpine 1 protein in a sample obtained from a subject who is undergoing treatment with a microRNA-134 modulator, such as a microRNA-134 antagonist, or is being evaluated for suitability for treatment with a microRNA-134 modulator, such as a microRNA-134 antagonist.

[0038] The present invention provides a use of a Serpine 1 mRNA detection probe for determining the level of Serpine 1 mRNA in a sample obtained from a subject who is undergoing treatment with a microRNA-134 modulator or microRNA-134 antagonist or is being evaluated for suitability for treatment with a microRNA-134 modulator such as a microRNA-134 antagonist.

[0039] The present invention provides a use of a Serpine 1 mRNA RT-PCR assay for determining Serpine 1 mRNA levels in a sample obtained from a subject who is undergoing treatment with a microRNA-134 modulator, a microRNA-134 antagonist, or is being evaluated for suitability for treatment with a microRNA-134 modulator, such as a microRNA-134 antagonist.

[0040] The present invention provides a use of a Serpine 1 activity assay for determining the level of Serpine 1 activity in a sample obtained from a subject who is undergoing treatment with a microRNA-134 modulator, a microRNA-134 antagonist, or is being evaluated for suitability for treatment with a microRNA-134 modulator, such as a microRNA-134 antagonist.

[0041] The present invention provides a use of a tissue plasminogen activator (tPA) assay for determining the level of Serpine 1 activity in a sample obtained from a subject who is undergoing treatment with a microRNA-134 modulator, such as a microRNA-134 antagonist, or is being evaluated for suitability for treatment with a microRNA-134 modulator, such as a microRNA-134 antagonist.

[0042] The present invention provides a use of a Serpine 1 biomarker for determining a subject's likely response to a therapeutic agent comprising a microRNA-134 modulator, wherein the biomarker is an altered level of Serpine 1 mRNA, protein, or activity in a biological sample obtained from the subject compared to the level obtained from a reference sample, such as a sample from a healthy subject, a sample from a diseased subject, or one or more previous samples obtained from the subject.

[0043] The present invention provides a use of a Serpine 1 biomarker for patient monitoring of subjects receiving treatment with a microRNA-134 antagonist, for example, for treating a neurological disease, such as a neurological disease associated with seizures (e.g., epilepsy or cerebral ischemic injury), in order to monitor the effectiveness of the microRNA-134 antagonist.

[0044] The present invention provides a use of a Serpine 1 biomarker for patient monitoring of subjects receiving treatment with a microRNA-134 antagonist for the treatment of neurological epileptic seizures.

[0045] In some embodiments, the neurological disease is epileptic encephalopathy. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 RNA sequencing analysis identified genes whose expression levels were significantly different after 6 days of treatment of primary mouse cortical neurons with 0.1 µM miR-134 anti-miR. Volcano plots show the differences in gene expression between control mock-treated primary cortical neurons and those treated with 0.1 µM miR-134 LNA anti-miR (upregulated genes on the right and downregulated genes on the left). The experiment and data analysis are described in Example 1. Each dot corresponds to a gene. Genes whose expression levels differed between the two conditions with a multiple-test adjusted P-value < 0.05 are labeled with the gene name.

[0047] Figure 2. Validation of candidate miR-134 targets identified by RNA sequencing. Target gene Syt6 ( Figure 2A )、Peg10( Figure 2B ) and Serpine 1 ( Figure 2C ddPCR was performed on RNA isolated from primary cortical neurons treated with an LNA anti-miR inhibitor for 5 days. Gpr36 expression was below detection (data not shown). The LNA anti-miR inhibitor of miR-134 significantly upregulated Serpine1 in a dose-dependent manner. The experiment is described in Example 2.

[0048] Figure 3 . Schematic representation of the hybridization of the miR-134 seed sequence to the mouse 3' UTR region of Serpine1.

[0049] Figure 4 Serpine1 mRNA expression in human MDA-MB-231 cells (n = 3) before transfection with miR-134 and 48 hours after transfection with mock (PBS), LNA anti-miR, or LNA control. LNA anti-miR treatment significantly upregulated Serpine1 relative to both mock (PBS)-treated cells (p < 0.01, Student's T-test) and LNA control-treated cells (p < 0.05, Student's T-test). DETAILED DESCRIPTION

[0050] Method A: The present invention provides a method for determining the activity, such as potency, efficacy, or inhibitory level, of a microRNA-134 modulator in a cell, such as a neuronal cell, comprising determining the level of a Serpine 1 biomarker in the cell to which the microRNA-134 modulator is added. The method can be an in vitro method.

[0051] The cell may be a primary cell, such as a primary neuronal cell.

[0052] Activity can, for example, refer to the potency, efficacy, or level of inhibition of microRNA-134 and can be compared to one or more reference samples or values.

[0053] Method B: The present invention provides a method for identifying a subject suffering from a neurological disease who may benefit from administration of a therapeutic agent comprising a microRNA-134 antagonist, the method comprising the steps of:

[0054] a) measuring the level of a Serpine 1 biomarker in a sample obtained from the subject;

[0055] comparing to at least one reference level of said Serpine 1 biomarker;

[0056] b) to identify whether the subject is likely to benefit from administration of a therapeutic agent comprising a microRNA-134 modulator, such as an antagonist.

[0057] Method C: The present invention provides a method for determining the efficacy of a therapeutic agent that is a microRNA-134 modulator, such as an antagonist, in a subject, the method comprising the following steps:

[0058] a) measuring the level of a Serpine 1 biomarker in a sample obtained from a subject who has previously been administered a therapeutic agent that is a microRNA-134 modulator, such as an antagonist;

[0059] b) comparing to at least one reference level of said Serpine 1 biomarker;

[0060] To identify the efficacy of therapeutic agents such as microRNA-134 modulators, such as antagonists.

[0061] Method D: The present invention provides a method for diagnosing a neurological disease (e.g., a neurological disease associated with epileptic seizures, such as epilepsy or cerebral ischemic injury), wherein the neurological disease is suitable for treatment with a microRNA-134 antagonist therapeutic agent, the method comprising the following steps:

[0062] a) measuring the level of a Serpine 1 biomarker in a sample obtained from the subject;

[0063] b) comparing to at least one reference level of said Serpine 1 biomarker;

[0064] To identify whether the subject has a neurological disease suitable for treatment with a microRNA-134 antagonist therapeutic agent.

[0065] Method E: The present invention provides a method for treating a neurological disease, such as epilepsy, in a subject in need of treatment with a microRNA-134 antagonist therapeutic agent, the method comprising the method of any one of claims 1 to 4, followed by the step of administering to the subject an effective dose of the microRNA-134 antagonist therapeutic agent. The treatment can be prophylactic—that is, preventative treatment of a subject at risk for developing a neurological disease, such as a neurological disease associated with seizures, such as epilepsy, or seizures associated with cerebral ischemic injury. The treatment can be therapeutic—that is, treatment after a symptom of a disease (e.g., a seizure, such as epilepsy) has been diagnosed.

[0066] The neurological disease may be a neurological disease associated with risk or characterized by seizures such as epilepsy or cerebral ischemic injury.

[0067] The reference level may be, for example

[0068] a. Levels of disease-associated Serpine 1 biomarkers,

[0069] b. Normal levels of Serpine 1 biomarkers,

[0070] c. Both a) and b).

[0071] In some embodiments, decreased levels of Serpine-1 biomarkers, such as Serpine-1 mRNA, protein, or Serpine-1 activity, indicate increased microRNA-134 activity, or increased levels of Serpine-1 biomarkers indicate decreased microRNA-134 activity. (Increases in direct biomarkers of Serpine-1 correlate with microRNA inhibition and Serpine-1 derepression).

[0072] Indirect Serpine-1 biomarker: Since Serpine 1 (PAI-1) is an inhibitor of tPA-1, elevated PAI-1 due to microRNA-134 inhibition would reduce tPA activity and result in decreased conversion of plasminogen to plasmin (clotting).

[0073] The present invention provides a use of a Serpine 1 biomarker assay for measuring microRNA-134 modulation, such as microRNA-134 inhibition. The use may, for example, be an in vitro use.

[0074] The present invention provides a Serpine 1 biomarker assay for use as a companion diagnostic for a therapeutic agent, such as a microRNA-134 modulator, such as an antagonist, for treating a neurological disease, such as a neurological disease associated with seizures (e.g., epilepsy or cerebral ischemic injury). Such use can be, for example, in vitro.

[0075] The present invention provides a use of a Serpine 1 biomarker for determining the likely response of a subject suffering from a neurological disease to a therapeutic agent comprising a microRNA-134 modulator. The use can be, for example, an in vitro use.

[0076] The Serpine 1 biomarker assay may be selected from the group consisting of:

[0077] a. Measurement of Serpine 1 mRNA

[0078] b. Measurement of Serpine 1 protein

[0079] c. Measurement of Serpine 1 Activity

[0080] d. Measurement of tissue plasminogen activator (tPA) activity

[0081] e. Measurement of the conversion of plasminogen to plasmin or blood clot.

[0082] a), b) and c) are direct Serpine-1 biomarker assays, wherein d. and e. are indirect Serpine-1 biomarker assays. In some embodiments, the Serpine-1 biomarker assay is a direct Serpine-1 biomarker assay. In some embodiments, the Serpine-1 biomarker assay is an indirect Serpine-1 biomarker assay.

[0083] In some embodiments, the subject suffers from a disease or disorder associated with microRNA-134, such as a neurological disease, particularly a neurological disease associated with epileptic seizures, such as epilepsy or cerebral ischemic injury, or the subject may suffer from a disease or disorder associated with microRNA-134, such as a neurological disease, particularly a neurological disease associated with epileptic seizures, such as epilepsy or cerebral ischemic injury.

[0084] In some embodiments, the subject has previously undergone tPA (tissue plasminogen activator) treatment, eg, for thrombosis.

[0085] In some embodiments, the Serpine 1 biomarker is measured in a sample obtained from the subject, said sample selected from the group consisting of a cerebrospinal fluid sample, a blood sample, or a plasma sample.

[0086] In some embodiments, the Serpine 1 biomarker is measured in a cerebrospinal cord sample obtained from the subject.

[0087] In some embodiments, the microRNA-134 modulator is an antisense oligonucleotide inhibitor of microRNA-134, which comprises at least 7 consecutive nucleotides that are complementary to microRNA-134, such as hsa-miR-134, such as SEQ ID NO 1 or 2, such as fully complementary.

[0088] In some embodiments, the microRNA-134 antagonist is an LNA antisense oligonucleotide, such as an LNA phosphorothioate antisense oligonucleotide.

[0089] microRNA-134 (also known as miR-134)

[0090] MicroRNA-134 was first reported as a tissue-specific microRNA in Lagos-Quintana et al., Curr Biol. 12:735-739 (2002). The mouse miR-134 pre-miRNA, mmu-mir-134MI0000160, has the following sequence:

[0091] AGGGUGUGUGACUGGUUGACCAGAGGGGCGUGCACUCUGUUCACCCUGUGGGCCACCUAGUCACCAACCCU

[0092] Mouse mature mmu-miR-134-5p MIMAT0000146 has sequence U GUGACU GGUUGACCAGAGGGG (SEQ ID NO 1)

[0093] Human microRNA-134 (Gene ID: 406924) is encoded on chromosome 14, position NC_000014.9 (101054687..101054759) - annotation version 109 (assembly GRCh38.p12 - GCF_000001405.38).

[0094] hsa-mir-134 MI0000474 pre-mRNA sequence (stem-loop):

[0095] CAGGGUGUGUGACUGGUUGACCAGAGGGGGCAUGCACUGUGUUCACCCUGUGGGCCACCUAGUCACCAACCCUC (SEQ ID NO 2)

[0096] hsa-miR-134-5p mature microRNA sequence MIMAT0000447:

[0097] UGUGACUGGUUGACCAGAGGGG (SEQ ID NO 1)

[0098] The seed sequence of microRNA-134 in humans and mice is GUGACU or GUGACUG.

[0099] Generally, miR-134, especially the mature microRNA-134 sequence, is highly conserved among mice, primates, humans, and mammals.

[0100] microRNA-134 modulators

[0101] MicroRNA-134 modulators are compounds that regulate the level of microRNA-134 activity in cells. MicroRNA-134 modulators such as microRNA-134 inhibitors are advantageously man-made compounds, synthetically produced compounds, isolated compounds, or purified compounds. In some embodiments, the microRNA-134 modulator is or includes a synthetically synthesized oligonucleotide. The synthetically synthesized oligonucleotide advantageously includes at least one modified nucleoside or at least one modified internucleoside bond.

[0102] In some embodiments, a microRNA-134 modulator is or includes a synthetic microRNA—that is, a synthetic oligonucleotide that mimics the activity of microRNA-134 when administered to a cell.

[0103] In some embodiments, the microRNA-134 modulator is or includes a synthesis inhibitor or microRNA-134, such as an antisense oligonucleotide targeting microRNA-134.

[0104] In some embodiments, Serpine-1 biomarkers can be used to identify microRNA modulators - microRNA-134 mimetics will enhance microRNA-134 inhibition of Serpine-1, while microRNA-134 antagonists will cause derepression of Serpine-1.

[0105] In some embodiments, the miR-134 modulators used in the present invention are microRNA-134 inhibitory antisense oligonucleotides, such as LNA anti-miRs, comprising a contiguous nucleotide sequence of at least 7 nucleotides that is fully complementary to a microRNA-134 target sequence, such as SEQ ID NO 1 or 2. Suitably, the miR-134 inhibitory antisense oligonucleotide is pharmaceutically active. In the context of the present invention, a pharmaceutically active compound refers to a compound that has the potential to provide a benefit to a subject based on preclinical data, such as in vitro (e.g., cell-based assays) or in vivo (e.g., animal data, such as mouse data).

[0106] microRNA-134 antagonists

[0107] One type of modulation, referred to herein as microRNA-134 antagonist / antagonism, is the ability of a compound to inhibit, downregulate, reduce, suppress, remove, stop, block, prevent, mitigate, reduce, avoid, or terminate the expression of microRNA-134, for example, by: degradation of microRNA-134 RNA or inactivation of microRNA-134 activity in a cell, for example, by binding (e.g., hybridizing) to a microRNA-134 RNA target, thereby preventing the microRNA-134 RNA from interacting with mRNA in the cell. High-affinity modified oligonucleotides targeting microRNAs, such as LNA anti-miRs, are believed to form highly stable duplexes with their target microRNAs, thereby effectively reducing microRNA activity.

[0108] Oligonucleotides

[0109] The term "oligonucleotide" as used herein is defined as generally known to those skilled in the art and refers to a molecule comprising two or more covalently linked nucleosides. Such covalently bonded nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are typically prepared in the laboratory by solid phase chemical synthesis followed by purification. When referring to the sequence of an oligonucleotide, reference is made to the sequence or order of the covalently linked nucleobase moieties of nucleotides or nucleosides or their modifications. The oligonucleotides of the present invention are artificial and chemically synthesized and are typically purified or separated. The oligonucleotides of the present invention may include one or more modified nucleosides or nucleotides.

[0110] antisense oligonucleotides

[0111] As used herein, the term "antisense oligonucleotide" is defined as an oligonucleotide capable of regulating the expression of a target gene by hybridizing to a target nucleic acid, particularly a contiguous sequence on the target nucleic acid. LNA anti-miR is an exemplary antisense oligonucleotide for inhibiting microRNAs in vitro and in vivo.

[0112] The antisense oligonucleotides used in the present invention include at least 7 consecutive nucleotides that are fully complementary to the microRNA-134 target sequence, such as SEQ ID NO 1 or 2. Advantageously, the antisense oligonucleotides of the present invention are complementary to the microRNA-134 seed sequence. The microRNA-134 seed sequence in humans is GUGACU or GUGACUG. In some embodiments, the antisense oligonucleotides mentioned in the present invention include a complementary sequence to the microRNA seed sequence, such as the nucleotide sequence AGTCAC or AGUCAC or CAGTCAC or CAGUCAC. Please note that for Watson-Crick base pairing, T and U can be used interchangeably. Advantageously, the complement of the seed sequence within the antisense oligonucleotide includes at least one high-affinity modified nucleoside, such as at least one LNA or at least one 2'O-MOE nucleoside. In some embodiments, the complement of the seed sequence within the antisense oligonucleotide includes at least two high-affinity modified nucleosides, such as at least two LNAs or at least two 2'O-MOE nucleosides. In some embodiments, the complement of the seed sequence within the antisense oligonucleotide includes at least 3 high-affinity modified nucleosides, such as at least 3 LNA or at least 3 2'O-MOE nucleosides.

[0113] In some embodiments, the antisense oligonucleotides referred to in the present invention include a continuous nucleotide sequence of 7-26 nucleotides in length, such as 7-12 nucleotides in length, for example 8, 9, 10, 11 or 12 nucleotides in length, or 12-26 nucleotides in length, such as 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26 consecutive nucleotides in length.

[0114] Advantageously, the antisense oligonucleotides of the present invention are single-stranded. It will be appreciated that single-stranded oligonucleotides of the present invention may form hairpin or intermolecular duplex structures (duplexes between two molecules of the same oligonucleotide) as long as the degree of self-complementarity within or between sequences is less than 50% across the total length of the oligonucleotide.

[0115] LNA-anti-miR

[0116] LNA-anti-miRs are antisense oligonucleotides comprising a contiguous nucleotide sequence complementary to a target microRNA, such as hsa-miR-134, including at least one LNA nucleoside. LNA-anti-miRs are described in WO2007 / 112754 and WO2009043353, which are hereby incorporated by reference. See also the mixed and full polymer compounds described herein.

[0117] Other LNA-anti-miR designs are disclosed in WO2007 / 027775, WO07027894, WO2015 / 061536, WO2017035319, WO2018 / 106566, EP2841579 and WO18106568.

[0118] Preferably, the antisense oligonucleotide microRNA-134 antagonist comprises the sequence 5'agtcac 3' or 5'cagtcac 3', which are or include the complement of the hsa-miR-134 seed region. In some embodiments, the antisense oligonucleotide microRNA-134 antagonist mentioned herein comprises the sequence 5'agtcac 3', wherein at least one, such as two, three, four, five, or six, of the nucleosides in 5'agtcac 3' are LNA nucleosides.

[0119] An exemplary LNA-anti-miR is the antisense oligonucleotide 5' TgGtcAAccAgTcAC 3' (SEQ ID NO 8), wherein uppercase letters are β-D-oxy-LNA nucleosides, lowercase letters are DNA nucleosides, LNA cytosine is 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.

[0120] In advantageous embodiments, the modulator comprises an antisense LNA oligonucleotide. In a particularly preferred embodiment, the modulator comprises an oligonucleotide between 7 and 25 nucleotides in length and includes at least one LNA. In some embodiments, the microRNA modulator comprises an oligonucleotide between 7 and 25 nucleotides in length and includes at least one LNA, and further includes at least one other affinity-enhancing nucleotide analog. In some embodiments, the oligonucleotides of the present invention comprise phosphorothioate bonds.

[0121] In some embodiments, the anti-miR-134 oligonucleotide is an LNA anti-miR (see, for example, WO2007 / 112754). LNA anti-miRs are antisense oligonucleotides complementary to mature microRNA targets. These antisense oligonucleotides comprise LNA nucleosides and may further include phosphorothioate internucleotide linkages. LNA anti-miRs may further include other nucleotides, such as DNA and / or 2'-O-methoxyethyl (MOE) nucleosides (see, for example, EP1931780). Anti-miR-134 oligonucleotides that do not recruit RNaseH1 are advantageous for targeting mature microRNAs. Therefore, it is advantageous that anti-miR-134 oligonucleotides, such as LNA anti-miRs, do not contain regions of four or more consecutive DNA nucleosides.

[0122] Anti-microRNA LNA phosphorothioates can be ordered from Qiagen (https: / / www.qiagen.com / dk / shop / pcr / primer-sets / mircury-lna-mirna-inhibitors / #orderinginformation). Compound C (Exiqonantagomir) used in the experiments described herein can be obtained from this source.

[0123] Advantageously, anti-miR-134 oligonucleotides targeting mature microRNA-134 target nucleic acids include complementarity to the microRNA-134 seed region (2-7 nucleotides from the 5' end of hsa-miR-134). In some embodiments, the anti-miR-134 oligonucleotide includes at least one, such as at least two or at least three, LNA nucleotides, positioned at a position complementary to the microRNA-134 seed region (e.g., the anti-miR-134 oligonucleotide includes the sequence CAGTCAC or AGTCAC).

[0124] LNA anti-miRs may be fully phosphorothioate or may be partially phosphorothioate. For systemic administration, a high proportion of fully phosphorothioate antisense oligonucleotides may be preferred, whereas for local administration to the CNS, it may be desirable to use partial phosphorothioates.

[0125] In some embodiments, the anti-miR-134 oligonucleotide is 7-10 consecutive LNA nucleotides in length (also known as mini-LNA, see Obad et al., Nat Genet. 2011 Mar 20;43(4):371-8 and WO2009043353) and comprises the complement of the microRNA-134 seed region. Examples of mini-LNA inhibitors of hsa-miR-134 include: ACCAGTCAC, CCAGTCAC, and CAGTCAC, wherein each nucleotide is an LNA nucleoside, such as β-D-oxy LNA, and all internucleoside linkages are phosphorothioates. Partial phosphorothioates may also be used, for example, the internucleoside linkages between the terminal nucleotides may be phosphorothioates, while the remaining internucleoside linkages may be phosphodiesters.

[0126] In one embodiment, the pharmaceutical composition includes an anti-miR-134 oligomer having the following sequence: 5'-TgGtcAAccAgTcAC-3' (SEQ ID NO: 8), also referred to herein as Compound A, wherein uppercase letters represent β-D-oxy LNA, lowercase letters represent DNA, LNA C is 5-methyl C, and wherein this compound has a completely phosphorothioate backbone. This oligomer can be prepared as described in WO 2007 / 112754. Other oligomers of WO 2007 / 112754, the contents of which are hereby incorporated by reference, can be used according to the present invention.

[0127] In some embodiments, the microRNA-134 inhibitor is an LNA antisense oligomer comprising or consisting of any one of the sequences listed in Table 1.

[0128] Table 1. The following specific sequences or compounds can be used in the methods of the present invention, such as in the treatment of diseases that indicate expression / overexpression of miR-134, such as those listed in Table 1. The compounds are preferably entirely phosphorothioate, and each nucleotide is an LNA nucleotide, such as β-D-oxy LNA. The LNA cytosine can be a 5' methylcytosine. Equivalent anti-miRs can be designed by matching to positions -2 to -8 / -9 or -10 (for 7-mers, 8-mers, or 9-mers) of the mature microRNA, counting from the terminal 5' nucleotide of the microRNA (i.e., at the -1 position).

[0129] Table 1

[0130] sequence SEQ ID CCCCTCTGGTCAACCAGTCACA 4 CCTCTGGTCAACCAGTCAC 5 5'-TgGtcAAccAgTcAC-3'* 6

[0131] *wherein capital letters represent β-D-oxy LNA, lowercase letters represent DNA and LNA C is 5 methyl C, and wherein this compound has a fully phosphorothioate backbone.

[0132] Many other chemistries and designs of anti-microRNA oligonucleotides are known in the art.

[0133] To inhibit microRNAs in vivo, a number of chemistries and designs have been used in the art, including non-RNaseH recruiting antisense oligonucleotides targeting mature microRNA targets, such as:

[0134] Complete 2'-O-methoxyethyl phosphorothioate as reported in WO2005013901, Esau et al., Cell Metab. 2006 Feb;3(2):87-98 and Davis et al., Nucleic Acids Res. 2006 May 11;34(8):2294-304.

[0135] 2'-O-Methoxyethyl / 2'-fluoro mixed phosphorothioate - see Davis et al., Nucleic Acids Res. 2009 Jan;37(1):70-7.

[0136] 2'-O-Methyl AntagomiR - a fully 2'-O-methyl modified complete complement of the mature microRNA, in which the 5' and 3' regions are phosphorothioate with a phosphodiester internal region incorporating a cholesterol conjugate (Krutzfeldt et al., Nature. 2005 Dec 1;438(7068):685-9).

[0137] For targeting pre-microRNA targets, RNaseH recruitment designs have been reported to be functional, see WO2005013901, which discloses 2'-O-methoxyethyl gapmers targeting pre-miRNA target sequences.

[0138] microRNA-134 antagonist therapeutics

[0139] A microRNA-134 antagonist therapeutic agent is a microRNA-134 inhibitor that has been discovered, developed, or has received market approval or is marketed for inhibiting microRNA-134 to prevent or treat microRNA-134-related diseases or conditions, such as neurological diseases associated with seizures such as epilepsy or cerebral ischemic injury.

[0140] Serpine 1 biomarker

[0141] A Serpine 1 biomarker is a direct or indirect biomarker of Serpine 1 expression or activity in a cell or sample.

[0142] Direct biomarkers of Serpine 1 expression include:

[0143] Serpine 1 mRNA is measured, for example, using a hybridization-based assay (eg, northern blot, RT-PCR, probe hybridization, microarray analysis, RNA protection assay, or RNA sequencing).

[0144] Serpinel pre-mRNA is encoded at human chromosome 7: 101, 127, 089-101, 139, 266 forward strand (GRCh38: CM000669.2) and is provided herein by way of example as SEQ ID NO 3 (SERPINE1-201).

[0145] Serpine 1 protein levels can be measured, for example, using Serpine 1-specific antibodies. Many Serpine 1-specific antibodies are commercially available. Serpine 1 antibody assays can be used to measure Serpine 1 protein levels, for example, using ELISA assays, which are also commercially available, such as the Human PAI1 ELISA Kit (SERPINE1) (ab184863) from abcam. An example of a human Serpine 1 protein sequence is provided as SEQ ID NO 7.

[0146] Serpine 1 is a modulator of tissue plasminogen activator (tPA), a serine protease that converts plasminogen to plasmin, the primary enzyme responsible for clot breakdown.

[0147] Indirect biomarkers of Serpine 1 expression include assays for tPA activity, which are commercially available from, for example, AnaSpec's SensoLyte® AMC tPA Activity Assay Kit *Fluorimetric*. Elisa assays for tPA are also commercially available. Furthermore, because Serpine-1 inhibits tPA, and tPA converts plasminogen to plasmin, the conversion of plasminogen to plasmin (e.g., clot analysis) can also be used as a Serpine-1 biomarker.

[0148] Reference Level

[0149] In the methods of use of the present invention, the level of a Serpine-1 biomarker can be compared to at least one reference level. The reference level can be, for example, the level of a Serpine-1 biomarker associated with a disease and / or a normal level of a Serpine-1 biomarker. The level of a Serpine-1 biomarker can be determined, for example, based on a population of subjects, such as a population of subjects diagnosed with a disease and / or a population of subjects believed not to have a disease.

[0150] Additionally or alternatively, the Serpine-1 reference can be a historical Serpine-1 biomarker level from a subject, which is used, for example, for patient / subject monitoring of a subject to whom a microRNA-134 antagonist therapeutic has been administered. Thus, the present invention can be used to monitor effective microRNA-134 inhibition in a patient and thereby optimize the dosage regimen for an individual subject / patient.

[0151] Subjects

[0152] The subject can be a mammal, such as a rodent, eg, a rat or mouse, or a primate, such as a monkey (eg, a cynomolgus monkey).

[0153] The subject can be a non-human animal model for a microRNA-134-related disease. In some embodiments, the animal model is a mouse model based on chemical (kainic acid)-induced epileptic seizures.

[0154] The subject can be a human, such as a human in need of treatment with a microRNA-134 antagonist therapeutic agent or a human undergoing treatment with a microRNA-134 antagonist therapeutic agent.

[0155] The subject can be a human with a neurological disorder associated with epileptic seizures (e.g., characterized by or at risk for epileptic seizures).

[0156] The subject may be a human suffering from cerebral ischemic injury.

[0157] The subject can be a human who has been diagnosed with a microRNA-134-associated disease or disorder, such as epilepsy, or a human who has been diagnosed as being at risk of developing a microRNA-134-associated disease or disorder, such as epilepsy.

[0158] The subject may have previously undergone treatment with, for example, tPA (tissue plasminogen activator) for thrombosis (such subjects may be at risk for developing epilepsy). In such cases, the methods or uses of the present invention may be used diagnostically, i.e., to identify subjects at increased risk for developing an epileptic seizure (e.g., epilepsy), and / or therapeutically, i.e., to prevent or treat an epileptic seizure (e.g., epilepsy). Epileptic seizures may be associated with neurological disorders such as cerebral ischemic injury.

[0159] MicroRNA-134-related diseases or conditions

[0160] MicroRNA-134 is a brain-specific miRNA involved in neuronal microstructure. Overexpression of microRNA-134 is associated with reduced spinal cord volume, decreased dendritic length, and abrogation of long-term potentiation. Therefore, microRNA-134 is an interesting target for the treatment of various neurological diseases. Recent evidence suggests that miRNAs may play a key role in certain forms of epilepsy. Research led by Professor David Henshall of the Royal College of Surgeons in Ireland (RCSI) identified a strong link between temporal lobe epilepsy (TLE) and increased expression of a miRNA (mir-134), known to play a key role in promoting dendritic branching and negatively regulating spine maturation. Furthermore, they demonstrated that silencing miR-134 in an adult mouse model of status epilepticus using locked nucleic acid (LNA) anti-miR-134 oligonucleotides, such as the antagomiR (Ant-134), strongly suppressed the seizure activity and hippocampal damage caused by status epilepticus. Specifically, it was demonstrated that treatment with an antagomir targeting miR-134 via ICV injection 24 hours before intra-amygdala kainic acid (KA)-induced status epilepticus significantly reduced the severity of status epilepticus as recorded by EEG and histological measures of hippocampal damage (Jimenez-Mateos et al., 2012). Pretreatment of mice with ICV injection of anti-miR-134 also effectively suppressed seizures induced by the chemoconvulsants pilocarpine (Jimenez-Mateos et al., 2015) and PTZ (Reschke et al., 2017). Furthermore, ICV treatment with an antagomir administered 1 hour after intra-amygdala KA injection did not reduce acute status epilepticus activity but significantly delayed the onset and reduced the total number of spontaneous seizures monitored by EEG telemetry over a 2-week period (Jimenez-Mateos et al., 2012). Notably, silencing miR-134 after status epilepticus in rats reduced the occurrence of spontaneous seizures by 86% in a transepithelial pathway stimulation model, a toxin-free model of acquired epilepsy (Reschke et al., 2017).

[0161] The microRNA-134-associated disease or disorder may be a neurological disease, such as a neurological disease associated with seizures such as epilepsy or cerebral ischemic injury.

[0162] Other neurological diseases that may require treatment with microRNA-134 modulators, such as antagonists, include stroke, epileptic seizures associated with CNS infections, brain tumors, traumatic brain injury, neurodegenerative diseases, metabolic diseases that cause epileptic seizures (including but not limited to hypoglycemia, glycogen storage diseases, pyruvate dehydrogenase deficiency, acquired hypoparathyroidism, adenosylsuccinate lyase (ADSL) deficiency), and autoimmune diseases that cause epileptic seizures (multiple sclerosis, diabetes, and systemic lupus erythematosus). The term "brain injury that may immediately trigger epilepsy or epileptic seizures or cause or has caused brain damage" should be understood to mean stroke, trauma, or other types of acute neurological injury. MicroRNA-134 modulators can be used to treat or prevent epileptic seizures associated with neurological diseases.

[0163] Continuous nucleotide sequence

[0164] The term "contiguous nucleotide sequence" refers to the region of an oligonucleotide that is complementary to a target nucleic acid. This term is used interchangeably herein with "contiguous nucleobase sequence" and "oligonucleotide motif sequence." In some embodiments, all of the nucleotides in the oligonucleotide constitute the contiguous nucleotide sequence. In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence and may optionally include one or more additional nucleotides, such as a nucleotide linker region that can be used to attach a functional group to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. Advantageously, the contiguous nucleotide sequence is 100% complementary to the target nucleic acid (microRNA-134 RNA, such as SEQ ID NO 1 or 2).

[0165] Nucleotides

[0166] Nucleotides are the building blocks of oligonucleotides and polynucleotides and, for the purposes of this invention, encompass both naturally occurring and non-naturally occurring nucleotides. Essentially, a nucleotide, such as a DNA or RNA nucleotide, comprises a ribose sugar moiety, a nucleobase moiety, and one or more phosphate groups (nucleosides lack phosphate groups). Nucleosides and nucleotides are also interchangeably referred to as "units" or "monomers."

[0167] Modified nucleosides

[0168] As used herein, the term "modified nucleoside" or "nucleoside modification" refers to a nucleoside that has been modified compared to an equivalent DNA or RNA nucleoside by introducing one or more modifications to a sugar moiety or a (nucleo) base moiety. In a preferred embodiment, the modified nucleoside comprises a modified sugar moiety. The term modified nucleoside is also used interchangeably herein with terms such as "nucleoside analog," "modified unit," or "modified monomer." Nucleosides having unmodified DNA or RNA sugar moieties are referred to herein as DNA or RNA nucleosides. Nucleosides containing modifications in the base region of a DNA or RNA nucleoside are generally still referred to as DNA or RNA if Watson-Crick base pairing is permitted.

[0169] Modified internucleoside linkages

[0170] The term "modified internucleoside linkage," as commonly understood by those skilled in the art, refers to a linkage, other than a phosphodiester (P-O) bond, that covalently couples two nucleosides together. Thus, the oligonucleotides of the present invention may include modified internucleoside linkages. In some embodiments, such modified internucleoside linkages can provide increased nuclease resistance to the oligonucleotide compared to phosphodiester linkages. In naturally occurring oligonucleotides, internucleoside linkages comprise a phosphate group that creates a phosphodiester bond between adjacent nucleosides. Modified internucleoside linkages are particularly useful for stabilizing oligonucleotides for in vivo use and can provide protection from nuclease cleavage in DNA or RNA nucleoside regions (e.g., within the gap region of gapmer oligonucleotides) and in modified nucleoside regions (e.g., Region F and Region F') within the oligonucleotides of the present invention.

[0171] In one embodiment, the oligonucleotide includes one or more internucleoside linkages modified with natural phosphodiester compounds, such as one or more modified internucleoside linkages that are, for example, more resistant to attack by nucleases. Nuclease resistance can be determined by incubating the oligonucleotide in serum or by using a nuclease resistance assay (e.g., snake venom phosphodiesterase (SVPD)), both of which are known in the art. Internucleoside linkages that enhance the nuclease resistance of an oligonucleotide are referred to as nuclease-resistant internucleoside linkages. In some embodiments, at least 50% of the internucleoside linkages in an oligonucleotide or its contiguous nucleotide sequence are modified, such as at least 60%, at least 70%, at least 80%, or at least 90% of the internucleoside linkages in an oligonucleotide or its contiguous nucleotide sequence are nuclease-resistant internucleoside linkages. In some embodiments, all of the internucleoside linkages in an oligonucleotide or its contiguous nucleotide sequence are nuclease-resistant internucleoside linkages. It should be appreciated that in some embodiments, the nucleoside linking the oligonucleotide of the present invention to a non-nucleotide functional group, such as a conjugate, may be a phosphodiester.

[0172] A preferred modified internucleoside linkage is phosphorothioate.

[0173] Phosphorothioate internucleoside bonds are particularly useful due to their nuclease resistance, excellent pharmacokinetics, and ease of manufacture. In some embodiments, at least 50% of the internucleoside bonds in an oligonucleotide or its continuous nucleotide sequence are phosphorothioates, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90% of the internucleoside bonds in an oligonucleotide or its continuous nucleotide sequence are phosphorothioates. In some embodiments, all internucleoside bonds in the oligonucleotide or its continuous nucleotide sequence are phosphorothioates.

[0174] Nucleobases

[0175] The term "nucleobase" includes purines (e.g., adenine and guanine) and pyrimidines (e.g., uracil, thymine, and cytosine) present in nucleosides and nucleotides, which form hydrogen bonds in nucleic acid hybridization. In the context of the present invention, the term "nucleobase" also encompasses modified nucleobases that are different from naturally occurring nucleobases but are functional during nucleic acid hybridization. In this context, "nucleobase" refers to naturally occurring nucleobases such as adenine, guanine, cytosine, thymine, uracil, xanthine, and hypoxanthine, as well as non-naturally occurring variants. Such variants are, for example, those described in Hirao et al. (2012) "Accounts of Chemical Research," Vol. 45, p. 2055, and Bergstrom (2009) "Current Protocols in Nucleic Acid Chemistry," Supplement 371.4.1.

[0176] In some embodiments, the nucleobase moiety is modified by changing a purine or pyrimidine to a modified purine or pyrimidine, such as a substituted purine or substituted pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiazolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil, 5-thiazolo-uracil, 2-thiouracil, 2'thiothymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0177] The nucleobase moiety can be represented by the letter code for each corresponding nucleobase, such as A, T, G, C, or U, wherein each letter may optionally include a functionally equivalent modified nucleobase. For example, in the exemplary oligonucleotide, the nucleobase moiety is selected from A, T, G, C, and 5-methylcytosine. Optionally, for LNA oligonucleotides, a 5-methylcytosine LNA nucleoside can be used.

[0178] sample

[0179] Measurement of the Serpine-1 biomarker can be performed in a cell extract, such as in the in vitro methods of the invention, or can be performed in a biological extract obtained from a subject.

[0180] The biological extract comprises, for example, a cerebrospinal fluid sample, a blood sample or a plasma sample. Advantageously, the sample may be a cerebrospinal fluid sample obtained from a subject.

[0181] It will be appreciated that prior to assaying for Serpine-1 biomarkers, the cell extract or sample may be processed, for example, purified biomarker molecule RNA may be extracted from the extract or sample for assaying for, for example, Serpine-1 mRNA.

[0182] Modified oligonucleotides

[0183] The term modified oligonucleotide describes an oligonucleotide that includes one or more sugar-modified nucleosides and / or modified internucleoside linkages. The term "chimeric oligonucleotide" is a term used in the literature to describe oligonucleotides with modified nucleosides.

[0184] Complementarity

[0185] The term "complementarity" is used to describe the ability of nucleosides / nucleotides to undergo Watson-Crick base pairing. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). It should be understood that oligonucleotides may include nucleosides with modified nucleobases, for example, 5-methylcytosine is often used in place of cytosine. Therefore, the term complementarity encompasses Watson-Crick base pairing between unmodified nucleobases and modified nucleobases (see, for example, Hirao et al. (2012) Reviews of Chemical Research, Vol. 45, p. 2055 and Bergstrom (2009) Current Nucleic Acid Chemistry: A Laboratory Manual, Suppl. 37, 1.4.1).

[0186] As used herein, the term "complementarity%" refers to the ratio of nucleotides within a contiguous nucleotide sequence in a nucleic acid molecule (e.g., an oligonucleotide) that, at a given position, are complementary to (i.e., form Watson-Crick base pairs with) a contiguous nucleotide sequence at a given position in a different nucleic acid molecule (e.g., a target nucleic acid or target sequence). The percentage is calculated by counting the number of aligned bases that form a pair between the two sequences (when aligned 5'-3' with the target sequence and 3'-5' with the oligonucleotide sequence), dividing by the total number of nucleotides in the oligonucleotide and multiplying by 100. In such an alignment, nucleobases / nucleotides that are not aligned (forming base pairs) are referred to as mismatches. Preferably, insertions and deletions are not allowed when calculating the complementarity% of a contiguous nucleotide sequence.

[0187] The term "complete complementarity" means 100% complementarity.

[0188] Identity

[0189] As used herein, the term "identity" refers to the proportion (expressed as a percentage) of nucleotides in a contiguous nucleotide sequence in a nucleic acid molecule (e.g., an oligonucleotide) that are identical to a reference sequence (e.g., a sequence motif), spanning the contiguous nucleotide sequence. Therefore, percent identity is calculated by counting the number of aligned bases (matches) that are identical between two sequences (e.g., in a contiguous nucleotide sequence of a compound of the invention and in a reference sequence), dividing that number by the total number of nucleotides in the aligned region, and multiplying by 100. Thus, percent identity = (number of matches × 100) / length of the aligned region (e.g., contiguous nucleotide sequence). Insertions and deletions are not allowed for when calculating percent identity for contiguous nucleotide sequences. It should be understood that chemical modifications of nucleobases are not considered when determining identity, as long as the nucleobase retains its Watson-Crick base pairing function (e.g., 5'-methylcytosine is considered identical to cytosine when calculating % identity).

[0190] hybridization

[0191] As used herein, the term "hybridization" refers to the formation of hydrogen bonds between base pairs on opposing strands of two nucleic acid chains (e.g., an oligonucleotide and a target nucleic acid), thereby forming a duplex. The binding affinity between two nucleic acid chains refers to the strength of the hybridization. It is usually measured in terms of the melting temperature (T m ), which is defined as the temperature at which half of the oligonucleotide forms a duplex with the target nucleic acid. Under physiological conditions, T m It is not strictly proportional to affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515–537). The standard state Gibbs free energy ΔG° is a more accurate representation of binding affinity and is related to the dissociation constant (K d )with ΔG°=-RTln(K d), where R is the gas constant and T is the absolute temperature. Therefore, a very low ΔG° for the reaction between an oligonucleotide and a target nucleic acid reflects strong hybridization between the oligonucleotide and the target nucleic acid. ΔG° is the energy associated with a reaction at 1 M aqueous concentration, pH 7, and temperature of 37°C. Hybridization of an oligonucleotide and a target nucleic acid is a spontaneous reaction, and the ΔG° for a spontaneous reaction is less than zero. ΔG° can be measured experimentally, for example, using isothermal titration microcalorimetry (ITC) as described in Hansen et al., 1965, Chem. Comm., 36–38, and Holdgate et al., 2005, Drug Discovery Today. Those skilled in the art will appreciate that commercial equipment for measuring ΔG° is commercially available. ΔG° can also be estimated numerically using the nearest neighbor model described by SantaLucia, 1998, Proc Natl Acad Sci USA, 95: 1460–1465, using appropriately derived thermodynamic parameters as described in Sugimoto et al., 1995, Biochemistry, 34: 11211–11216 and McTigue et al., 2004, Biochemistry, 43: 5388–5405. To enable modulation of the intended nucleic acid target of the oligonucleotides of the invention via hybridization, the oligonucleotides of the invention are hybridized to the target nucleic acid with an estimated ΔG° value of less than -10 kcal for oligonucleotides 10–30 nucleotides in length. In some embodiments, the extent or strength of hybridization is measured as the standard state Gibbs free energy ΔG°. The oligonucleotide can hybridize to the target nucleic acid at an estimated ΔG value of less than -10 kcal for oligonucleotides of 8 to 30 nucleotides in length, such as less than -15 kcal, such as less than -20 kcal, and such as less than -25 kcal. In some embodiments, the oligonucleotide hybridizes to the target nucleic acid at an estimated ΔG value of about -10 to -60 kcal, such as -12 to -40, such as -15 to -30 kcal, or -16 to -27 kcal, such as -18 to -25 kcal. Antisense oligonucleotides targeting microRNA-134 are capable of hybridizing and inhibiting (antagonizing) microRNA-134 activity.

[0192] Target nucleic acid

[0193] According to the present invention, the target nucleic acid is mammalian or human microRNA-134 RNA, such as SEQ ID NO 1 or 2.

[0194] Target sequence

[0195] The term "target sequence" as used herein means a sequence of nucleotides present in a target nucleic acid that includes a nucleobase sequence that is complementary to an oligonucleotide of the invention. In some embodiments, the target sequence consists of a region on the target nucleic acid that is complementary to a contiguous nucleotide sequence of an oligonucleotide of the invention.

[0196] Oligonucleotides of the invention include a contiguous nucleotide sequence that is complementary to or hybridizes to a target nucleic acid, such as a subsequence of a target nucleic acid, such as a target sequence described herein.

[0197] The oligonucleotide comprises a contiguous nucleotide sequence that is complementary to a target sequence present in a target nucleic acid molecule. The contiguous nucleotide sequence (and therefore the target sequence) comprises at least 7 contiguous nucleotides, such as 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 contiguous nucleotides, such as 8-22, such as 11-18 contiguous nucleotides.

[0198] High-affinity modified nucleosides

[0199] A high affinity modified nucleoside is a modified nucleoside that, when incorporated into an oligonucleotide, increases the affinity of the oligonucleotide for its complementary target, for example, in terms of melting temperature (T m ). The high affinity modified nucleosides of the present invention preferably increase the melting temperature of each modified nucleoside by +0.5 to +12°C, more preferably +1.5 to +10°C, and most preferably +3 to +8°C. Many high affinity modified nucleosides are known in the art and include, for example, many 2' substituted nucleosides and locked nucleic acids (LNA) (see, for example, Freier and Altmann; Nucleic Acids Research, 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213).

[0200] Sugar modification

[0201] The oligomers of the invention may include one or more nucleosides having a modified sugar moiety, ie, a modification of the sugar moiety compared to the ribose sugar moiety found in DNA and RNA.

[0202] Numerous nucleosides with modifications to the ribose sugar moiety have been prepared, primarily to improve specific properties of oligonucleotides, such as affinity and / or nuclease resistance.

[0203] These modifications include modifications to the ribose ring structure, such as substitution with a hexose ring (HNA), or a bicyclic ring (LNA) typically having a diradical bridge between the C2 and C4 carbon atoms on the ribose ring, or an unlinked ribose ring (e.g., UNA) typically lacking a bond between the C2 and C3 carbon atoms. Other sugar-modified nucleosides include, for example, bicyclic hexose nucleic acids (WO2011 / 017521) or tricyclic nucleic acids (WO2013 / 154798). Modified nucleosides also include nucleosides in which the sugar moiety is replaced by a non-sugar moiety, such as in peptide nucleic acids (PNA) or morpholino nucleic acids.

[0204] Sugar modifications also include modifications by changing the substituent groups on the ribose ring to groups other than the hydrogen or 2'-OH groups naturally present in DNA and RNA nucleosides. Substituents can be introduced, for example, at the 2', 3', 4', or 5' positions.

[0205] 2' sugar-modified nucleosides.

[0206] 2' sugar modified nucleosides are nucleosides having a substituent other than H or -OH at the 2' position (2' substituted nucleosides) or including a 2' linked diradical capable of forming a bridge between the 2' carbon and the second carbon in the ribose ring, such as LNA (2'-4' diradical bridged) nucleosides.

[0207] Indeed, considerable effort has been devoted to the development of 2'-substituted nucleosides, and many have been found to possess beneficial properties when incorporated into oligonucleotides. For example, the 2'-modified sugar can enhance the binding affinity and / or nuclease resistance of the oligonucleotide. Examples of 2'-substituted modified nucleosides include 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. For further examples, see, for example, Freier and Altmann, Nucleic Acids Research, 1997, 25, 4429-4443 and Uhlmann, Current Opinion in Drug Development, 2000, 3(2), 293-213 and Deleavey and Damha, Chemistry and Biology, 2012, 19, 937. The following are schematic diagrams of some 2'-substituted modified nucleosides.

[0208]

[0209] In relation to the present invention, 2' substitutions do not comprise 2' bridged molecules such as LNA.

[0210] Locked Nucleic Acid (LNA)

[0211] An "LNA nucleoside" is a 2'-modified nucleoside that includes a double radical linking the C2' and C4' carbonyl groups of the nucleoside's ribose ring (also known as a "2'-4' bridge"), which constrains or locks the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNAs). This locking of the ribose conformation is associated with enhanced affinity for hybridization with complementary RNA or DNA molecules (duplex stabilization) when LNA is incorporated into an oligonucleotide. This can be routinely determined by measuring the melting temperature of the oligonucleotide / complementary duplex.

[0212] Non-limiting exemplary LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO 2008 / 150729, Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76, Seth et al., J. Org. Chem. 2010, vol. 75(5), pp. 1569-81 and Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238 and Wan and Seth, J. Medical Chemistry 2016, 59, 9645-9667.

[0213] Other non-limiting exemplary LNA nucleosides are disclosed in Scheme 1.

[0214] Option 1:

[0215]

[0216] Specific LNA nucleosides are β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA, such as (S)-6'-methyl-β-D-oxy-LNA (ScET), and ENA.

[0217] A particularly advantageous LNA is β-D-oxy-LNA.

[0218] Non-RNase H recruiting antisense oligonucleotides

[0219] WO2005 / 013901 discloses RNaseH-recruiting 2'-O-MOE gapmers and fully 2-O-MOE-modified oligonucleotides for inhibiting microRNAs. Generally, RNAseH-recruiting gapmer oligonucleotides are considered inferior to non-RNaseH-recruiting steric block antisense oligonucleotides in inhibiting microRNAs (see Davis et al. 2006, Nucleic Acids Res., 34, 2294-304). Krützfelt et al. 2005, Nature, 438, 685-9 disclose fully 2'O-methyl-modified antisense oligonucleotide cholesterol conjugates that fail to recruit RNaseH to effectively inhibit microRNA-122 in vivo.

[0220] As disclosed in WO 2007 / 112754, for the inhibition of microRNAs it is advantageous to use non-RNaseH recruiting high affinity antisense oligonucleotides such as LNA anti-miRs.

[0221] EP 1 222 309 provides an in vitro method for determining RNase H activity, which can be used to determine the ability to recruit RNase H. Using the method provided in Examples 91-95 of EP 1 222 309, an oligomer is considered to be able to recruit RNase H if, after being provided with a complementary RNA target, its initial rate (measured in pmol / l / min) is at least 1%, such as at least 5%, such as at least 10% or less than 20% of the equivalent DNA, which is only oligonucleotides, has no 2' substitutions, and has phosphorothioate linkages between all nucleotides of the oligonucleotides.

[0222] In one embodiment In some embodiments, using the methods provided in Examples 91-95 of EP 1 222 309, an oligomer is considered to be substantially incapable of recruiting RNaseH if the oligomer, when provided with a complementary RNA target and RNaseH, exhibits an initial rate of RNaseH measured in pmol / l / min of less than 1%, such as less than 5%, such as less than 10% or less than 20% of the initial rate determined using an equivalent DNA comprising only oligonucleotides, no 2' substitutions, and phosphorothioate linkages between all nucleotides of the oligonucleotide.

[0223] Full polymer

[0224] In some embodiments, an oligomer or contiguous nucleotide sequence thereof consists of a contiguous sequence of nucleoside analogs, such as affinity-enhanced nucleoside analogs, referred to herein as a "holomer."

[0225] A holopolymer is a single-stranded oligomer, or a contiguous nucleotide sequence thereof, that does not include DNA or RNA nucleosides and therefore includes only nucleoside analog nucleosides. The oligomer, or a contiguous nucleotide sequence thereof, can be a holopolymer—indeed, a variety of holopolymer designs can be very effective as therapeutic oligomers, particularly when targeting microRNAs (anti-miRs) or as splice-switching oligomers (SSOs).

[0226] In some embodiments, the full polymer comprises or consists of at least one XYX or YXY sequence motif, such as a repeating sequence XYX or YXY, wherein X is LNA and Y is an alternative (i.e., non-LNA) nucleotide analog, such as a 2'-OMe RNA unit and a 2'-fluoro DNA unit. In some embodiments, the above sequence motif can be, for example, XXY, XYX, YXY, or YYX.

[0227] In some embodiments, a full polymer may comprise or consist of a contiguous nucleotide sequence of between 8 and 16 nucleotides, such as 9, 10, 11, 12, 13, 14, or 15 nucleotides, such as between 8 and 12 nucleotides.

[0228] In some embodiments, the contiguous nucleotide sequence of the full polymer comprises at least 30%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as 95%, such as 100% LNA units. The remaining units may be selected from the non-LNA nucleotide analogs mentioned herein, such as those selected from the group consisting of 2'-O-alkyl-RNA units, 2'-OMe-RNA units, 2'-amino-DNA units, 2'-fluoro-DNA units, LNA units, PNA units, HNA units, INA units and 2'MOE RNA units or 2'-OMe RNA units and 2'-fluoro DNA units.

[0229] In some embodiments, the full polymer consists of or comprises a contiguous nucleotide sequence consisting only of LNA units.

[0230] In some embodiments, the full polymers can target microRNAs (ie, anti-miRs), as described in US Provisional Applications 60 / 979217 and 61 / 028062, and PCT / DK2008 / 000344, all of which are hereby incorporated by reference.

[0231] Polymer

[0232] The term "mixed polymer" refers to an oligomer comprising DNA nucleosides and nucleoside analog nucleosides or a contiguous nucleotide sequence thereof, wherein, in contrast to gapmers, tailmers, headmers and blockmers, there is no contiguous sequence of greater than 4 or greater than 5 naturally occurring DNA nucleosides (i.e., a DNA region sufficient to achieve RNaseH recruitment activity).

[0233] The oligomer or its contiguous nucleotide sequence can be a mixed polymer—indeed, a variety of mixed polymer designs can be very effective as therapeutic oligomers, especially when targeting microRNAs (anti-miRs), microRNA binding sites on mRNAs (Blockmir), or as splice switching oligomers (SSOs).

[0234] In some embodiments, the oligomer can be a contiguous nucleotide sequence or a mixed polymer, and indeed, the use of mixed polymers as therapeutic oligomers is believed to be particularly effective in reducing target RNA due to their ability to effectively and specifically bind to their targets.

[0235] In some embodiments, the mixed polymer comprises or consists of a contiguous nucleotide sequence of a repeating pattern of nucleotide analogs and naturally occurring nucleotides, or a nucleotide analog of one type and a nucleotide analog of a second type. The repeating pattern can be, for example, one in which every second or every third nucleotide is a nucleotide analog, such as LNA, and the remaining nucleotides are naturally occurring nucleotides, such as DNA, or can be 2'-substituted nucleotide analogs, such as the 2'MOE of the 2'-fluoro analogs mentioned herein, or, in some embodiments, selected from the groups of nucleotide analogs mentioned herein. It should be appreciated that the repeating pattern of nucleotide analogs, such as LNA units, can be combined with nucleotide analogs at fixed positions (e.g., at the 5' or 3' end).

[0236] In some embodiments, the first nucleotide of the oligomer or mixed polymer, counting from the 3' end, is a nucleotide analog, such as an LNA nucleotide.

[0237] In some embodiments, which may be the same or different, the second nucleotide of the oligomer or mixed polymer, counting from the 3' end, is a nucleotide analog, such as an LNA nucleotide.

[0238] In some embodiments, which may be the same or different, the seventh and / or eighth nucleotide of the oligomer or mixed polymer, counted from the 3' end, is a nucleotide analog, such as an LNA nucleotide.

[0239] In some embodiments, which may be the same or different, the ninth and / or tenth nucleotide of the oligomer or mixed polymer, counted from the 3' end, is a nucleotide analog, such as an LNA nucleotide.

[0240] In some embodiments, which may be the same or different, the 5' end of the oligomer or polymer is a nucleotide analog, such as an LNA nucleotide.

[0241] In some embodiments, the above-described design features can be incorporated into a conjugate design, such as an anti-miR conjugate.

[0242] In some embodiments, the mixed polymer does not include a region of more than 4 consecutive DNA nucleotide units or 3 consecutive DNA nucleotide units. In some embodiments, the mixed polymer does not include a region of more than 2 consecutive DNA nucleotide units.

[0243] In some embodiments, the mixed polymer comprises at least one region consisting of at least two consecutive nucleotide analogue units, such as at least two consecutive LNA units.

[0244] In some embodiments, the mixed polymer comprises at least one region consisting of at least three consecutive nucleotide analogue units, such as at least three consecutive LNA units.

[0245] In some embodiments, the polymers of the present invention do not include regions of more than 7 consecutive nucleotide analog units, such as LNA units. In some embodiments, the polymers of the present invention do not include regions of more than 6 consecutive nucleotide analog units, such as LNA units. In some embodiments, the polymers of the present invention do not include regions of more than 5 consecutive nucleotide analog units, such as LNA units. In some embodiments, the polymers of the present invention do not include regions of more than 4 consecutive nucleotide analog units, such as LNA units. In some embodiments, the polymers of the present invention do not include regions of more than 3 consecutive nucleotide analog units, such as LNA units. In some embodiments, the polymers of the present invention do not include regions of more than 2 consecutive nucleotide analog units, such as LNA units.

[0246] In mixed polymer embodiments involving modifications of nucleotides in positions 3 to 8, counting from the 3' end, the LNA units may be replaced with other nucleotide analogs such as those mentioned herein. Thus, "X" may be selected from the group consisting of 2'-O-alkyl-RNA units, 2'-OMe-RNA units, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-MOE-RNA units, LNA units, PNA units, HNA units, and INA units. "X" is preferably DNA or RNA, most preferably DNA.

[0247] In some embodiments, the polymer, such as an anti-miR polymer, is modified at positions 3 to 8—that is, at least one nucleotide analog is included at positions 3 to 8, counting from the 3' terminus. The design of this sequence can be defined by the number of non-LNA units present or by the number of LNA units present. In some embodiments of the former, at least one nucleotide, such as one nucleotide, of the nucleotides at positions 3 to 8, counting from the 3' terminus, is a non-LNA unit. In some embodiments, at least two nucleotides, such as two nucleotides, of the nucleotides at positions 3 to 8, counting from the 3' terminus, are non-LNA units. In some embodiments, at least three nucleotides, such as three nucleotides, of the nucleotides at positions 3 to 8, counting from the 3' terminus, are non-LNA units. In some embodiments, at least four nucleotides, such as four nucleotides, of the nucleotides at positions 3 to 8, counting from the 3' terminus, are non-LNA units. In some embodiments, at least five nucleotides, such as five nucleotides, of the nucleotides at positions 3 to 8, counting from the 3' terminus, are non-LNA units. In some embodiments, all six nucleotides, such as all six nucleotides, of the nucleotides at positions 3 to 8, counting from the 3' terminus, are non-LNA units.

[0248] In some embodiments, an alternatively defined miscella according to the present invention, such as an anti-miR miscella, comprises at least one LNA unit in positions three to eight, counting from the 3' end. In some embodiments, a miscella, such as an anti-miR miscella, comprises one LNA unit in positions three to eight, counting from the 3' end. The substitution pattern of nucleotides in positions three to eight, counting from the 3' end, can be selected from Xxxxxx, xXxxxx, xxXxxx, xxxxxx, xxxxXx, and xxxxxxx, where "X" represents an LNA unit and "x" represents a non-LNA unit.

[0249] In some embodiments, the mixed polymer, such as the anti-miR mixed polymer, comprises at least two LNA units at positions three to eight, counting from the 3' end. In some embodiments thereof, the mixed polymer comprises two LNA units at positions three to eight, counting from the 3' end. The substitution pattern of nucleotides at positions three to eight, counting from the 3' end, can be selected from the group consisting of: XXxxxx, XxXxxx, XxxXxx, XxxxXx, XxxxxX, xXXxxx, xXxXxx, xXxxXx, xXxxxX, xxXXxx, xxXxXx, xxXxxX, xxxXXx, xxxxXX, and xxxxXX, wherein "X" represents an LNA unit and "x" represents a non-LNA unit. In one embodiment, the substitution pattern of nucleotides in positions three to eight, counting from the 3' end, is selected from the group consisting of XxXxxx, XxxXxx, XxxxXx, XxxxxX, xXxXxx, xXxxXx, xXxxxX, xxXxXx, xxXxxX, and xxxxxX, wherein "X" represents an LNA unit and "x" represents a non-LNA unit. In some embodiments, the substitution pattern of nucleotides in positions three to eight, counting from the 3' end, is selected from the group consisting of xXxXxx, xXxxXx, xXxxxX, xxXxXx, xxXxxX, and xxxxxX, wherein "X" represents an LNA unit and "x" represents a non-LNA unit. In some embodiments, the substitution pattern of nucleotides in positions three to eight, counting from the 3' end, is selected from the group consisting of xXxXxx, xXxxXx, and xxXxXx, wherein "X" represents an LNA unit and "x" represents a non-LNA unit. In some embodiments, the substitution pattern of nucleotides in positions three to eight, counting from the 3' end, is xXxXxx, wherein "X" represents an LNA unit and "x" represents a non-LNA unit.

[0250] In some embodiments, the mixed polymer, such as the anti-miR mixed polymer, comprises at least three LNA units in positions three to eight, counting from the 3' end. In one embodiment thereof, the mixed polymer comprises three LNA units in positions three to eight, counting from the 3' end. The substitution pattern of nucleotides in positions three to eight, counting from the 3' end, can be selected from the group consisting of: XXXxxx, xXXXxx, xxXXXx, xxxXXX, XXxXxx, XXxxXx, XXxxxX, xXXxXx, xXXxxX, xxXXxX, XxXXxx, XxxXXx, XxxxXX, xXxXXx, xXxxXX, xxXxXX, xXxXX, xXxXX, and XxXxXx, wherein "X" represents an LNA unit and "x" represents a non-LNA unit. In some embodiments, the substitution pattern of nucleotides in positions three to eight, counting from the 3' end, is selected from the group consisting of: XXxXxx, XXxxXx, XXxxxX, xXXxXx, xXXxxX, xxXXxX, XxXXxx, XxxXXx, XxxxXX, xXxXXx, xXxxXX, xxXxXX, xXxXxX, and XxXxXx, wherein "X" represents an LNA unit and "x" represents a non-LNA unit. In some embodiments, the substitution pattern of nucleotides in positions three to eight, counting from the 3' end, is selected from the group consisting of: xXXxXx, xXXxxX, xxXXxX, xXxXXx, xXxxXX, xxXxXX, and xXxXxX, wherein "X" represents an LNA unit and "x" represents a non-LNA unit. In some embodiments, the substitution pattern of nucleotides in positions three to eight, counting from the 3' terminus, is xXxXxX or XxXxXx, wherein "X" represents an LNA unit and "x" represents a non-LNA unit. In some embodiments, the substitution pattern of nucleotides in positions three to eight, counting from the 3' terminus, is xXxXxX, wherein "X" represents an LNA unit and "x" represents a non-LNA unit.

[0251] In some embodiments, the mixed polymer comprises at least four LNA units in positions three to eight, counting from the 3' end. In some embodiments thereof, the mixed polymer comprises four LNA units in positions three to eight, counting from the 3' end. The substitution pattern of nucleotides in positions three to eight, counting from the 3' end, can be selected from the group consisting of xxXXXX, xXxXXX, xXXxXX, xXXXxX, xXXXXx, XxxXXX, XxXxXX, XxXXxX, XxXXXx, XXxxXX, XXxXxX, XXxXXx, XXXxxX, XXXXX, and XXXXxx, wherein "X" represents an LNA unit and "x" represents a non-LNA unit.

[0252] In some embodiments, the interpolymer according to the present invention comprises at least five LNA units in positions three to eight, counting from the 3' end. In some embodiments thereof, the interpolymer comprises five LNA units in positions three to eight, counting from the 3' end. The substitution pattern of nucleotides in positions three to eight, counting from the 3' end, can be selected from the group consisting of xXXXXX, XxXXXX, XXxXXX, XXXxXX, XXXXxX, and XXXXXx, where "X" represents an LNA unit and "x" represents a non-LNA unit.

[0253] In some embodiments, the non-LNA unit is another nucleotide analogue unit.

[0254] In some embodiments of the mixed polymer, the substitution pattern of the nucleotide at position 11, counted from the 3' end to the 5' end, may or may not include a nucleotide analog unit (e.g., LNA). In some embodiments, the mixed polymer comprises at least one nucleotide analog unit (e.g., LNA), such as one nucleotide analog unit, at position 11, counted from the 3' end to the 5' end. In some embodiments, the mixed polymer comprises at least two nucleotide analog units (e.g., LNA units), such as two nucleotide analog units, at position 11, counted from the 3' end to the 5' end.

[0255] In some embodiments involving nucleotide modifications in the oligonucleotide from position 11 to the 5' end of the oligomer, the LNA unit can be replaced by other nucleotide analogs such as those mentioned herein. Thus, "X" can be selected from the group consisting of: 2'-O-alkyl-RNA units, 2'-OMe-RNA units, 2'-amino-DNA units, 2'-fluoro-DNA units, LNA units, PNA units, HNA units, INA units. "X" is preferably DNA or RNA, most preferably DNA.

[0256] In some embodiments, the mixed polymer has the following substitution pattern, counting from the 3' end to the 5' end, repeating starting at nucleotide eleven: xXxX or XxXx, where "X" represents an LNA unit and "x" represents a non-LNA unit. In another embodiment, the mixed polymer has the following substitution pattern, counting from the 3' end to the 5' end, repeating starting at nucleotide eleven: XXxXxx, XXxxXx, or XxXxxX, where "X" represents an LNA unit and "x" represents a non-LNA unit. In yet another embodiment, the mixed polymer has the following substitution pattern, counting from the 3' end to the 5' end, repeating starting at nucleotide eleven: XXXxXXXx, XXxXxXxX, XXXxxxXX, or XXxXxxXX, where "X" represents an LNA unit and "x" represents a non-LNA unit.

[0257] The specific substitution pattern of the nucleotide starting at position 11, counting from the 3' end to the 5' end, depends on the number of nucleotides in the polymer. In a preferred embodiment, the polymer comprises 12 nucleotides and, counting from the 3' end, the substitution pattern at positions 11 to 12 is selected from xX and Xx, where "X" represents an LNA unit and "x" represents a non-LNA unit. In some embodiments, the substitution pattern at positions 11 to 12, counting from the 3' end, is xX, where "X" represents an LNA unit and "x" represents a non-LNA unit. Alternatively, there are no LNA units at positions 11 to 12, counting from the 3' end, i.e., the substitution pattern is xx.

[0258] In some embodiments, the mixed polymer comprises 12 nucleotides and, counting from the 3' terminus, the substitution pattern at positions 10 to 12 is selected from the group consisting of Xxx, xXx, xxX, XXx, XxX, xXX, and XXX, wherein "X" represents an LNA unit and "x" represents a non-LNA unit. In some embodiments thereof, counting from the 3' terminus, the substitution pattern at positions 10 to 12 is selected from the group consisting of xXx, xxX, and xXX, wherein "X" represents an LNA unit and "x" represents a non-LNA unit. In some embodiments, counting from the 3' terminus, the substitution pattern at positions 10 to 12 is xxX, wherein "X" represents an LNA unit and "x" represents a non-LNA unit. Alternatively, counting from the 3' terminus, no LNA units are present at positions 10 to 12, i.e., the substitution pattern is xxx.

[0259] In some embodiments, the polymer comprises an LNA unit at the 5' end. In some embodiments, the polymer comprises an LNA unit at the first two positions, counting from the 5' end. The polymer may also contain one or more structural features specified in the context of anti-miRs herein - the polymer contains a similar pattern and number of nucleotides / nucleotide analogs (e.g., X and x or X and Y).

[0260] Conjugate

[0261] As used herein, the term conjugate refers to an oligonucleotide covalently linked to a non-nucleotide moiety (the conjugate moiety or region C or third region).

[0262] The oligonucleotides of the present invention can improve the pharmacology of the oligonucleotides by, for example, affecting the activity, cellular distribution, cellular uptake or stability of the oligonucleotides. In certain embodiments, the conjugates can regulate or enhance the pharmacokinetic properties of the oligonucleotides by improving the cellular distribution, bioavailability, metabolism, excretion, permeability and / or cellular uptake of the oligonucleotides. Specifically, the conjugates can target specific organs, tissues or cell types to the oligonucleotides and enhance the effectiveness of the oligonucleotides in such organs, tissues or cell types. Simultaneously, the conjugates can be used to reduce the activity of the oligonucleotides in non-target cell types, tissues or organs, such as off-target activity or activity in non-target cell types, tissues or organs.

[0263] In one embodiment, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of a sugar, a cell surface receptor ligand, a drug, a hormone, a lipophilic substance, a polymer, a protein, a peptide, a toxin (e.g., a bacterial toxin), a vitamin, a viral protein (e.g., a capsid), or a combination thereof.

[0264] connector

[0265] A bond or linker is a connection between two atoms that connects one chemical group or segment of interest to another chemical group or segment of interest via one or more covalent bonds. The conjugate moiety can be attached to the oligonucleotide directly or via a linker (e.g., a linker or tether). Linkers are used to covalently link a third region, such as the conjugate moiety (region C), to the first region, such as the oligonucleotide or the contiguous nucleotide sequence or gapmer region FG-F' (region A).

[0266] In some embodiments of the present invention, the conjugate or oligonucleotide conjugate of the present invention may optionally include a linker region (second region or region B and / or region Y) located between the oligonucleotide or the contiguous nucleotide sequence complementary to the target nucleic acid (region A or first region) and the conjugate portion (region C or third region).

[0267] Region B refers to a biocleavable linker comprising or consisting of a physiologically labile bond, which is a bond that is cleavable under conditions commonly encountered in mammalian cells or similar conditions. Conditions under which a physiologically labile linker undergoes chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidizing or reducing conditions or reagents, and salt concentrations commonly encountered in mammalian cells or similar conditions. Mammalian cell conditions also include enzymatic activity commonly present in mammalian cells, such as proteolytic, hydrolase, or nuclease activity. In one embodiment, the biocleavable linker is susceptible to cleavage by S1 nuclease. Biocleavable linkers containing DNA phosphodiester are described in detail in WO2014 / 076195 (incorporated herein by reference), see also Regions D' or D'' herein.

[0268] Region Y refers to a linker that is not necessarily biocleavable but is primarily used to covalently attach the conjugate moiety (Region C or the third region) to the oligonucleotide (Region A or the first region). The Region Y linker can include a repeating structure such as a chain structure or oligomer of ethylene glycol, amino acid units, or aminoalkyl groups. The oligonucleotide conjugates of the present invention can be composed of the following regioelements: AC, ABC, ABYC, AYBC, or AYC. In some embodiments, the linker (Region Y) is an aminoalkyl group, such as a C2-C36 aminoalkyl group, including, for example, a C6 to C12 aminoalkyl group. In a preferred embodiment, the linker (Region Y) is a C6 aminoalkyl group.

[0269] treat

[0270] As used herein, the term "treating" refers to treating an existing condition (e.g., a disease or disorder mentioned herein) or preventing a disease, i.e., prophylaxis. Therefore, it should be understood that the treatment referred to herein, in some embodiments, is of a prophylactic nature.

[0271] Examples

[0272] Overview

[0273] MiR-134 plays a crucial regulatory role in epilepsy (Jimenez-Mateos et al., 2012), yet its mechanisms of action remain unclear. To identify potential targets of miR-134, primary cortical neurons were treated with an LNA-anti-miR inhibitor of miR-134 and incubated for 6 days. After the incubation period, RNA was isolated from the cells and subjected to global RNA sequencing analysis to identify mRNAs whose expression was regulated by microRNA-134 inhibition. Based on the identified derepressed mRNAs, genes that were significantly derepressed and also harbored putative microRNA-134 binding sites were identified based on the presence of potential microRNA-134 seed sequences in their 3' UTRs. These candidate biomarker transcripts were experimentally validated in a separate experiment using primary cortical neurons treated with a range of LNA-anti-miR-134 concentrations. Among the candidate transcripts tested, Serpine1 was confirmed to be derepressed and regulated in a dose-dependent manner. Serpine1 encodes the protein plasminogen activator inhibitor 1 (PAI-1), which binds and inhibits tissue plasminogen activator (tPA). A causal role for tPA in epilepsy has been demonstrated, as tPA knockout mice are protected from chemically induced seizures (Tsirka et al., 1995). This suggests that a potential mechanism by which microRNA-134 may regulate epilepsy is through miR-134 derepression of Serpine1 / PAI-1, thereby inhibiting tPA. Serpine1 / PAI-1 or active tPA is a biomarker of miR-134 inhibition, not only at the mRNA level in biological fluids such as cerebrospinal fluid, but also at the protein and activity levels.

[0274] Jimenez-Mateos et al., “Silencing microRNA-134 produces neuroprotective and prolonged seizure-suppressive effects.” Nat Med. 2012 Jul;18(7):1087-94.

[0275] Tsirka SE et al. Show that excitotoxin-induced neuronal degeneration and epileptic seizures are mediated by tissue plasminogen activator. Nature. 1995 Sep 28;377(6547):340-4.

[0276] Example 1: RNA sequencing analysis of RNA isolated from mouse primary cortical neurons after 6 days of treatment with the miR-134 inhibitor anti-miR identified potential miR-134 targets.

[0277] Cholesterol-conjugated LNA anti-miR supplied by Exiqon was used in this example.

[0278] Primary mouse neuronal cultures were prepared from P1 pups and plated in 6-well plates as described (Chen et al., 2007). After 6 days in vitro (DIV), the cultures were further treated with mock (n = 6) or 0.1 µM (n = 3) anti-miR (Exiqon, LNA- and 3'-cholesterol-modified oligonucleotides), a miR-134 inhibitor, for 6 days. Neuronal cells were cultured in basal growth medium supplemented with oligonucleotides in PBS. RNA from the 6-well setup was purified using the MagNA Pure 96 Cellular RNA High Capacity Kit (Roche, ID: 05469535001) according to the manufacturer's instructions, with an elution volume of 50 µL. RNA sequencing (100 million paired-end reads) was performed by Eurofins Genomics after ribosome depletion.

[0279] Paired-end Fastq files obtained from Illumina sequencing experiments were aligned to the mouse genome sequence (UCSC Genome Browser Assembly ID: mm10) using hisat2 version 2.1.0 (Kim, Langmead, and Salzberg 2015) with default settings except for the "--rna-strandness RF" option. Mapped reads were filtered based on a mapping quality of at least 10 (column 5 of the SAM file) and a SAM flag (column 2 of the SAM file) in which the property "reads mapped with appropriate pairs" must be true. Mapped reads were mapped using the featureCounts function in the Rsubread R package version 1.28.1 (Liao, Smyth, and Shi 2013) using the mouse ENSEMBL gene annotation version 92 (using only "havana" and "ensenble or havana" genes; https: / / www.ensembl.org / ) were summarized with the settings “isPairedEnd = TRUE, requireBothEndsMapped = TRUE, strandSpecific = 2, juncCounts = TRUE, allowMultiOverlap = FALSE”. Differential gene expression was performed using the voom method of the limma R package version 3.34.9 (Law et al. 2014) as described in the limma R package user guide ( https: / / bioconductor.org / packages / release / bioc / vignettes / limma / inst / doc / usersguide.pdf First edition: December 2, 2002, last revised: April 15, 2018).

[0280] The microRNA seed sequence is a 6-8 nucleotide long region of the microRNA that is required to perfectly hybridize with the target sequence in the 3' untranslated region (3' UTR) of the mRNA (Ellwanger et al. 2011). To identify whether a given gene has a miR-134 seed sequence match, the number of occurrences of the 7-mer sequence "CAGTCAC" starting at position 2 of miRNA-134 in the 3' UTR of a given gene that perfectly matches the miR-134 seed sequence defined as a 7-mer was counted (the maximum count is presented for genes with multiple annotated 3' UTRs).

[0281] Results: After 6 days of treatment of primary mouse cortical neurons with 0.1 µM miR-134 anti-miR, RNA sequencing analysis identified significantly regulated genes. Volcano plot ( Figure 1 ) shows the difference in gene expression between control mock-treated primary cortical neurons and primary cortical neurons treated with 0.1 µM miR-134 anti-miR (top panel, upregulated genes on the right and downregulated genes on the left). Each dot corresponds to a gene. Genes with different expression levels between the two conditions at a multiple-test adjusted P-value < 0.05 are labeled with the gene name.

[0282] Significantly upregulated genes with 7 oligonucleotide miR-134 seed sequences included Serpine1, Gpr35, Syt6, Peg10, Olfr460 - see Table 1:

[0283] Table 1

[0284] Ensembl ID Gene name logFC AveExpr P value adj.P.Val Seed Matching ENSMUSG00000037411 Serpine1 0.96 4.89 5.03E-07 0.00264181 1 ENSMUSG00000020447 Npc1l1 1.70 2.26 5.27E-07 0.00264181 0 ENSMUSG00000026271 Gpr35 1.19 3.46 1.42E-06 0.00465327 1 ENSMUSG00000027792 Bche 0.90 3.57 1.72E-06 0.00465327 0 ENSMUSG00000040152 Thbs1 0.67 6.26 1.86E-06 0.00465327 0 ENSMUSG00000026579 F5 0.77 3.28 6.60E-06 0.01102312 0 ENSMUSG00000027849 Syt6 0.38 5.70 1.01E-05 0.01383517 1 ENSMUSG00000031762 Mt2 0.71 4.24 2.35E-05 0.0252597 0 ENSMUSG00000049723 Mmp12 1.17 3.10 2.73E-05 0.02734967 0 ENSMUSG00000068587 Mgam 1.74 0.96 1.17E-05 0.01441299 0 ENSMUSG00000016356 Col20a1 0.62 4.81 3.47E-05 0.03068922 0 ENSMUSG00000067206 Lrrc66 1.84 0.61 1.25E-05 0.01441299 0 ENSMUSG00000092035 Peg10 0.55 6.87 5.30E-05 0.04167564 1 ENSMUSG00000036292 Gramd1c 1.00 2.47 7.58E-05 0.04559284 0 ENSMUSG00000045514 Olfr460 1.76 0.26 8.07E-05 0.04605006 1 ENSMUSG00000037577 Ephx3 2.49 -0.96 8.27E-05 0.04605006 0

[0285] Example 2

[0286] The compound used in this example is an unconjugated LNA anti-miR of the sequence: 5' TgGtcAAccAgTcAC 3' (SEQ ID NO 8), wherein uppercase letters are β-D-oxy-LNA nucleosides, lowercase letters are DNA nucleosides, LNA cytosine is 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.

[0287] Treatment of primary mouse cortical neurons with the miR-134 LNA inhibitor anti-miR induces Serpine1 mRNA expression, but not Syt6, Gpr35, or Peg10 mRNA expression. Primary mouse neuronal cultures were prepared from P1 pups and plated in 24-well plates as described (Chen et al., 2007). After 6 days in vitro (DIV), mouse neuronal cultures were further treated with mock (n = 4) or 0.04 µM, 0.11 µM, 0.33 µM, 1 µM, or 3 µM (n = 4) of the miR-134 inhibitor LNA anti-miR for 5 days. RNA was purified using the MagNA Pure 96 Cell RNA High Capacity Kit (Roche, ID: 05469535001) according to the manufacturer's instructions, with an elution volume of 50 µL. cDNA was synthesized using the iScript Advanced cDNA Synthesis Kit for qPCR (Bio-Rad, ID: 1725038) according to the manufacturer's instructions. To prevent inhibition of cDNA synthesis, RNA was denatured at 90°C for one minute before cDNA synthesis. ddPCR was performed using Probe ddPCR™ Supermix (dUTP-free) (Bio-Rad, ID: 186-3024). FAM-labeled probes and primers were from IDT (Serpine1 Mm.PT.58.6413525; Syt6 Mm.PT.58.5412202; Peg10 Mm.PT.58.12887449; Gpr25 Mm.PT.58.6713348), while HEX-labeled Tbp probes and primers were from Bio-Rad (Catalog No. 10031256). Cycling conditions were: 95°C for 10 minutes; denaturation at 94°C for 30 seconds; annealing at an assay-dependent temperature for 1 minute; and the denaturation and annealing steps were repeated 42 times. After 42 cycles, the enzyme was inactivated at 98°C for 10 minutes. If samples were not used directly, they were stored at 4°C. Droplets were passed through a QX200™ droplet reader (Bio-Rad) for fluorescence analysis, and the number of FAM-stained Serpine1 droplets and HEX-stained Tbp droplets was counted.

[0288] Example 3

[0289] Potential miR-134 target sites in Serpine1 were identified using TargetScanHuman 7.1, and potential hybridization of the miR-134 seed sequence to the 3′ UTR Serpine1 mRNA was identified in the Serpine 3′ UTR at positions 345–352 in the mouse transcript and 417–424 in the human transcript (see Figure 3 ). Using RNAStructure "Prediction of Bimolecular Secondary Structure Web Server" version 6.0.1 ( https: / / rna.urmc.rochester.edu / RNAstructureWeb / Servers / PredictBi / PredictBi.html ) predicted the interaction between microRNA-134 and the 3' UTR segment (Reuter and Mathews 2010).

[0290] Example 4

[0291] Analysis of Serpine1 mRNA expression in human breast cancer MDA-MB-231 cells after treatment with pre-miR-134 and LNA anti-miR or LNA control. MDA-MB-231 cells were seeded into 24-well plates and transfected the following day with 40 nM pre-miR-134 (Ambion pre-miR hsa-mir-134-5p, AM17100) and / or 100 nM LNA anti-miR or 100 nM control LNA using lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Two days after transfection, RNA from the 24-well setup was purified using the MagNA Pure 96 Cellular RNA High Capacity Kit (Roche, ID: 05469535001) according to the manufacturer's instructions, with an elution volume of 50 μL. One-step ddPCR was performed using the One-Step RT-ddPCR Probe Advanced Kit (Bio-Rad, ID: 1864021). FAM-labeled probes and primers were from IDT (Serpine1 Hs.PT.58.3938488.g), while HEX-labeled HPRT1 probes and primers were from IDT (Hs.PT.58v.45621572). The cycling conditions were: 95°C for 10 min; denaturation at 94°C for 30 s; annealing temperature depended on the assay and lasted for 1 min; the denaturation and annealing steps were repeated 42 times. After 42 cycles, the enzyme was inactivated at 98°C for 10 min. If the sample was not used directly, it was stored at 4°C. The droplets were flowed through a droplet reader QX200TM (Bio-Rad) for fluorescence analysis, and the number of FAM-stained Serpine1 droplets and HEX-stained HPRT1 droplets was counted. The results are presented in Figure 4 Shown in.

[0292] Additional references:

[0293] Chen Y .et al., Nat Protoc. 2007;2(5):1044-51.

[0294] Ellwanger et al., 2011. “The Sufficient Minimal Set of MiRNA Seed Types.” Bioinformatics (Oxford, England), 27 (10): 1346–50. https: / / doi.org / 10.1093 / bioinformatics / btr149.

[0295] Kim et al., 2015. “HISAT: A FastSpliced ​​Aligner with Low Memory Requirements”. Nature Methods 12(4): 357–60. https: / / doi.org / 10.1038 / nmeth.3317.

[0296] Law et al., 2014. “Voom: Precision Weights Unlock Linear Model Analysis Tools for RNA-Seq Read Counts”. Genome Biology 15 (2): R29. https: / / doi.org / 10.1186 / gb-2014-15-2-r29.

[0297] Liao et al., 2013. “The Subread Aligner: Fast, Accurate and Scalable Read Mapping by Seed-and-Vote.” Nucleic Acids Research 41 (10): e108. https: / / doi.org / 10.1093 / nar / gkt214.

[0298] Reuter, Jessica S., and David H. Mathews. 2010. “RNAstructure: Software for RNA Secondary Structure Prediction and Analysis.” BMC Bioinformatics 11 (March): 129. https: / / doi.org / 10.1186 / 1471-2105-11-129.

Claims

1. An in vitro method for determining the activity of a microRNA-134 modulator in a cell, such as a neuronal cell, comprising the step of determining the level of a Serpine 1 biomarker in the cell to which the microRNA-134 modulator is added.

2. An in vitro method for identifying a subject suffering from a neurological disease, such as a neurological disease associated with seizures (e.g., epilepsy, such as epileptic encephalopathy or cerebral ischemic injury), who may benefit from administration of a therapeutic agent comprising a microRNA-134 modulator, such as an antagonist, comprising the steps of: a) measuring the level of a Serpine 1 biomarker in a sample obtained from the subject; b) comparing to at least one reference level of said Serpine 1 biomarker; c) to identify whether the subject is likely to benefit from administration of a therapeutic agent comprising a microRNA-134 modulator, such as an antagonist.

3. An in vitro method for determining the efficacy of a therapeutic agent that is a microRNA-134 modulator, such as an antagonist, in a subject, the method comprising the steps of: d) measuring the level of a Serpine 1 biomarker in a sample obtained from a subject who has previously been administered a therapeutic agent that is a microRNA-134 modulator, such as an antagonist; e) comparing to at least one reference level of said Serpine 1 biomarker; f) to identify the therapeutic efficacy of said microRNA-134 modulators, such as antagonists.

4. An in vitro method for diagnosing a neurological disease, such as a neurological disease associated with epileptic seizures (e.g., epilepsy, such as epileptic encephalopathy or cerebral ischemic injury), wherein the neurological disease is amenable to treatment with a microRNA-134 antagonist therapeutic agent, the method comprising the steps of: a. measuring the level of Serpine 1 biomarker in a sample obtained from the subject; b. comparing to at least one reference level of the Serpine 1 biomarker; c. to identify whether the subject has a neurological disease suitable for treatment with a microRNA-134 antagonist therapeutic agent.

5. A method of treating a neurological disease in a subject in need of treatment with a microRNA-134 antagonist therapeutic agent, such as a neurological disease associated with epileptic seizures (e.g., epilepsy, such as epileptic encephalopathy or cerebral ischemic injury), comprising the method of any one of claims 1 to 4, followed by the step of administering to the subject an effective dose of the microRNA-134 antagonist therapeutic agent.

6. The method according to any one of claims 2 to 5, wherein the reference level is a. Levels of disease-associated Serpine 1 biomarkers, b. Normal levels of Serpine 1 biomarkers, ca) and b) both.

7. Use of a Serpine 1 biomarker assay in vitro for measuring microRNA-134 modulation, such as microRNA-134 inhibition.

8. A Serpine 1 biomarker assay for use as an in vitro companion diagnostic for a microRNA-134 modulator, such as an antagonist, therapeutic agent, for example, a microRNA-134 antagonist therapeutic agent, in the treatment of a neurological disorder such as epilepsy.

9. An in vitro use of a Serpine 1 biomarker for determining the likely response of a subject suffering from a neurological disease, such as a neurological disease associated with seizures (e.g., epilepsy, such as epileptic encephalopathy or cerebral ischemic injury), to a therapeutic agent comprising a microRNA-134 modulator.

10. The method or use according to any one of claims 1 to 9, wherein the Serpine 1 biomarker assay is selected from the group consisting of: a. Measurement of Serpine 1 mRNA b. Measurement of Serpine 1 protein c. Measurement of Serpine 1 activity d. Measurement of tissue plasminogen activator (tPA) activity e. Measurement of the conversion of plasminogen to plasmin.

11. The method of use according to any one of claims 1 to 10, wherein an increase in the Serpine 1 biomarker indicates a decrease in the level of microRNA-134, or wherein a decrease in the Serpine 1 biomarker indicates an increase in the level of microRNA-134.

12. The method or use according to any one of claims 1 to 11, wherein the subject suffers from a disease or condition associated with microRNA-134, such as a neurological disease, such as a disease associated with epileptic seizures (e.g., epilepsy, such as epileptic encephalopathy or cerebral ischemic injury), or is at risk of suffering from the disease or condition associated with microRNA-134, such as epileptic seizures, such as epileptic encephalopathy.

13. The method or use according to any one of claims 1 to 12, wherein the subject has previously undergone tPA (tissue plasminogen activator) treatment, for example for thrombosis.

14. The method or use of any one of claims 1 to 13, wherein the Serpine 1 biomarker is determined in a sample obtained from the subject, the sample selected from the group consisting of a cerebrospinal fluid sample, a blood sample, or a plasma sample.

15. The method or use of any one of claims 1 to 13, wherein the Serpine 1 biomarker is determined in a cerebrospinal cord sample obtained from the subject.

16. The method of use according to any one of claims 1 to 14, wherein the microRNA-134 modulator is an antisense oligonucleotide inhibitor of microRNA-134, said antisense oligonucleotide inhibitor comprising at least 7 consecutive nucleotides that are complementary to microRNA-134, such as hsa-miR-134, such as SEQ ID NO 1, such as fully complementary.

17. The method or use of any one of claims 1 to 25, wherein the microRNA-134 modulator is an LNA antisense oligonucleotide.

Images