Reagent compositions, kits and uses for the detection of cervical cancer

Abstract

The application relates to the technical field of biological detection, and discloses a reagent composition, a kit and purposes for cervical cancer detection. The reagent composition comprises the following combinations of primers and probes: the primers shown in SEQ ID NO: 7-8, the probe shown in SEQ ID NO: 9; the primers shown in SEQ ID NO: 10-11, the probe shown in SEQ ID NO: 12; the primers shown in SEQ ID NO: 13-14, the probe shown in SEQ ID NO: 15; the primers shown in SEQ ID NO: 16-17, the probe shown in SEQ ID NO: 18; and the primers shown in SEQ ID NO: 19-20, the probe shown in SEQ ID NO: 21. The reagent composition has high sensitivity and specificity in the detection of cervical cancer and high-grade cervical precancerous lesions.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological detection, in particular to a reagent composition, a kit and a use for cervical cancer detection. BACKGROUND

[0002] The onset and progression of cervical cancer both need to go through a relatively long period, from early cervical intraepithelial neoplasia (CIN) to the development of cervical cancer, which takes several years or decades. If the patient is diagnosed at the early stage of the disease, effective treatment measures are taken as soon as possible to curb the development of the disease, and the cure rate can reach 100%.

[0003] At present, the mainstream cervical cancer screening methods in China include cytological examination (TCT) and HPV detection, but both have significant defects: TCT has low sensitivity, and the results are highly dependent on the experience of pathologists, and false negatives are prone to occur. The shortage of domestic cytological pathologists makes the liquid-based cytology technology have "instability and non-standardization" in sample collection, processing and interpretation, which seriously affects the accuracy of detection; HPV detection has high sensitivity, but low positive predictive value, resulting in a large number of non-cancer infected persons receiving unnecessary colposcopy biopsy, which increases the medical burden and patient anxiety. Subtypes such as HPV52 and HPV58 are often found in low-grade lesions, and most of them can be naturally cleared. Therefore, it is urgent to develop more effective early screening and early diagnosis technology to make up for the defects of existing detection methods and change the severe situation of cervical cancer diagnosis and treatment.

[0004] DNA methylation is a covalent modification of DNA, the specific process is: under the action of DNA methyltransferases (DNMTs), methyl is added to the 5' carbon position of cytosine in the DNA CpG sequence, and finally 5-methylcytosine is formed. The structure formed by the aggregation of multiple CpGs is called CpG island (CGI), which is mainly located in the promoter and the first exon region in the structural gene. In cancer cells, there is a DNA methylation marker, which is essentially a manifestation of DNA abnormal methylation. This abnormal methylation phenomenon exists throughout the stages of cancer occurrence and development. Compared with traditional tumor markers, DNA methylation markers have many advantages in cancer detection, such as earlier detection, non-invasive detection, and more accurate detection results. At present, there are several NMPA certified cervical cancer methylation PCR detection products on the market, but there are still problems of DNA damage and degradation, incomplete transformation and complex operation. Therefore, it is urgent to develop a cervical cancer screening technology with high detection sensitivity, specificity and accuracy, good detection stability and simple operation. SUMMARY

[0005] The present invention aims to overcome the aforementioned problems of the prior art by providing a reagent composition, kit, and use thereof for cervical cancer detection. The reagent composition provided by the present invention detects the methylation levels of specific genes, exhibiting high specificity and sensitivity, and is capable of efficiently screening for the risk of cervical cancer and (advanced) precancerous lesions.

[0006] In order to achieve the above object, the present invention provides a reagent composition for cervical cancer detection, which comprises the following combination of primers and probes:

[0007] (1) Primers and probes for detecting LEPR gene methylation levels: primers having nucleotide sequences as shown in SEQ ID NOs: 7-8, and a probe having a nucleotide sequence as shown in SEQ ID NO: 9;

[0008] (2) Primers and probes for detecting the methylation level of the GABRA2 gene: primers having nucleotide sequences as shown in SEQ ID NOs: 10-11, and a probe having a nucleotide sequence as shown in SEQ ID NO: 12;

[0009] (3) Primers and probes for detecting the methylation level of the RNF219-AS1 gene: primers having nucleotide sequences as shown in SEQ ID NOs: 13-14, and a probe having a nucleotide sequence as shown in SEQ ID NO: 15;

[0010] (4) Primers and probes for detecting the methylation level of the ASCL1 gene: primers having nucleotide sequences as shown in SEQ ID NOs: 16-17, and a probe having a nucleotide sequence as shown in SEQ ID NO: 18;

[0011] (5) Primers and probes for detecting the methylation level of the ZNF671 gene: primers having nucleotide sequences as shown in SEQ ID NOs: 19-20, and a probe having a nucleotide sequence as shown in SEQ ID NO: 21.

[0012] A second aspect of the present invention provides a kit for detecting cervical cancer, the kit comprising the reagent composition described in the first aspect.

[0013] The third aspect of the present invention provides use of the reagent composition described in the first aspect in preparing a kit for screening cervical cancer or cervical precancerous lesions.

[0014] The fourth aspect of the present invention provides use of the kit described in the second aspect in preparing a kit for detecting cervical cancer or cervical precancerous lesions.

[0015] Through the above technical solution, the present invention can achieve at least the following beneficial effects:

[0016] (1) This study screened five relevant marker genes and their optimal methylation regions, and used multi-gene methylation combined detection to significantly improve the detection rate of cervical cancer. The method has high sensitivity and specificity, effectively distinguishing cervical cancer and assisting clinical assessment of cervical cancer risk. Furthermore, a prediction model was constructed, with scientific and reasonable analysis and relatively simple interpretation of the results.

[0017] (2) The present invention has a short detection time and a simple operation process. In particular, according to a preferred embodiment of the present invention, a rapid DNA methylation detection technology that does not rely on sulfite conversion is adopted. By placing the enzyme treatment process and the PCR amplification detection process in the same reaction tube, the DNA loss caused by traditional sulfite treatment is avoided, and the detection sensitivity is further improved.

[0018] (3) The present invention can achieve non-invasive detection / diagnosis, and patient compliance is high. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] 图1 This is a diagram showing the results of fluorescent quantitative PCR detection of positive samples using the reagent combination of the present invention.

[0020] 图2 This is a graph showing the results of fluorescent quantitative PCR detection of negative samples using the reagent combination of the present invention.

[0021] 图3 This is the ROC curve with CIN2+ as the outcome variable.

[0022] 图4 This is the ROC curve with CIN3+ as the outcome variable. DETAILED DESCRIPTION

[0023] The endpoints of the ranges and any values ​​disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0024] For purposes of this disclosure, the term "detecting cervical cancer" includes the prediction of cervical precancerous lesions. Cervical cancer and precancerous lesions are categorized into four grades based on severity: CIN1, CIN2, CIN3, and cervical cancer (CC). "CIN" refers to the grade of cervical intraepithelial neoplasia (CIN), "CIN1" refers to grade 1 CIN, "CIN2" refers to grade 2 CIN, and "CIN3" refers to grade 3 CIN. Higher grades indicate a higher risk of cervical cancer. For purposes of this disclosure, "high-grade cervical precancerous lesions" include CIN2 and CIN3. "CIN2+" refers to CIN2, CIN3, and CC; "CIN3+" refers to CIN3 and CC.

[0025] Studies have shown that the methylation of specific genes is closely related to the occurrence of cancer. At present, there are many genes in the field that are considered to be related to cervical cancer and cervical precancerous lesions, and the preliminary screening programs for cervical cancer and cervical precancerous lesions are constantly updated by detecting the methylation levels of these genes. However, the current genetic testing methods are still not ideal for screening cervical cancer and cervical precancerous lesions, and missed screening, false positives, etc. occur frequently. In long-term research, the inventors of the present invention cleverly discovered that the method of jointly detecting the methylation levels of specific genes in cervical cancer-related marker genes has good sensitivity and specificity, thereby effectively improving the screening accuracy and significantly reducing the referral rate. Therefore, the present invention provides a method of detecting cervical cancer by detecting the methylation levels of genes in the sample. LEPR Gene, GABRA2 Gene, RNF219-AS1 Gene, ASCL1 Genes and ZNF671 The invention provides a method for in vitro detection of cervical cancer and / or cervical precancerous lesions based on the methylation status of a target sequence in a gene. The method provided by the invention can detect cervical cancer and / or cervical precancerous lesions non-invasively and rapidly.

[0026] Based on this, the first aspect of the present invention provides a reagent composition for detecting cervical cancer, the reagent composition comprising a reagent for detecting the methylation status of cervical cancer and cervical precancerous lesion marker genes or their fragments, wherein the marker genes include LEPR Gene, GABRA2 Gene, RNF219-AS1 Gene, ASCL1 Genes and ZNF671 The methylation status of the marker gene or its fragment is characterized by the methylation of the target sequence of the marker gene.

[0027] The gene names involved in the present invention have general meanings in the art, and their complete sequences can be obtained by conventional means in the art, for example, by querying public biological information databases such as NCBI. For example, LEPR The protein encoded by the gene belongs to the gp130 family of cytokine receptors, which are known to stimulate gene transcription by activating cytosolic stat proteins; LEPR The protein encoded by this gene is a receptor for leptin, a fat cell-specific hormone that regulates body weight, and is involved in the regulation of fat metabolism and a novel hematopoietic pathway required for normal lymphogenesis; LEPR(leptin receptor) The complete sequence of the gene can be found in Gene ID: 3953. GABRA2 The gene encodes the gamma-aminobutyric acid type B receptor, which plays an important inhibitory regulatory role in the nervous system; GABRA2 The complete sequence of the gene can be found in Gene ID: 2555. RNF219-AS1 Genes involved in the regulation of protein autoubiquitination, protein monoubiquitination, and DNA replication; RNF219-AS1 The complete sequence of the gene can be found in Gene ID: 100874222. ASCL1 The gene encodes a member of the basic helix-loop-helix (bHLH) family of transcription factors that activates transcription by binding to the E-box (5'-canntg-3'); ASCL1 The complete sequence of the gene can be found in GeneID: 429. ZNF671(zinc finger protein 671) The gene has DNA binding transcription factor activity and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity; it is involved in the transcriptional regulation of RNA polymerase II; ZNF671 The complete sequence of the gene can be found in Gene ID: 79891.

[0028] The reagent composition provided by the present invention can be used for the complete LEPR Gene, GABRA2 Gene, RNF219-AS1 Gene, ASCL1 Genes and ZNF671 The methylation level (or status) of the gene can be detected, and the methylation level of some fragments (such as a single fragment or multiple fragments) in the above gene can also be detected. The inventors found in their research that LEPR Gene, GABRA2 Gene, RNF219-AS1 Gene, ASCL1 Genes and ZNF671 The purpose of screening for cervical cancer and cervical precancerous lesions at a high sensitivity and specificity can be achieved by detecting and analyzing the methylation level of a specific region in the gene. Compared with the detection of the entire gene, the detection of a specific segment is simpler and easier, so the present invention preferably uses a specific region in the reagent composition. LEPR Gene, GABRA2 Gene, RNF219-AS1 Gene, ASCL1 Genes and ZNF671 A reagent that detects the methylation level of a specific region in a gene.

[0029] According to some preferred embodiments of the present invention, the reagent for detecting the methylation status of cervical cancer and cervical precancerous lesion marker genes or fragments thereof is a reagent for detecting the methylation level of CpG island regions or fragments thereof in cervical cancer and cervical precancerous lesion marker genes. CpG is the abbreviation for cytosine (C)-phosphate (P)-guanine (G), and "CpG island" refers to a region of the genome rich in CpG dinucleotides.

[0030] The reagent composition provided by the present invention can detect the methylation level in the complete sequence of the CpG island region in each of the aforementioned genes, or can detect the methylation level in a partial segment (such as a single fragment or multiple fragments).

[0031] According to some particularly preferred embodiments of the present invention, the reagent used to detect the methylation status of cervical cancer and cervical precancerous lesion marker genes or their fragments is a reagent used to detect the methylation level function of gene fragments with nucleotide sequences such as those shown in SEQ ID NOs: 1-5 (a reagent that can simultaneously detect the methylation level function of five gene fragments with nucleotide sequences such as those shown in SEQ ID NOs: 1-5).

[0032] The reagent composition of the present invention can detect the methylation level of the target detection region sequence, or can detect the methylation level of a segment of a marker gene that has at least 80% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 100%, or a range consisting of any two of the above values, or any intermediate value within the range) homology to the target sequence of SEQ ID NOs: 1-5. For example, the methylation level of a gene fragment containing additional nucleotides in addition to the above sequence can be detected.

[0033] According to a preferred embodiment of the present invention, the reagent composition further includes a reagent for detecting an internal standard. An "internal standard" refers to a non-target gene (or fragment thereof) that is detected together with the target gene (or fragment thereof). The addition of an internal standard detection reagent during detection can further improve detection accuracy. Typically, a known conserved gene in the target object (e.g., the sample being tested) can be selected as the internal standard.

[0034] Preferably, the internal standard is at least one of the human housekeeping genes. "Housekeeping genes," also known as "housekeeping genes" or "housekeeping genes," are a type of gene that is stably expressed in all cells.

[0035] According to a particularly preferred embodiment of the present invention, wherein the internal standard is ACTB gene (its complete sequence can be found in Gene Bank accession number: NC_000007.14) or its fragments. ACTB The gene "is the gene encoding human cytoskeletal actin (β-Actin).

[0036] Preferably, the nucleotide sequence of the internal standard (target sequence) is as shown in SEQ ID NO:6.

[0037] In the present invention, the reagents used to detect the methylation levels of the marker genes and (optionally) the internal standard can be conventional reagents used in corresponding detection methods in the art. For example, detection can be performed using amplification-sequencing, biochips, methylation fluorescence quantitative PCR, etc. Correspondingly, the reagent compositions of the present invention can use reagents commonly used in these methods.

[0038] For example, when methylation fluorescence quantitative PCR is used for detection, according to a preferred embodiment of the present invention, the reagent composition includes nucleic acid primers and probes. "Methylation fluorescence quantitative PCR" refers to a method in which the methylation level of the region to be detected is determined by converting the region to be detected by sulfite or digesting it with a methylation-sensitive restriction endonuclease, and then performing fluorescence quantitative PCR detection using primers and probes specifically designed for the detection target.

[0039] Any nucleic acid primer and probe capable of detecting the aforementioned marker genes and (optionally) internal standards is suitable for use in the present invention. A "primer" refers to an oligonucleotide that can serve as a starting point for synthesis when placed under conditions that induce the synthesis of a primer extension product complementary to a nucleic acid chain, i.e., in the presence of nucleotides and an inducer such as a DNA or RNA polymerase, and at a suitable temperature and pH. A primer typically contains at least about 9, 10, 15, 20, 25, or more nucleotides. A "probe" refers to a nucleic acid sequence that can hybridize to a target sequence under specified conditions and can be used to detect the presence of the target sequence.

[0040] In order to obtain better detection effect, preferably, the reagent composition includes the following combination of primers and probes:

[0041] (1) Detection LEPR Primers and probes for gene methylation levels: primers whose nucleotide sequences are shown in SEQ ID NOs: 7-8, and a probe whose nucleotide sequence is shown in SEQ ID NO: 9;

[0042] (2) Detection GABRA2 Primers and probes for gene methylation levels: primers whose nucleotide sequences are shown in SEQ ID NOs: 10-11, and a probe whose nucleotide sequence is shown in SEQ ID NO: 12;

[0043] (3) Detection RNF219-AS1 Primers and probes for gene methylation levels: primers whose nucleotide sequences are shown in SEQ ID NOs: 13-14, and a probe whose nucleotide sequence is shown in SEQ ID NO: 15;

[0044] (4) Detection ASCL1 Primers and probes for gene methylation levels: primers whose nucleotide sequences are shown in SEQ ID NOs: 16-17, and a probe whose nucleotide sequence is shown in SEQ ID NO: 18; and

[0045] (5) Detection ZNF671 Primers and probes for gene methylation levels: primers whose nucleotide sequences are shown in SEQ ID NOs: 19-20, and a probe whose nucleotide sequence is shown in SEQ ID NO: 21.

[0046] More preferably, the reagent composition further comprises:

[0047] (6) Detection ACTB Primers and probe for the gene (internal standard): primers having nucleotide sequences as shown in SEQ ID NOs: 22-23, and a probe having a nucleotide sequence as shown in SEQ ID NO: 24.

[0048] According to the present invention, to detect the aforementioned marker genes by methylation-based fluorescent quantitative PCR, the probes are modified with a reporter group (typically at the 5' end), preferably a fluorescent reporter group. Any fluorescent reporter group commonly used in the art can be used in the present invention, for example, ATTO 425, HEX, FAM, ROX, CY5, Quasar 705, Alexa Fluor 405, and the like. Preferably, the (fluorescent) reporter groups modified on different probes are detected using different fluorescence detection channels (i.e., the reporter groups on different probes are different).

[0049] According to a preferred embodiment of the present invention, the probe is further modified with a quencher group (typically at the 3' end), preferably a fluorescence quencher group. Any quencher group commonly used in combination with a reporter group in the art is suitable for use in the present invention. Examples include BHQ-0, BHQ-1, BHQ-2, SQ1, SQ2, and the like. Those skilled in the art are familiar with the pairing of reporter groups and their corresponding quenchers. The quenchers on different probes can be the same or different, and will not be further elaborated here.

[0050] According to some preferred embodiments of the present invention, the reagent composition further comprises a negative control reagent and / or a positive control reagent.

[0051] A negative control reagent refers to a target gene (such as the aforementioned marker gene or fragment thereof) that is not methylated. In the reagent composition provided herein, the negative control may contain only one verified non-methylated marker gene or fragment thereof, or may contain multiple verified non-methylated marker genes or fragments thereof.

[0052] A positive control reagent refers to a target gene known to be methylated (e.g., the aforementioned marker gene or fragment thereof). In the reagent composition provided herein, the positive control may contain only one validated methylated marker gene or fragment thereof, or may contain multiple validated methylated marker genes or fragments thereof.

[0053] In the reagent composition provided by the present invention, both the negative control and the positive control can be obtained by conventional means, for example, by artificial synthesis.

[0054] A second aspect of the present invention provides a kit for detecting cervical cancer, wherein the kit comprises the reagent composition described in the first aspect.

[0055] The kit provided herein may contain only core reagents for detecting cervical cancer and cervical precancerous lesions (e.g., primers and probes used for the aforementioned marker gene detection), or may further include other conventional reagents required for the detection process (e.g., buffer systems, enzymes, dNTPs, and other reagents required for PCR detection; and reagents required for nucleic acid extraction, purification, and sample pretreatment for methylation detection). Any reagent commonly used in the art for marker gene detection may be suitable for use in the present invention, and skilled artisans may select and adjust the reagents based on the actual detection technology used.

[0056] According to some preferred embodiments of the present invention, the kit further comprises at least one of an enzyme, a buffer, a magnesium source and dNTPs.

[0057] Preferably, the enzyme comprises a methylation-sensitive restriction endonuclease and / or a DNA polymerase. Any enzyme that can be used in methylation fluorescence quantitative PCR is suitable for use in the present invention. Preferably, the methylation-sensitive restriction endonuclease comprises at least one of HpaII, HinP1I, and HhaI. Any DNA polymerase known in the art for methylation fluorescence quantitative PCR can be used in the present invention, for example, a conventional DNA polymerase or a hot-start DNA polymerase (such as Taq enzyme).

[0058] Preferably, the magnesium source comprises a water-soluble inorganic Mg salt. Typically, the magnesium source can be provided in the form of an aqueous solution, such as Mg 2+ Magnesium chloride, magnesium sulfate, magnesium nitrate, etc. with a concentration of 1-6mM.

[0059] More preferably, the kit further comprises reagents and utensils for nucleic acid extraction and / or purification.

[0060] Reagents (or vessels) for nucleic acid extraction and / or purification are primarily used to extract nucleic acids from a sample, and the extracted nucleic acids are then tested using the reagents for detecting marker gene methylation levels contained in the kit of the present invention. Any reagent known in the art for extracting / purifying nucleic acids from biological samples is suitable for use in the present invention. These reagents can be purchased commercially or prepared using existing techniques. The biological sample can be a test specimen collected from a subject in need, such as at least one of a histological section, a tissue biopsy / paraffin-embedded tissue, or cells (e.g., cervical exfoliated cells).

[0061] In the present invention, there is no particular limitation on the concentrations of the various reagents contained in the kit, and they can be adjusted according to actual detection needs.

[0062] In order to obtain better detection effects (such as improving sensitivity, specificity and accuracy, etc.), according to some preferred embodiments of the present invention, among the reagents contained in the kit, Mg 2+ The final concentration of the primer can be 1-6 mM; the final concentration of dNTPs can be 1-80 mM; the final concentration of the methylation-sensitive restriction endonuclease can be 0.01-30 U / μL; the final concentration of the primer can be 0.1-40 μM; and the final concentration of the probe can be 0.1-20 μM. The final concentrations of the primer and probe refer to the final concentration of one primer / probe.

[0063] The present invention further provides a method for detecting cervical cancer, which comprises detecting a sample using the reagent composition described in the first aspect or the kit described in the second aspect.

[0064] The method provided by the present application can be a diagnostic method or a non-diagnostic method. For example, the diagnostic method can comprise detecting a sample from a subject in need by using the reagent composition or kit provided by the present application, and determining whether the subject has a risk of cervical cancer or cervical precancerous lesion (especially high-grade cervical precancerous lesion), so as to determine the subsequent diagnosis and treatment plan (for example, whether to transfer, whether to further treat, etc.). For another example, the non-diagnostic method can comprise detecting a sample by using the reagent composition or kit provided by the present application in research work or non-diagnostic detection work, for example, detecting a sample by using the reagent composition or kit provided by the present application in the mechanism research of cervical cancer and precancerous lesion, drug development, etc.

[0065] According to some preferred embodiments of the present application, the method can further comprise a step of constructing a prediction model for detecting cervical cancer. This step can be performed in a conventional manner in the art, and preferably a prediction model can be constructed by using logistic regression.

[0066] For example, the construction of the prediction model can be based on logistic regression fitting, and the prediction performance of the model can be evaluated by ROC curve analysis. The process of logistic regression fitting and ROC curve analysis can be performed by using existing methods in the art, for example, a prediction model can be constructed by using corresponding computer software based on the detection results.

[0067] According to a particularly preferred embodiment of the present application, the prediction model is as shown in (I) or (II):

[0068] (I) taking CIN2+ as the outcome variable:

[0069] P=EXP(4.0452-0.203ΔCt(LEPR)+0.0698ΔCt(GABRA2)-0.0964ΔCt(RNF219-AS1)-0.1161ΔCt(ASCL1)-0.0484ΔCt(ZNF671)) / (1+EXP(4.0452-0.203ΔCt(LEPR)+0.0698ΔCt(GABRA2)-0.0964ΔCt(RNF219-AS1)-0.1161ΔCt(ASCL1)-0.0484ΔCt(ZNF671))

[0070] (II) taking CIN3+ as the outcome variable:

[0071] P=EXP(3.0622-0.1224ΔCt(LEPR)+0.0838ΔCt(GABRA2)-0.2073ΔCt(RNF219-AS1)-0.1501ΔCt(ASCL1)-0.024ΔCt(ZNF671)) / (1+EXP(3.0622-0.1224ΔCt(LEPR)+0.0838ΔCt(GABRA2)-0.2073ΔCt(RNF219-AS1)-0.1501ΔCt(ASCL1)-0.024ΔCt(ZNF671)))

[0072] In the prediction model (I) or (II), ΔCt(LEPR) is LEPR The ΔCt value of the gene (representing its methylation level / status), and so on; P It is the risk index of cervical cancer or cervical precancerous lesions.

[0073] Preferably, the above-mentioned prediction model is used to diagnose cervical cancer and precancerous lesions. When the P value calculated by prediction model (I) is greater than or equal to 0.311, the diagnosis is positive (i.e., CIN2+, requiring subsequent referral and further treatment); when it is less than 0.311, the diagnosis is negative (i.e., CIN1 or the normal group (common inflammation or no lesions), no subsequent diagnosis and treatment is required). When the P value calculated by prediction model (II) is greater than or equal to 0.126, the diagnosis is positive; when it is less than 0.126, the diagnosis is negative.

[0074] Preferably, the method may further comprise the step of predicting the risk of cervical cancer and cervical precancerous lesions of the subject providing the sample based on the prediction model and the test results of the sample.

[0075] In order to achieve the above detection, the present invention also relates to a system for detecting cervical cancer, the system comprising:

[0076] (a) a cervical cancer-related feature input module, used to input cervical cancer-related features of a subject, wherein the cervical cancer-related features include: the methylation status of the marker genes or fragments thereof described in the aforementioned reagent composition;

[0077] (b) a cervical cancer discrimination processing module, configured to input cervical cancer-related features into a cervical cancer prediction model (e.g., the aforementioned prediction model) to obtain a risk probability; and to compare the risk probability with a cervical cancer risk threshold to obtain an auxiliary diagnosis result;

[0078] (c) An auxiliary diagnosis result output module, used to output the auxiliary diagnosis result.

[0079] The third aspect of the present invention provides use of the reagent composition in preparing a kit for screening cervical cancer or cervical precancerous lesions.

[0080] Similarly, the present invention also provides use of the reagent composition described in the first aspect, or the kit described in the second aspect, in screening samples of cervical cancer or cervical precancerous lesions.

[0081] A fourth aspect of the present invention provides LEPR Gene, GABRA2 Gene, RNF219-AS1 Gene, ASCL1 Genes and ZNF671 Use of a combined gene methylation level detection reagent in the preparation of a kit for detecting cervical cancer or cervical precancerous lesions.

[0082] Similarly, the present invention further provides LEPR Gene, GABRA2 Gene, RNF219-AS1 Gene, ASCL1 Genes and ZNF671 Application of combined detection of gene methylation levels in the detection of cervical cancer and cervical precancerous lesions.

[0083] The applications of the third and fourth aspects provided above can be diagnostic (for example, used in medical testing to further judge and determine subsequent testing / treatment plans) or non-diagnostic (for example, used in research work, for drug screening, disease mechanism research and verification, etc.).

[0084] The present invention will be described in detail below by way of examples. It should be understood that the following examples are only used to further explain and illustrate the present invention, and are not intended to limit the present invention.

[0085] In the following examples, unless otherwise specified, all reagents and materials used were commercially available products purchased from regular chemical or biological reagent / material suppliers, and all reagents were of analytical grade.

[0086] Example 1

[0087] Target and primer sequences: A detection system (reagent composition) for early cervical cancer screening was developed using a combination of CpG islands in the promoter regions of five genes, namely LEPR, GABRA2, RNF219-AS1, ASCL1, and ZNF671 (target sequences are shown in SEQ ID NOs: 1-5, respectively). The ACTB gene was used as an internal standard for detection, and its target sequence is shown in SEQ ID NO: 6.

[0088] LEPR (hg19_dna chr1:65991093-65991246)靶序列如下所示:

[0089] CTGCGGGCAGGGGTCCTCCCTCCCCAGCGCCGGGTCTCTCCTCCCGCAGGCCCGCGGCCACCCGCAGCGGCATTCCCCGCCGCCGCCCCCGCCACCTGCGCGACCGCCCTAGCCGCTCGAGTCCGCTCCTCCCGCTCAGGGGCGGCTGCGGAGG(SEQ ID NO:1)

[0090] GABRA2 (hg19_dna chr4:46391314-46391520)靶序列如下所示:

[0091] CCCTTCCTGCCCACCCACGGTTGCCCAAGACCAAGTCTTAGAGGCAGCCGGGTTCCGATCAAGTGCTGCGAAACGACGCGTTTGACAGCTGCTCTGGAGCCGAGGATCACAATAAGAGAAGGCGCGTGAGGCTCCGGCAGCAAACACCAGCCAGGCAGGCAGCGGTAATCACAGTGAGCAAAGTTGAAGACTATAAAAGAGCCAGGC(SEQ ID NO:2)

[0092] RNF219-AS1 (hg19_dna chr13:79170075-79170260)靶序列如下所示:

[0093] AGAACGTCCTCAAGGGCACGTAAGAGTTGGAGGTGACCTCCGGGAGCGCCTAATTTTGAGCCGCGGAACTTCGGCCCACTTCTCCGAGGGGACCAGGCGCGCGCCAATACGCATGTGCGGGCTCTGAGCGCTCAGAGCGCGCCTCTTCCTTCCCGGCTCCCCGCGGTGCGCACCCGCTGGCCACTC(SEQ ID NO:3)

[0094] ASCL1 (hg19_dna chr12:103352208-103352414)靶序列如下所示:

[0095] GGCGCCGCAGCTGAGACCGGCGGCCGACGGCCAGCCCTCAGGGGGCGGTCACAAGTCAGCGCCCAAGCAAGTCAAGCGACAGCGCTCGTCTTCGCCCGAACTGATGCGCTGCAAACGCCGGCTCAACTTCAGCGGCTTTGGCTACAGCCTGCCGCAGCAGCAGCCGGCCGCCGTGGCGCGCCGCAACGAGCGCGAGCGCAACCGCGT(SEQ ID NO:4)

[0096] ZNF671 (hg19_dna chr19:58238828-58239028)靶序列如下所示:

[0097] CGATCGGGGACGCAGGCACTTCCGTCCCTGCAGAGCATCAGACGCGTCTCGGGACACTGGGGACAACATCTCCTCCGCGCTTTCCCAACACCTCCACCTGCGGCCCACACAAGCGTTACAGAACCCCGGCCAGGGACAGCCTGACAGAAACAAAATGTCCGCTACAAGGAGGAGCCGGAAGTCCCGCCCACGCACCCCCCG(SEQ ID NO:5)

[0098] ACTB (hg19_dna chr7:5566855-5567259)靶序列如下所示:

[0099] TTTTTGGCTTGACTCAGGATTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCCCCCAAAGTTCACAATGTGGCCGAGGACTTTGATTGCACATTGTTGTTTTTTTAATAGTCATTCCAAATATGAGATGCGTTGTTACAGGAAGTCCCTTGCCATCCTAAAAGCCACCCCACTTCTCTCTAAGGAGA ATGGCCCAGTCCTCTCCCAAGTCCACACAGGGGAGGTGATAGCATTGCTTTCGTGTAAATTATGTAATGCAAAATTTTTTTAATCTTCGCCTTAATACTTTTTTATTTTGTTTTATTTTGAATGATGAGCCTTCGTGCCCCCCTCCCCCTTTTTTGTCCCCCAACTTGAGATGTATGAAGGCTTTTGGTCTCCCTGGGA (SEQ ID NO: 6)

[0100] The primers and probes used are shown in Table 1 and were synthesized by Hunan Kangde Biotechnology Co., Ltd. In Table 1, the primers marked with "F" are upstream primers, the primers marked with "R" are downstream primers, and the primers marked with "P" are probes.

[0101] Table 1

[0102]

[0103] Example 2

[0104] Reference gene methylation level detection:

[0105] Positive samples were prepared by mixing fully methylated human genomic DNA with genomic DNA from normal human cervical exfoliated cells with no methylation of the target gene. The concentration was 1 ng / μL containing 10% fully methylated human genomic DNA (1 ng / μL genomic DNA from normal human cervical exfoliated cells with no methylation of the target gene: 1 ng / μL fully methylated human genomic DNA = 9:1); the concentration was 1 ng / μL containing 1% fully methylated human genomic DNA (1 ng / μL genomic DNA from normal human cervical exfoliated cells with no methylation of the target gene: 1 ng / μL fully methylated human genomic DNA = 99:1); and the concentration was 1 ng / μL containing 0.5% fully methylated human genomic DNA (1 ng / μL genomic DNA from normal human cervical exfoliated cells with no methylation of the target gene: 1 ng / μL fully methylated human genomic DNA = 199:1).

[0106] Negative samples: Human genomic DNA with no target gene methylation verified by sequencing, with a concentration of 10 ng / uL.

[0107] Methylation-sensitive restriction endonucleases: including HpaII, HinP1I, and HhaI. Their recognition sites and enzyme cleavage patterns are as follows:

[0108]

[0109] Testing process:

[0110] Preparation of PCR system: The PCR reaction solution was prepared according to the reagent formula in Table 2. In Table 2, PCR amplification buffer (S10) was purchased from Hunan Kangde Biotechnology Co., Ltd. with the product number PR001-10; hot start enzyme was purchased from Hunan Kangde Biotechnology Co., Ltd. with the product number TQ006-03; methylation-sensitive restriction endonuclease mix was MRES01 purchased from Hunan Kangde Biotechnology Co., Ltd. with the product number ME012-01.

[0111] Table 2

[0112]

[0113] Add 10uL of sample to the PCR reaction tube at a rate of 10uL / reaction, then add 40uL of PCR reaction solution in sequence, cover the PCR tube, shake to mix, and centrifuge for 5s.

[0114] Fluorescence PCR reaction and result analysis

[0115] 1) Place the PCR reaction tubes into the sample slot of the thermal cycler and set the names of the samples to be tested in the corresponding order.

[0116] 2) Fluorescence detection channel selection: Select the FAM channel (Reportere: FAM, Quencher: None) to detect LEPR; select the HEX channel (Reportere: HEX, Quencher: None) to detect GABRA2; select the ROX channel (Reportere: ROX, Quencher: None) to detect RNF219-AS1; select the Alexa Fluor 405 channel (Reportere: AlexaFluor 405, Quencher: None) to detect ASCL1; select the ATTO 425 channel (Reportere: ATTO 425, Quencher: None) to detect ZNF671; select the CY5 channel (Reportere: CY5, Quencher: None) as an internal standard to detect the housekeeping gene ACTB.

[0117] 3) Fluorescence quantitative PCR reaction conditions are shown in Table 3:

[0118] Table 3

[0119]

[0120] 4) Result analysis

[0121] After the reaction is completed, the instrument automatically saves the results and uses the instrument's built-in software for automatic analysis. The intersection of the amplification curve and the threshold line is called Ct (i.e., cycle threshold, which refers to the cycle value experienced when the fluorescence signal in the PCR reaction tube reaches the set threshold). 图1 As shown, the sensitivity of the detection reagent provided by the present invention can reach 0.5% target gene methylation in 1ng / µL nucleic acid, and there is no non-specific amplification in 100ng / reaction of non-methylated DNA (see 图2 ), indicating that the kit of the present invention has good specificity, and it can also detect when the detection concentration in the positive control is low, indicating that the reagent composition of the present invention has high sensitivity.

[0122] Example 3

[0123] Clinical cervical exfoliated cell sample testing: The test samples used in this example are all clinical samples (cervical exfoliated cell samples) collected from Hunan Shengweier Medical Laboratory Co., Ltd. The research content of this example has obtained informed consent from relevant personnel.

[0124] 950 clinical cervical exfoliated cell samples were collected, including 55 patients with cervical cancer, 451 patients with cervical intraepithelial neoplasia grade 1 (CIN1), 108 patients with cervical intraepithelial neoplasia grade 2 (CIN2), 68 patients with cervical intraepithelial neoplasia grade 3 (CIN3), and 268 normal samples. Nucleic acid extraction was performed using the Shengxiang Biotechnology Nucleic Acid Extraction Reagent S10025 in combination with the natch48 Extractor. Following the process of Example 2, nucleic acid sample enzymatic digestion and PCR amplification were performed in the same reaction tube. Based on the amplification results, the ΔCt value (Ct (target gene) - Ct (reference gene)) was calculated, and logistic regression fitting and ROC curve analysis were performed to obtain the prediction model:

[0125] (I) CIN2+ as the outcome variable:

[0126] P = EXP(3.0622 - 0.1224ACt(LEPR) + 0.0838ACt(GABRA2) - 0.2073ACt(RNF219-AS1) - 0.1501ACt(ASCL1) - 0.024ACt(ZNF671)) / (1 + EXP(3.0622 - 0.1224ACt(LEPR) + 0.0838ACt(GABRA2) - 0.2073ACt(RNF219-AS1) - 0.1501ACt(ASCL1) - 0.024ACt(ZNF671))

[0127] When the P value calculated by the prediction model (I) is greater than or equal to 0.311, it is judged as positive (i.e. judged as CIN2+, which needs subsequent referral and further treatment); less than 0.311, it is judged as negative (i.e. CIN1 or normal group, no need for subsequent diagnosis and treatment).

[0128] (II) Taking CIN3+ as the outcome variable:

[0129] P = EXP(3.0622 - 0.1224ACt(LEPR) + 0.0838ACt(GABRA2) - 0.2073ACt(RNF219-AS1) - 0.1501ACt(ASCL1) - 0.024ACt(ZNF671)) / (1 + EXP(3.0622 - 0.1224ACt(LEPR) + 0.0838ACt(GABRA2) - 0.2073ACt(RNF219-AS1) - 0.1501ACt(ASCL1) - 0.024ACt(ZNF671))

[0130] When the P value calculated by the prediction model (II) is greater than or equal to 0.126, it is judged as positive; less than 0.126, it is judged as negative.

[0131] The ROC curve analysis results of the prediction model (I) and the prediction model (II) are shown in 图3 and 图4 , which show the AUC value of the overall model and mark the best cutoff value in this population.

[0132] Methylation test results were judged positive using the optimal cutoff value. The detection results of prediction model (I) and prediction model (II) for high-grade cervical lesions and cervical cancer are shown in Table 4. CIN3+ includes CIN3 and cervical cancer, and CIN2+ includes cervical cancer, CIN3, and CIN2. The results showed that the sensitivity and specificity of the composition of the present invention for detecting high-grade cervical lesions CIN2 and CIN3 and cervical cancer (CIN2+) were 75.3% and 93.3%, respectively, and for detecting CIN3 and cervical cancer (CIN3+) were 94.3% and 88.5%, respectively.

[0133] Table 4

[0134]

[0135] Comparative Example 1

[0136] The detection effect of other reagent combinations on high-grade cervical lesions and cervical cancer in the samples of Example 3: LEPR、 GABRA2、RNF219-AS1、ASCL1、ZNF671、POU4F3、CADM1、RXFP3 The multi-target joint detection system was constructed by using multiple targets, and the sensitivity and specificity of each combination were tested according to the clinical cervical exfoliated cell samples in Example 3. LEPR、GABRA2、RNF219-AS1 The primer probes are designed for other regions of the gene, and the original combination primer probes (reagent combination of the present invention) are replaced to conduct experiments, such as combination (1), (2), (3) (combination (1) LEPR The target sequence of the gene is shown in SEQ ID NO: 25 and the primer and probe sequences are shown in SEQ ID NO: 31-33; in combination (2) GABRA2 The target sequence of the gene is shown in SEQ ID NO: 26 and the primer and probe sequences are shown in SEQ ID NO: 34-36; in combination (3) RNF219-AS1 The target sequence of the gene is shown in SEQ ID NO: 27 and the primer and probe sequences are shown in SEQ ID NO: 37-39). Combination (4) is POU4F3 、 CADM1 The primers and probes of the present invention are replaced by GABRA2 、 ZNF671 The primer and probe combination (5) is RXFP3、CADM1 The primers and probes of the present invention are replaced by LEPR 、 RNF219-AS1 The results showed that the clinical performance of the reagent combination of the present invention was the best, as shown in Table 6.

[0137] LEPR (hg19_dna chr1:65991564-65991764) target sequence is as follows:

[0138] AGAATGGGGCTTTGGGACGCGCGTGGCAGACGCGGAGCCCCGCGGGCCGCTTAGGGACTGGGAGTCCGGGGCAGCTTAGCGGGACCACCAGAGGGGCCAGCGCCCGGCGGGCGGCGGGGGTGGGGTGGGTGCGACGCCGGGCGACTCTCGGCTCCCGTGGGGCGAGGAAGATCTGGACACACGGCTGACAGCAGCCGGCAG(SEQ ID NO:25)

[0139] GABRA2 (hg19_dna chr4:46392317-46392517)靶序列如下所示:

[0140] CGGCGTCGGGCGCCTGGGTGCGCTCGGAGCGCCGCTCCCCTCGCCCACACCTCGCCGGAGGAGCGGAGCCCACGCGCAGCCTCGGGCTGCTCCCCGAGGCCGCTTGCTGGGGCTCCCGAGAGGCCCCAAGGTTCCTGACAGAGCTGCTGTTGGGTGTTGGTGTAAAGCCGGGAATGTAGTGTGGCGGTGATGCCCTAGATC(SEQ ID NO:26)

[0141] RNF219-AS1 (hg19_dna chr13:79170527-79170727)靶序列如下所示:

[0142] GGTGAGTGAACGAGAACCCTGAGTGAGTGAGGGGAGGGCGGGTCCCCTCCTGGCTTCAAATTCAACCCAATCAGCTCTGCCGATGGTTTGAAACTGCACACGCCGACCCACCCGCCCCGAAGTCTGAAAGTTATGCCCTGGAGACCTGCGAGCTGCGGAGTGCAGCTGGAGAGGGAGCTGCCCCACGAGGAGGCCTCCAGA(SEQ ID NO:27)

[0143] POU4F3 (hg19_dna chr5 145718555-145718741)靶序列如下所示:

[0144] GGCAGCGAGCGAGAGGGCGAGGGGAGCGCGGGCGCTGAGCAGCGCTCACTTGGAGAGCGGCAAGCAAGCTAGACAAGCCTGATTCCATGTCACCCGCTGCCACCCTGCCAGGAGCGCGAAGATGATGGCCATGAACTCCAAGCAGCCTTTCGGCATGCACCCGGTGCTGCAAGAACCCAAATTCTCC (SEQ ID NO: 28)

[0145] CADM1 The target sequence of (hg19_dna chr11 115375145-115375345) is as follows:

[0146] CTGCCTCCGGAGCCCGAGCGGACAGCTAATGAGATGCTAATGACATGCGCTGGAGGCGGAGTCCGGGCAGACCAATCACAGCGCCGCGAGCCCAACCCGGCTCTCGGAGGGCCTCGCTCCCTCCCCCACCCCGCCCCCTGGCGCTGGCGTTCGGCGGCGCGCCCGCGCCACCTAGGGGCGGGGCCAAGGGGAGGGGCGTAT (SEQ ID NO: 29)

[0147] RXFP3 The target sequence of (hg19_dna chr5 33936184-33936354) is as follows:

[0148] TCCTGGAGGTCAGTGGGTGTCTGCGTCTCTCCGCGGTTGTCAACTCCGGGTGGGTTGCCAGCGGCTCTCACCAGTTACGGTGGCACTTGCACGGCCAAGGCGGCGGGCCCCAAGGAGCATGCGTAATCCCGGGGCGCCGCGAGGGGCGCTTTCCGAGGTGCTGAACCCAGC (SEQ ID NO: 30)

[0149]

[0150] Note: In combination (4), the 5' end of CC-CADM1-P is modified with ATTO 425 and the 3' end is modified with BHQ-0; in combination (5), the 5' end of CC-CADM1-P is modified with ROX and the 3' end is modified with BHQ-2.

[0151] Table 6

[0152]

[0153] The results showed that compared with the combination (4) and combination (5) for the detection of the other five genes, the reagent combination provided by the present invention has the best detection sensitivity and AUC with CIN2+ or CIN3+ as the outcome variable. Therefore, the present invention finally determined LEPR、GABRA2、RNF219-AS1、ASCL1 and ZNF671 A combined detection system.

[0154] In particular, by comparing the reagent combination of the present invention with combinations (1)-(3), it can be seen that even for the same target gene, a better detection effect will be obtained by targeting a specific target segment.

[0155] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, various simple variations of the technical solution of the present invention may be made, including combining the various technical features in any other appropriate manner. These simple variations and combinations should also be regarded as the contents disclosed by the present invention and fall within the scope of protection of the present invention.

Claims

1. A reagent composition for cervical cancer detection, characterized in that: The reagent composition includes the following primer and probe combinations: (1) Detection LEPR Primers and probes for gene methylation levels: primers whose nucleotide sequences are shown in SEQ ID NOs: 7-8, and a probe whose nucleotide sequence is shown in SEQ ID NO: 9; (2) Detection GABRA2 Primers and probes for gene methylation levels: primers whose nucleotide sequences are shown in SEQ ID NOs: 10-11, and a probe whose nucleotide sequence is shown in SEQ ID NO: 12; (3) Detection RNF219-AS1 Primers and probes for gene methylation levels: primers whose nucleotide sequences are shown in SEQ ID NOs: 13-14, and a probe whose nucleotide sequence is shown in SEQ ID NO: 15; (4) Detection ASCL1 Primers and probes for gene methylation levels: primers with nucleotide sequences as shown in SEQ ID NOs: 16-17, and a probe with a nucleotide sequence as shown in SEQ ID NO: 18; (5) Detection ZNF671 Primers and probes for gene methylation levels: primers whose nucleotide sequences are shown in SEQ ID NOs: 19-20, and a probe whose nucleotide sequence is shown in SEQ ID NO:

21.

2. The reagent composition according to claim 1, characterized in that The probe is modified with a reporter group and / or a quencher group.

3. The reagent composition according to claim 2, characterized in that The 5' end of the probe is modified with a fluorescent reporter group, and the 3' end is modified with a fluorescent quencher group.

4. The reagent composition according to claim 1, characterized in that The reagent composition also includes a reagent for detecting an internal standard.

5. A kit for detecting cervical cancer, characterized in that: The kit comprises the reagent composition according to any one of claims 1 to 4.

6. The kit according to claim 5, characterized in that The kit further comprises at least one of an enzyme, a buffer, a magnesium source, and dNTPs.

7. Use of the reagent composition according to any one of claims 1 to 4 in preparing a kit for screening cervical cancer or cervical precancerous lesions.

8. Use of the kit according to claim 5 or 6 in the preparation of a kit for detecting cervical cancer or cervical precancerous lesions.

Images