Toxoplasma gondii CFAP gene deleted strain as well as construction method and application thereof

By constructing the CFAP gene deletion strain ME49△cfap of Toxoplasma gondii, the problem of lack of effective Toxoplasma gondii vaccine in the prior art was solved, and the effect of blocking Toxoplasma gondii transmission and improving immune protection was achieved.

CN120536244APending Publication Date: 2025-08-26HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510730445.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-03
Publication Date
2025-08-26

AI Technical Summary

Technical Problem

Currently, there is a lack of effective Toxoplasma gondii vaccine to block the spread of Toxoplasma gondii. The existing drugs have great side effects, and the economic losses and health risks caused by Toxoplasma infection are serious.

Method used

Toxoplasma gondii CFAP gene deletion strain ME49△cfap was constructed, and the formation of egg cysts was prevented by knocking out the CFAP gene specifically expressed in the male gamete stage, and a vaccine was prepared by genetic engineering methods.

Benefits of technology

Successfully blocked the transmission of Toxoplasma gondii in felines, showed good safety and immune protection, reduced the risk of ovarian cyst emissions, and had the potential to become a genetically engineered vaccine.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120536244A_ABST
    Figure CN120536244A_ABST
Patent Text Reader

Abstract

The invention discloses a toxoplasma gondii CFAP gene deleted strain as well as a construction method and application thereof. The toxoplasma gondii CFAP gene deleted strain ME49 cfu is prepared by taking a toxoplasma gondii strain ME49 as a parent strain and knocking out a CFAP gene in the toxoplasma gondii strain ME49; the nucleotide sequence of the CFAP gene is as shown in SEQ ID NO: 1. The strain ME49 cfap can be normally cultured in vitro, the polypide can normally grow and replicate, but the strain can induce the terminal host cat to generate immune protection force, inhibit the sexual reproduction of the toxoplasma gondii, reduce the oocyst discharge, and facilitate the reduction of the transmission risk of the toxoplasma gondii caused by the terminal host cat.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the fields of biology and genetic engineering, and in particular to a Toxoplasma gondii CFAP gene-deficient strain and a construction method and application thereof. Background Art

[0002] Toxoplasma gondii is an obligate intracellular parasite of the phylum Apicomplexa that infects all warm-blooded animals, including humans and agricultural animals such as pigs and sheep. It is a major zoonotic pathogen. Approximately one-third of the world's population is infected with Toxoplasma gondii. In immunocompromised individuals and pregnant women, Toxoplasma gondii can cause fatal acute toxoplasmosis, fetal malformations, or miscarriage. In livestock farming, Toxoplasma infection leads to miscarriage in pregnant animals and contaminated meat products, resulting in significant economic losses. Toxoplasmosis is a serious disease, and currently no vaccine is available in my country. Treatment options are limited and have significant side effects.

[0003] Toxoplasma gondii has a complex life cycle, involving sexual reproduction (oocyst formation) in the definitive host (felines) and asexual proliferation (tachyzoites and bradyzoites) in the intermediate host. Oocysts excreted in the feces of infected definitive cats contaminate the environment, becoming the primary source of infection for humans and other hosts and a key link in the spread of Toxoplasma. Blocking their formation and release is crucial for the prevention and control of toxoplasmosis. Given the unique characteristics of Toxoplasma transmission in cats, vaccination to prevent oocyst production is the most effective approach. However, currently, no cat vaccine is available worldwide that can block parasite transmission.

[0004] When cats are infected with Toxoplasma gondii, the parasite reproduces in their intestines through schizonts, producing merozoites. Some of these merozoites differentiate into male and female gametes, which fertilize to produce zygotes that then develop into oocysts. The CFAP gene is specifically expressed in the male gamete stage of Toxoplasma gondii and may be involved in male gamete development and oocyst formation. In light of this, the present invention constructed a knockout strain of this gene to investigate the impact of CFAP on oocyst production and the effectiveness of the CFAP-deficient strain as a vaccine to block the transmission of Toxoplasma gondii in cats. Summary of the Invention

[0005] The present invention aims to overcome the shortcomings of existing technologies and provides a Toxoplasma gondii CFAP gene-deficient strain, its construction method, and its application. Because the CFAP gene, specifically expressed in the male gamete stage of Toxoplasma, has been deleted, the CFAP gene-deficient Toxoplasma strain constructed in the present invention is incapable of producing oocysts in cats. This strain blocks the ability of felines to transmit Toxoplasma gondii and has the potential to be used as a genetically engineered vaccine for Toxoplasma gondii.

[0006] To achieve the above purpose, the technical solution designed by the present invention is as follows: The present invention provides a Toxoplasma gondii CFAP gene deleted strain ME49 △cfap , the insect strain ME49 △cfapThe Toxoplasma gondii strain ME49 was used as the parent strain, and the CFAP gene in the Toxoplasma gondii strain ME49 was knocked out; The nucleotide sequence of the CFAP gene is shown in SEQ ID NO: 1.

[0007] The present invention also provides a strain ME49 △cfap The construction method includes the following steps: (1) Collect Toxoplasma gondii ME49 tachyzoites and prepare parasite suspension using Cytomix buffer; (2) The CFAP-5UTR::DHFR::CFAP-3UTR homologous template and the pSAG1-Cas9-U6-sgCFAP plasmid were used as transfection DNA. The transfection DNA and the insect suspension were mixed and added to the electroporation cup for electroporation; (3) After electroporation, add insect culture medium for rinsing and transfer the liquid in the electroporation cup to the host cells for culture; (4) After the parasite escapes from the host cell, the cell is lysed to release the parasite, and the parasite is added to the host cell. 3-5 generations of drug screening are performed using pyrimethamine, and monoclonal parasite screening is performed. (5) After the monoclonal parasite appears, the host cells containing the monoclonal parasite are added to the host cells and culture is continued; (6) When the host cells are lysed, the monoclonal parasites in the host cells are used for DNA extraction and PCR identification. If the identification result is correct, the Toxoplasma gondii CFAP gene deletion strain ME49 is obtained. △cfap .

[0008] Furthermore, in the step (1), the amount of the insect body in the insect body suspension is 1×10 7 ~3.3×10 7 Tachyzoites / mL.

[0009] Furthermore, in step (2), the mass volume ratio of the transfection DNA to the parasite suspension is 1:25-30 μg / μL, and the molar ratio of the homologous template to the plasmid in the transfection DNA is 1:5.

[0010] Furthermore, in step (2), the preparation method of the pSAG1-Cas9-U6-sgCFAP plasmid is as follows: S1: Design the CFAP gene target site using the gRNA online design website, and design gRNA primers based on the designed target sequence; S2: PCR amplification was performed using Q5 high-fidelity DNA polymerase, gRNA primers, and plasmid pSAG1::CAS9-U6::sgUPRT, and the PCR amplification product was digested to obtain a digestion product; S3: The digestion product was reacted with KLD enzyme, and the reaction product was transformed into Escherichia coli DH5α competent cells for culture and screening to obtain the plasmid pSAG1-Cas9-U6-sgCFAP.

[0011] Furthermore, the gRNA primers are gRNA-CFAP-F and gRNA-R, and their nucleotide sequences are: gRNA-CFAP-F: 5'–TGTGGAACGGGGTATTTACCGTTTTAGAGCTAGAAATAGC–3'; gRNA-R is: 5'–AACTTGACATCCCCATTTAC–3'.

[0012] Furthermore, in step (2), the preparation method of the CFAP-5UTR::DHFR::CFAP-3UTR homologous template is as follows: 1) Using Toxoplasma gondii ME49 genomic DNA as a template, PCR amplification was performed using primers U5CFAP-F and U5CFAP-R to obtain the 5' homology arm fragment; 2) Using the genomic DNA of Toxoplasma gondii ME49 as a template, PCR amplification was performed using primers U3CFAP-F and U3CFAP-R to obtain the 3' homology arm fragment; 3) Using the pUC19 plasmid as a template, perform PCR amplification with primers pUC19-F and pUC19-R to obtain the pUC19 vector fragment; 4) Using the DHFR-containing plasmid as a template, PCR amplification was performed using primers loxP-DHFR-F and loxP-DHFR-R to obtain the DHFR fragment; 5) Ligate the 5' homology arm fragment, DHFR fragment, 3' homology arm fragment, and pUC19 vector fragment to generate plasmid pCFAP-5UTR::DHFR::CFAP-3UTR; 6) Using plasmid pCFAP-5UTR::DHFR::CFAP-3UTR as a template, PCR amplification was performed with primers U5CFAP-F and U3CFAP-R to obtain the CFAP-5UTR::DHFR::CFAP-3UTR homologous template.

[0013] Furthermore, the nucleotide sequence of the primer U5CFAP-F is: 5'-CGACTCACTATAGGGCGAATCGGGCTATGGTCAGCTAAAACCA-3'; The nucleotide sequence of primer U5CFAP-R is: 5'-ATGTCTTCTGCGCGGGTTGCTACTCAGAGGAGGCAGCGA-3'; The nucleotide sequence of primer U3CFAP-F is: 5'-GCCACAAGTTCAGCGTGTCCGAGTCATCGGCCAAGTAGGTG-3'; The nucleotide sequence of primer U3CFAP-R is: 5'-GCTATGACCATGATTACGCCGGCAATCGTAACTCGGCCA-3'; The nucleotide sequence of primer pUC19-F is: 5'–ATTCGCCCTATAGTGAGTCG–3'; The nucleotide sequence of primer pUC19-R is: 5'–ATTCGCCCTATAGTGAGTCG–3'; The nucleotide sequence of primer loxP-DHFR-F is: 5′-CAACCCGCGCAGAAGACATC-3′; The nucleotide sequence of primer loxP-DHFR-R is: 5′-GGACACGCTGAACTTGTGGC-3′.

[0014] Furthermore, the host cell is the host cell HFF-1; When the PCR identification result shows that the parasite DNA contains a 5' homology arm and a 3' homology arm, and does not contain the gene CFAP, the identification result is correct.

[0015] The present invention also provides a strain ME49 △cfap Application in preparing Toxoplasma gondii vaccine or improving cats' immunity to Toxoplasma gondii.

[0016] Beneficial effects of the present invention: 1. The present invention successfully constructed the Toxoplasma gondii CFAP gene deletion strain ME49 △cfap , ME49 △cfap Because the CFAP gene, which is specifically expressed in the male gamete stage of Toxoplasma gondii, has been knocked out, oocysts cannot be produced in cats. This has the ability to block the transmission of Toxoplasma gondii in cats and has the potential to become a genetically engineered vaccine for Toxoplasma gondii.

[0017] 2. The present invention carries out ME49 △cfap The virulence experiment showed that ME49 △cfapThe 30-day survival rates of mice inoculated with ME49 and mice inoculated with wild-type ME49 were 70% and 60%, respectively, indicating that the knockout of the Toxoplasma male gamete protein gene CFAP does not affect the virulence of tachyzoites to mice.

[0018] 3. The present invention carries out ME49 △cfap Safety studies on cats showed that vaccination with ME49 △cfap The cats did not experience adverse reactions such as persistent fever, depression and diarrhea, with a survival rate of 100% and no Toxoplasma gondii oocysts were discharged. △cfap It has good safety for cats and no risk of oocyst shedding.

[0019] 4. The present invention carries out ME49 △cfap The immune protection experiment on cats showed that ME49 vaccination △cfap The number of Toxoplasma gondii oocysts in the feces of cats immunized with ME49 was extremely low, only 0.04% of the number of Toxoplasma gondii oocysts in the feces of cats not immunized with ME49. △cfap It can provide cats with good protection against infection with wild-type strains, which helps reduce the risk of Toxoplasma gondii transmission caused by the release of oocysts by the final host (cat). BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a map of the pCFAP-5UTR::DHFR::CFAP-3UTR plasmid; Figure 2 Schematic diagram of the strategy for knocking out the Toxoplasma CFAP gene; Figure 3 For ME49 △cfap Figure 1. PCR identification results of monoclonal insect strains; Figure 4 For ME49 △cfap Figure 1 shows the results of toxicity experiments on mice; Figure 5 For ME49 △cfap Figure 3: Body temperature measurement results of immunized cats within 30 days; Figure 6 For ME49 △cfap Figure 3 shows the weight measurement results of immunized cats within 30 days; Figure 7 This is the statistical result of fecal oocysts in the immunized and control groups of cats within 20 days after PRU cyst infection. DETAILED DESCRIPTION

[0021] The present invention is further described in detail below with reference to specific embodiments so that those skilled in the art can understand.

[0022] Example 1 Toxoplasma gondii CFAP gene deletion strain ME49 △cfap Construction 1. Starting Toxoplasma gondii strain ME49 The Toxoplasma gondii strain ME49 used in the present invention is a type II strain of the genus Toxoplasma of the family Toxoplasma in the order Coccidia. The knocked-out gene CFAP is an ASH domain protein specifically expressed in the male gametocyte development stage, and its nucleotide sequence is shown in SEQ ID NO: 1.

[0023] 2. Construction of pSAG1-Cas9-U6-sgCFAP plasmid 1. Use the gRNA online design website (E-CRISP Design) to design the target gene CFAP targeting site, and design gRNA primers according to the designed target sequence. The primers are as follows: Upstream primer gRNA-CFAP-F: 5'–TGTGGAACGGGGTATTTACCGTTTTAGAGCTAGAAATAGC–3'; The downstream primer gRNA-R is: 5'–AACTTGACATCCCCATTTAC–3'.

[0024] 2. Prepare the PCR reaction system in a sterile PCR tube according to the parameters in Table 1, where the template DNA is the pSAG1::CAS9-U6::sgUPRT plasmid.

[0025] Table 1 PCR reaction system

[0026] 3. Perform PCR amplification according to the PCR reaction conditions in Table 2.

[0027] Table 2 PCR reaction conditions

[0028] 4. After PCR is completed, add 1 μL of DpnI directly to the PCR product and digest it in a PCR instrument at 37°C for 30 min to obtain the digestion product.

[0029] 5. Prepare a new sterilized PCR tube and prepare the KLD enzyme reaction system according to the parameters in Table 3. Incubate in a PCR instrument at 25°C for 15 minutes to obtain the reaction product.

[0030] Table 3 KLD enzyme reaction system

[0031] 6. Take all the reaction products and transform them into Escherichia coli DH5α competent cells, spread them on LB plates containing 100 μg / mL Amp, and invert and culture them at 37°C overnight to grow single colonies. Pick a single colony and place it in 5 mL of LB liquid culture medium containing 100 μg / mL Amp. Incubate the culture at 37°C / 180 rpm with shaking for 10-12 hours until the bacterial solution becomes turbid. Take 500 μL of the bacterial solution for sequencing analysis. The sequencing primer is the M13 reverse primer, and the sequence of the M13 reverse primer is: CAGGAAACAGCTATGAC. If the sequencing results show that the target sequence has been completely replaced, the plasmid pSAG1-Cas9-U6-sgCFAP is successfully constructed. Use the endotoxin-free plasmid extraction kit to extract the pSAG1-Cas9-U6-sgCFAP plasmid, determine the concentration, and set aside.

[0032] 3. Preparation of CFAP-5UTR::DHFR::CFAP-3UTR Homologous Template 1. Determine the locus of the gene to be knocked out, CFAP, based on its Gene ID, on ToxoDB. Determine the 5' homology arm (CFAP-5UTR) and 3' homology arm (CFAP-3UTR) based on the genomic sequence. 2. Design seamless ligation amplification primers for the 5' homology arm, 3' homology arm, DHFR drug screening tag, and pUC19 vector according to the method described in the instructions of the Multi-Fragment Seamless Ligation Kit; 3. Use the designed primers (as shown in Table 4) and high-fidelity enzyme (Phanta) to amplify the 5' homology arm and 3' homology arm fragments from the Toxoplasma gondii ME49 genomic DNA, and amplify the DHFR fragment from the plasmid containing DHFR (purchased from http: / / www.addgene.org). Use the designed specific primers to linearize the pUC19 vector fragment (purchased from http: / / www.addgene.org), and recover the above target fragments to obtain the 5' homology arm fragment, 3' homology arm fragment, DHFR fragment, and pUC19 vector fragment, respectively. The recovered product concentrations were determined using NanoDrop2000.

[0033] Table 4 Primers for plasmid construction

[0034] 4. Prepare the following reaction system according to the concentration of the recovered product: 5× CE MultiS Buffer: 2.0 μL; Exnase TMMultiS: 1.0 μL; CFAP-5UTR: 10 ng; CFAP-3UTR: 10 ng; DHFR: 30 ng; pUC19: 25 ng; add sterile deionized water (nuclease-free) to a total reaction volume of 10 μL. Mix thoroughly, react at 37°C for 30 min, and place on ice for 5 min to obtain the ligation product.

[0035] 5. Transform all 10 μL of ligation product into 100 μL of E. coli DH5α competent cells, spread on LB plates containing 100 μg / mL Amp, and invert and culture at 37°C overnight to grow single colonies; pick a single colony and place it in a sterile PV glass bottle containing 5 mL of LB liquid medium containing 100 μg / mL Amp, and shake culture at 37°C / 180 rpm for 10 h until the bacterial solution becomes turbid; use M13 forward primer and M13 reverse primer for sequencing analysis respectively. The sequence of M13 forward primer is GTAAAACGACGGCCAGT. If the sequencing result is correct, the plasmid pCFAP-5UTR::DHFR::CFAP-3UTR is successfully constructed. Then, the identified bacterial solution is used for plasmid extraction and stored at -20°C. The map of the correct plasmid is shown as follows. Figure 1 shown.

[0036] 6. Use high-fidelity enzyme to perform PCR amplification on the pCFAP-5UTR::DHFR::CFAP-3UTR plasmid. The amplification primers are U5CFAP-F upstream primer and U3CFAP-R downstream primer. The target fragment (CFAP-5UTR::DHFR::CFAP-3UTR) is excised and recovered by gel excision, and the concentration is measured and set aside to obtain the CFAP-5UTR::DHFR::CFAP-3UTR homologous template.

[0037] 4. Toxoplasma gondii CFAP gene deletion strain ME49 △cfap Acquisition 1. Collect fresh Toxoplasma gondii ME49 tachyzoites, filter through a sterile 3 μm pore size filter to remove host cell debris, and centrifuge at 1500 rpm for 10 min. Discard the supernatant and resuspend the parasite pellet in Cytomix buffer (120 mM KCl, 0.15 mM CaCl2, 10 mM K2HPO4 / KH2PO4, 25 mM HEPES, 2 mM EGTA, 5 mM MgCl2, pH = 7.6) to obtain a parasite suspension with a parasite weight of approximately 3.3 × 10 7 Tachyzoites / mL.

[0038] 2. Take 250-300 μL of the insect suspension into the electroporation cuvette, add the pSAG1-Cas9-U6-sgCFAP plasmid from step 2 and the CFAP-5UTR::DHFR::CFAP-3UTR homologous template from step 3 as the transfection DNA. The molar ratio of plasmid to homologous template DNA is 5:1, the total amount of transfection DNA is 10 μg, and the total volume of the electroporation reaction is 350 μL.

[0039] 3. Use a pipette to mix the transfected DNA and parasite suspension evenly in a 4 mm electroporation cuvette and remove bubbles. Place the cuvette in a Bio-Rad electroporator and set the conditions to 1600 V, 25 μF, 50 Ω, and 4 mm. Electroporate twice.

[0040] 4. Immediately add 1 mL of parasite culture medium (DMEM + 2% FBS + double antibodies, double antibodies are 100 μg / mL penicillin and 50 μg / mL streptomycin) to the electroporation cup and gently rinse. Then transfer the liquid to fresh host cells HFF-1 for culture (T25). At the same time, set up a control group ME49 without DNA transfection and culture and observe it at the same time.

[0041] 5. After 60-80% of the transfected parasites have escaped from the host HFF-1 cells, lyse the cells to release the parasites from the host cells. Add 500-2000 μL of parasites to fresh host HFF-1 cells (T25) and select with 1 μM pyrimethamine.

[0042] 6. After 3 days of pyrimethamine exposure, parasite proliferation can be observed within the host cells. When 50% of the parasites have escaped from the host cells, the cells are lysed to release the parasites. 500-1000 μL of parasites are added to fresh HFF-1 host cells and screened with 1 μM pyrimethamine.

[0043] 7. After 3 to 5 generations of drug screening, place the parasites in a 96-well plate containing host cells HFF-1 for monoclonal parasite screening (connect two 96-well plates) and inoculate two (calculated amount) tachyzoites per well; the remaining parasites can be used to extract genomic DNA and use the primers and Figure 2 The method shown is used to detect homology arm integration efficiency and gene knockout efficiency. The presence of a PCR1 band indicates that the 5' homology arm of CFAP has integrated into the Toxoplasma genome, and the presence of a PCR2 band indicates that the 3' homology arm of CFAP has integrated into the Toxoplasma genome. The PCR3 band detects whether the knocked-out gene CFAP is still in the genome. If the control group ME49 has a PCR3 band but the transfection experimental group does not, it means that CFAP has been successfully knocked out.

[0044] Table 5ME49 △cfapPCR primers for identification of monoclonal insect strains

[0045] 8. After 8-11 days of culture in a 96-well plate, observe for the presence of single clones. Use a sterile pipette to scrape the host cells containing the single clone from the well and add them to a 24-well plate containing HFF-1 host cells for continued culture. When 70% of the host cells in the 24-well plate have been lysed, transfer 150 μL of the parasites in the well to a new 24-well plate for culture. The remaining single clones are used for DNA extraction to identify clones.

[0046] 9. Use PCR1, PCR2 and PCR3 to detect the selected monoclonal parasites. If PCR1 and PCR2 have specific bands but PCR3 has no target bands, it means that the monoclonal parasite is the Toxoplasma gondii CFAP gene deletion strain ME49. △cfap ; will be determined as ME49 △cfap The insect strains were further expanded and cultured in T25 culture flasks; the gene-deficient insect strains in T25 culture flasks were again tested and verified by PCR1, PCR2 and PCR3.

[0047] The PCR reaction system was as follows: 2× Master Mix: 12.5 μL; 10 μM upstream primer: 2.0 μL; 10 μM downstream primer: 2.0 μL; insect DNA: 2.0 μL; sterile deionized water: 6.5 μL; total volume: 25 μL.

[0048] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min; 35 cycles of denaturation at 95°C for 30 sec, annealing at Tm-5°C for 30 sec, and extension at 72°C for 2 min; complete extension at 72°C for 10 min; and cooling at 15°C for 5 min.

[0049] 10. PCR product identification: After amplification, take 10 μL of PCR product, add 2 μL of 6× nucleic acid loading buffer, mix well, apply sample, and electrophoresis on 1.0% agarose gel, 1× TAE buffer, 110-120 V for 30 minutes. Observe with gel imaging system. The PCR identification results are as follows: Figure 3 As shown, this example successfully constructed the Toxoplasma gondii CFAP gene deletion strain ME49 △cfap .

[0050] Example 2 Toxoplasma gondii CFAP gene deleted strain ME49 △cfap Application 1. ME49 △cfap Diluted injection 1. Diluted injection formula: DMEM powder (Gibco, catalog number: 12800-17): 13.5 g; NaHCO3: 3.7 g; HEPES: 2.38 g; Add ultrapure H2O to a volume of 1 L.

[0051] 2. Preparation method of diluted injection The above ingredients were mixed with a magnetic stirrer for 5 min and sterilized by filtration with a 0.22 μm filter to obtain ME49. △cfap Dilute the injection solution.

[0052] 2. Toxoplasma gondii CFAP gene deletion strain ME49 △cfap Toxicity experiments in mice 1. Culture Toxoplasma gondii tachyzoites in vitro using HFF-1 cells. Wait until 30-50% of the parasites have escaped from the cells. Discard the culture medium in the original culture flask, wash away the escaped parasites and residual culture medium with PBS, and add fresh diluent without FBS.

[0053] 2. Scrape the cells with a disposable cell scraper. Repeatedly pipette the suspension 8-10 times with a 5 mL syringe to rupture the parasite vesicles and release the parasites. Purify the parasites by filtering through a sterile 3 μm pore size filter. Count and dilute the parasite suspension using a cell counting plate.

[0054] 3. Inoculate 7-week-old female KM mice intraperitoneally with 100 worms per mouse. Record the survival of the mice every day. Statistic the results after 30 days. Figure 4 As shown in the experimental results, it can be seen that ME49 △ cfap The survival rate of mice vaccinated with wild-type ME49 within 30 days was 70%, while that of mice vaccinated with wild-type ME49 within 30 days was 60%, indicating that the deletion of the male gamete protein gene CFAP of Toxoplasma gondii does not affect the virulence of tachyzoites to mice.

[0055] 3. Toxoplasma gondii CFAP gene deletion strain ME49 △cfap Safety tests on cats With 10 6 ME49 △cfap The infectious dose of tachyzoites per cat was administered subcutaneously in the neck of 3 cats (serological test for Toxoplasma gondii was negative). 21 days later, the immunized cats were boosted with 10 6 ME49 △cfap Tachyzoites were set as the immune group.

[0056] The body temperature and weight of the immunized cats were measured every 3 days. The feces of the immunized cats were collected every day and the survival rate was recorded. The feces of the experimental cats were then tested for the presence of Toxoplasma gondii oocysts using the saturated sucrose floatation method. The results were statistically analyzed after 30 days. The changes in body temperature and weight were as follows: Figure 5 and Figure 6 The results showed that immunization with ME49 △cfap After the cats were isolated, their body temperature rose (basically maintained within the normal range of 38.5-39.5°C), their weight increased, and no adverse reactions such as depression, vomiting, and diarrhea were found. The survival rate was 100%, and no Toxoplasma oocysts were discharged. △cfap It has good safety for cats and no risk of oocyst shedding.

[0057] 4. Toxoplasma gondii CFAP gene deletion strain ME49 △cfap Immunity protection experiment on cats With 10 6 ME49 △cfap The infectious dose of tachyzoites per cat was administered subcutaneously in the neck of three cats (serologically negative for Toxoplasma gondii). Five weeks after the first vaccination, unimmunized Toxoplasma-negative cats served as the control group. Toxoplasma gondii PRU cysts were orally administered to the immunized and control cats, with 800 cysts per cat, three per group.

[0058] Detect and record the number of Toxoplasma gondii oocysts per gram of feces (OPG) of the experimental cats for 20 days. Figure 7 As shown in the figure, the three cats in the control group released Toxoplasma gondii oocysts from 5 to 13 days after infection, with an average OPG of 8.8×10 5 Only one cat in the immunization group released Toxoplasma gondii oocysts on the 7th to 8th day after infection, and the average OPG per cat was 375, which was much lower than that of the control group. △cfap It can provide cats with good protection against infection with wild-type strains, help reduce the risk of Toxoplasma gondii transmission caused by the release of oocysts by the definitive host (cat), and has the potential to become a genetically engineered Toxoplasma vaccine.

[0059] Example 3 Toxoplasma gondii CFAP gene deletion strain ME49 △cfap Preparation of vaccines Collect fresh ME49 △cfap Tachyzoites were filtered through a sterile 3 μm pore size filter to remove host cell debris, centrifuged at 1500 rpm for 10 min, and the supernatant was discarded. The precipitate was resuspended to 10 μg / mL in D-hank's balanced salt solution. 6 Tachyzoites / mL can be used to obtain vaccine ME49 △cfap The vaccine is administered by subcutaneous injection into the neck of each cat.

[0060] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without inventiveness, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A Toxoplasma gondii CFAP gene-deficient strain ME49 △cfap , characterized in that: The insect strain ME49 △cfap The Toxoplasma gondii strain ME49 was used as the parent strain, and the CFAP gene in the Toxoplasma gondii strain ME49 was knocked out; The nucleotide sequence of the CFAP gene is shown in SEQ ID NO:

1.

2. The insect strain ME49 according to claim 1 △cfap The construction method is characterized by: The following steps are involved: (1) Collect Toxoplasma gondii ME49 tachyzoites and prepare parasite suspension using Cytomix buffer; (2) The CFAP-5UTR::DHFR::CFAP-3UTR homologous template and the pSAG1-Cas9-U6-sgCFAP plasmid were used as transfection DNA. The transfection DNA and the insect suspension were mixed and added to the electroporation cup for electroporation; (3) After electroporation, add insect culture medium for rinsing and transfer the liquid in the electroporation cup to the host cells for culture; (4) After the parasite escapes from the host cell, the cell is lysed to release the parasite, and the parasite is added to the host cell. 3-5 generations of drug screening are performed using pyrimethamine, and monoclonal parasite screening is performed. (5) After the monoclonal parasite appears, the host cells containing the monoclonal parasite are added to the host cells and culture is continued; (6) When the host cells are lysed, the monoclonal parasites in the host cells are used for DNA extraction and PCR identification. If the identification result is correct, the Toxoplasma gondii CFAP gene deletion strain ME49 is obtained. △cfap .

3. The construction method according to claim 2, wherein: In the step (1), the amount of the insect body in the insect body suspension is 1×10 7 ~3.3×10 7 Tachyzoites / mL.

4. The construction method according to claim 2, wherein: In the step (2), the mass volume ratio of the transfection DNA to the parasite suspension is 1:25-30 μg / μL, and the molar ratio of the homologous template to the plasmid in the transfection DNA is 1:

5.

5. The construction method according to claim 2, wherein: In step (2), the preparation method of the pSAG1-Cas9-U6-sgCFAP plasmid is as follows: S1: Design the CFAP gene target site using the gRNA online design website, and design gRNA primers based on the designed target sequence; S2: PCR amplification was performed using Q5 high-fidelity DNA polymerase, gRNA primers, and plasmid pSAG1::CAS9-U6::sgUPRT, and the PCR amplification product was digested to obtain a digestion product; S3: The digestion product was reacted with KLD enzyme, and the reaction product was transformed into Escherichia coli DH5α competent cells for culture and screening to obtain the plasmid pSAG1-Cas9-U6-sgCFAP.

6. The construction method according to claim 5, characterized in that: The gRNA primers are gRNA-CFAP-F and gRNA-R, and their nucleotide sequences are: gRNA-CFAP-F: 5'–TGTGGAACGGGGTATTTACCGTTTTAGAGCTAGAAATAGC–3'; gRNA-R is: 5'–AACTTGACATCCCCATTTAC–3'.

7. The construction method according to claim 2, wherein: In step (2), the preparation method of the CFAP-5UTR::DHFR::CFAP-3UTR homologous template is as follows: 1) Using Toxoplasma gondii ME49 genomic DNA as a template, PCR amplification was performed using primers U5CFAP-F and U5CFAP-R to obtain the 5' homology arm fragment; 2) Using the genomic DNA of Toxoplasma gondii ME49 as a template, PCR amplification was performed using primers U3CFAP-F and U3CFAP-R to obtain the 3' homology arm fragment; 3) Using the pUC19 plasmid as a template, perform PCR amplification with primers pUC19-F and pUC19-R to obtain the pUC19 vector fragment; 4) Using the DHFR-containing plasmid as a template, PCR amplification was performed using primers loxP-DHFR-F and loxP-DHFR-R to obtain the DHFR fragment; 5) Ligate the 5' homology arm fragment, DHFR fragment, 3' homology arm fragment, and pUC19 vector fragment to generate plasmid pCFAP-5UTR::DHFR::CFAP-3UTR; 6) Using plasmid pCFAP-5UTR::DHFR::CFAP-3UTR as a template, PCR amplification was performed with primers U5CFAP-F and U3CFAP-R to obtain the CFAP-5UTR::DHFR::CFAP-3UTR homologous template.

8. The construction method according to claim 7, wherein: The nucleotide sequence of the primer U5CFAP-F is: 5'-CGACTCACTATAGGGCGAATCGGGCTATGGTCAGCTAAAACCA-3'; The nucleotide sequence of primer U5CFAP-R is: 5'-ATGTCTTCTGCGCGGGTTGCTACTCAGAGGAGGCAGCGA-3'; The nucleotide sequence of primer U3CFAP-F is: 5'-GCCACAAGTTCAGCGTGTCCGAGTCATCGGCCAAGTAGGTG-3'; The nucleotide sequence of primer U3CFAP-R is: 5'-GCTATGACCATGATTACGCCGGCAATCGTAACTCGGCCA-3'; The nucleotide sequence of primer pUC19-F is: 5'–ATTCGCCCTATAGTGAGTCG–3'; The nucleotide sequence of primer pUC19-R is: 5'–ATTCGCCCTATAGTGAGTCG–3'; The nucleotide sequence of primer loxP-DHFR-F is: 5′-CAACCCGCGCAGAAGACATC-3′; The nucleotide sequence of primer loxP-DHFR-R is: 5′-GGACACGCTGAACTTGTGGC-3′.

9. The construction method according to claim 7, wherein: The host cell is the host cell HFF-1; When the PCR identification result shows that the parasite DNA contains a 5' homology arm and a 3' homology arm, and does not contain the gene CFAP, the identification result is correct.

10. The insect strain ME49 according to claim 1 △cfap Application in preparing Toxoplasma gondii vaccine or improving cats' immunity to Toxoplasma gondii.