Development and utilization of a corn kernel weight related trait SNP marker

Abstract

The present application provides a kind of corn kernel weight related trait SNP marker development and utilization, belongs to molecular breeding technical field.The present application provides a sequence comprising the SNP molecular marker related to corn kernel weight related trait, the sequence includes the nucleotide sequence of SEQ ID No.1, and there is C and T polymorphism at 94bp of the nucleotide sequence, and genotype effect analysis indicates that when the site is CC, the kernel hundred-grain weight of corn inbred line material is significantly higher than that when the site is TT.A SNP molecular marker closely linked to the corn hundred-grain weight trait is developed, which can be used in breeding to select corn kernel hundred-grain weight.The functional breeding marker developed by the present application for corn kernel hundred-grain weight trait can be used for assisted selection of corn kernel hundred-grain weight trait in molecular marker assisted breeding, and the genotype of single site only needs to be detected to select the hundred-grain weight trait of corn.

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding technology, specifically relating to the development and utilization of SNP markers for maize kernel weight correlation traits. Background Technology

[0002] As the most widely planted and highest-yielding grain crop in my country, maize is crucial to the country's food security. Grain weight is one of the important selective traits in high-yield maize breeding. Currently, maize breeding in my country is in a transitional stage from traditional phenotypic selection to bio-breeding. Developing molecular markers for assisted breeding selection can help accelerate the molecular breeding process. Molecular marker-assisted breeding, with its high efficiency, short cycle, and low cost, has become a routine breeding technology applied to maize breeding by international multinational seed companies.

[0003] Currently, molecular marker technology has been widely applied in maize breeding and selection. The development of molecular markers has gone through three stages: the first stage, represented by SSR markers as restriction fragment length polymorphism (RFLP) and amplified fragment length polymorphism (APLP) markers; the second stage, represented by SSR markers; and the third stage, represented by InDel and SNP markers. SNP markers, due to their high abundance, wide distribution, and ease of automated detection in the genome, are widely used in marker-assisted breeding, germplasm quality control, and variety protection.

[0004] Quantitative trait locus (QTL) mapping is widely used in plants and animals and has become the most common method for locating loci controlling target traits. Genome-wide association studies (GWAS) are an effective method for revealing the complex genetic basis of crop trait variation and have been widely applied to various crops. Maize has a high level of genetic diversity and contains rare alleles in its genome, making it very suitable for using GWAS to study the genetic structure of grain-related traits. Therefore, combining QTL and GWAS to elucidate the genetic basis of maize grain weight is of great significance for crop improvement. Summary of the Invention

[0005] This invention provides a method for developing and utilizing SNP markers for maize kernel weight-related traits, enabling breeding selection based on genotype detection at a single point to detect the weight of 100 maize kernels.

[0006] The present invention provides a sequence containing an SNP molecular marker related to the weight of maize kernels, the sequence comprising the nucleotide sequence shown in SEQ ID No. 1, and having C and T polymorphisms at 94 bp of the nucleotide sequence.

[0007] The present invention also provides a primer pair for amplifying the above sequence.

[0008] In a preferred embodiment of the present invention, the primer pair includes an upstream primer with nucleotide sequences as shown in SEQ ID No. 3 and a downstream primer with SEQ ID No. 4.

[0009] The present invention also provides an application of a substance that detects the above sequence in detecting or assisting in the detection of maize yield-related traits.

[0010] In a preferred embodiment of the present invention, the corn yield-related traits include the weight of 100 corn kernels.

[0011] In a preferred embodiment of the present invention, the substance comprises the primer pair described above.

[0012] The present invention also provides a method for detecting maize kernel weight-related traits, including using maize genomic DNA as a template, performing PCR amplification using the above primer pair, detecting the base type at 94bp of the amplification product, wherein the CC genotype of maize kernel weight-related traits is superior to the TT genotype.

[0013] In a preferred embodiment of the present invention, the PCR amplification program includes: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 60°C annealing for 15 s, 72°C extension for 60 s, 35 cycles; 72°C final extension for 5 min.

[0014] The present invention also provides an application of a substance for detecting the above sequence in molecular marker-assisted breeding.

[0015] The present invention also provides a method for maize breeding, including detecting the genotype of the parents according to the above method and selecting varieties with the CC genotype as parents for breeding; or selecting varieties or lines with the CC genotype when screening offspring.

[0016] Beneficial Effects: This invention provides a sequence containing an SNP molecular marker related to maize kernel weight, comprising the nucleotide sequence of SEQ ID No. 1, with C and T polymorphisms at 94 bp. Through map-based cloning, this invention identified a major-effect QTL on chromosome 1 of the maize genome, located between 19345489 bp and 61943737 bp. Combined with genome-wide association analysis, an SNP locus S1_52872374 significantly associated with the 100-kernel weight trait was identified within this QTL. Genotypic effect analysis showed that when this locus was CC, the 100-kernel weight of maize inbred lines was significantly higher than when it was TT. This invention develops an SNP molecular marker closely linked to the 100-kernel weight trait in maize, which can be used in breeding to select for maize kernel weight. This invention develops a functional breeding marker for the 100-kernel weight trait in maize. This marker assists in the selection of maize's 100-kernel weight trait in marker-assisted breeding, requiring only the detection of a single locus's genotype to select for this trait. The method described in this invention has the advantages of clear selection targets, early selection, and independence from environmental influences. Using genotype detection at a single locus for breeding selection of maize's 100-kernel weight trait can also be used in molecular aggregation breeding of maize. Attached Figure Description

[0017] Figure 1 Genetic map of the RIL population;

[0018] Figure 2 Result image of QTL localization;

[0019] Figure 3 A distribution map of SNP markers on the ten chromosomes;

[0020] Figure 4 This is a plot showing the weight distribution density of 100 grains in the associated population.

[0021] Figure 5 Manhattan plot analysis for GWAS;

[0022] Figure 6 The graph shows the results of the T-test for different isopleths of 100 grains. Detailed Implementation

[0023] The present invention provides a sequence containing an SNP molecular marker related to the weight of maize kernels, the sequence comprising the nucleotide sequence shown in SEQ ID No. 1, and having C and T polymorphisms at 94 bp of the nucleotide sequence.

[0024] This invention combines QTL mapping and GWAS to identify SNP sites that are significantly associated with maize 100-kernel weight, and develops breeding markers suitable for assisting in the selection of maize kernel 100-kernel weight. The SNP sites are located in the sequence shown in SEQ ID No. 1, and the 94th position of the sequence shown in SEQ ID No. 1 is a polymorphic site.

[0025] SEQ ID No. 1:

[0026] GGACGGATGGAAACGGAAGTATACGCATGACGGTCTTAATGCCTTTTACGAAGCAGCACTTTCAGAGGACGGGACGTAGCAGTACGCGTACCACCACAAGCGCCGGCGATCTCGTATCTGCAGAGCCGATCGCCATTTCCTCCATCGTACGTTTATACAAGGAGGAAGCGGCCGACACGTCACTTTGCCTTTCTTCATTTAATACAAACTCTTGCACGGGACA.

[0027] The present invention also provides a primer pair for amplifying the above sequence.

[0028] In a preferred embodiment of the present invention, the primer pair includes an upstream primer with the nucleotide sequence shown in SEQ ID No. 3: GGACGGATGGAAACGGAAGT, which has a Tm value of 60.04℃ and a GC content of 55%; and a downstream primer shown in SEQ ID No. 4: TGTCCCGTGCAAGAGTTTGT, which has a Tm value of 60.11℃ and a GC content of 50%.

[0029] The present invention also provides an application of a substance that detects the above sequence in detecting or assisting in the detection of maize yield-related traits.

[0030] In a preferred embodiment of the present invention, the substance used to detect the sequence described in SEQ ID No. 1 includes the primer pair described above, and the maize yield-related trait includes maize 100-kernel weight. Using the primer pair described in the present invention, 364 maize inbred lines were divided into two groups according to alleles TT and CC, wherein 330 maize inbred lines had the genotype CC, and 34 maize inbred lines had the genotype TT. A T-test was performed on the 100-kernel weight values ​​of the two groups, and the p-value was less than 2.22e-16, indicating that there was a difference in 100-kernel weight between the two groups. When the method of the present invention was used to detect CC at 94bp of the sequence described in SEQ ID No. 1, the maize material had a higher 100-kernel weight.

[0031] The present invention also provides a method for detecting maize kernel weight-related traits, including using maize genomic DNA as a template, performing PCR amplification using the above primer pair, detecting the base type at 94bp of the amplification product, wherein the CC genotype of maize kernel weight-related traits is superior to the TT genotype.

[0032] In a preferred embodiment of the present invention, the PCR amplification program includes: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 60°C annealing for 15 s, 72°C extension for 60 s, 35 cycles; 72°C final extension for 5 min.

[0033] The present invention also provides an application of a substance for detecting the above sequence in molecular marker-assisted breeding.

[0034] The primer pairs described in this invention can be used for breeding through molecular marker-assisted breeding, thereby cultivating or screening maize varieties with superior trait of 100-kernel weight.

[0035] The present invention also provides a method for maize breeding, including detecting the genotype of the parents according to the above method and selecting varieties with the CC genotype as parents for breeding; or selecting varieties or lines with the CC genotype when screening offspring.

[0036] To further illustrate the present invention, the development and utilization of a maize kernel-related trait SNP marker provided by the present invention will be described in detail below with reference to embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0037] Example 1

[0038] 1. QTL positioning of 100 kernels of corn

[0039] This invention constructs a recombinant inbred line (RIL) population of 363 individuals by hybridizing the maize inbred lines SPL01 and SPL02 (both published in the article Yu, D., Wang, H., Gu, W. et al. Genetic diversity and population structure of popcorn germplasm resources using genome-wide SNPs through genotyping-by-sequencing. Genet Resour Crop Evol 68, 2379-2389 (2021). https: / / doi.org / 10.1007 / s10722-021-01137-0) as parents and then self-pollinating for 6 generations.

[0040] The RIL population was planted at the Zhuangxing Base of the Shanghai Academy of Agricultural Sciences for three consecutive spring seasons in 2019, 2020, and 2021. A randomized experimental design was used, with each maize inbred line planted in two rows. Normal water, fertilizer, and field management were implemented, and self-pollination was performed. After the kernels matured, three uniformly growing plants were selected, and the 100-kernel weight was measured using an automatic seed analyzer. The BLUP value of the 100-kernel weight was calculated using Meta-R software based on three environments and three replicates.

[0041] The results showed that the minimum weight per 100 grains in the RIL population was 4.79g, the maximum was 8.59g, and the average was 6.90g. These results were used for subsequent QTL localization analysis.

[0042] Genotyping of inbred lines in the RIL population was performed using the GenoBaitsMaize 10K Panel genotyping chip developed by Shijiazhuang Borui Biotechnology Co., Ltd., yielding a total of 11,535 SNP loci. After filtering using the following criteria: deletion rate <5%, heterozygosity <20%, and minor allele frequency >0.05, 988 SNPs were retained. Genetic mapping was constructed using ASTMAP software. Figure 1 The total size of the genetic map was 2,966 cM, and the average genetic distance between SNP markers was 3.17 cM (Table 1).

[0043] Table 1. Statistical information on genetic maps

[0044] chromosome Genetic distance (cM) Number of SNPs Chr1 484.56 191 Chr2 364.28 95 Chr3 325.53 89 Chr4 316.89 129 Chr5 328.14 132 Chr6 208.90 48 Chr7 259.28 87 Chr8 252.42 68 Chr9 262.90 76 Chr10 163.14 73 total 2966.02 988

[0045] Using RQTL software for QTL localization, the marker S1_55391236 on chromosome 1 had the highest lod value of 5.17. The markers to its left and right were S1_19345489 (lod = 3.43) and 1_61943737 (lod = 3.4), respectively. Therefore, this QTL interval is between 19345489 bp and 61943737 bp on chromosome 1. Figure 2 ).

[0046] 2. Correlation analysis of the 100-kernel weight trait in maize

[0047] This invention uses 370 maize inbred lines collected independently (Table 2) as a basis to conduct a genome-wide association analysis (GWAS) of the 100-kernel weight trait in maize. First, fresh leaf DNA was extracted using the CTAB method; then, sequenced using simplified genome sequencing (SGS); finally, the sequences obtained from the sequencing were aligned to the B73v4 version of the genome using BWA software, repetitive sequences were extracted using picard software, and SNP sites were identified using the HaplotypeCaller module of GATK software. After obtaining the genotypes, quality filtering was performed using bcftools software. The filtering criteria included: 1) retaining biallelic SNP sites; 2) retaining SNP sites with a minor allele frequency greater than or equal to 0.05; and 3) removing SNP sites with a sample deletion rate greater than 0.05. After quality filtering, a total of 356,290 sites were retained. Figure 3 This is used for subsequent GWAS analysis.

[0048] Table 2370 maize inbred lines

[0049]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055] The association analysis population was planted at the Zhuangxing Base of the Shanghai Academy of Agricultural Sciences for three consecutive spring seasons in 2019, 2020, and 2021. A randomized experimental design was adopted, with each maize inbred line planted in two rows. Normal water, fertilizer, and field management were implemented, and self-pollination was performed. After the kernels matured, three plants with uniform growth were selected, and their 100-kernel weight was measured using an automatic seed testing instrument. The BLUP value of 100-kernel weight was calculated using Meta-R software based on three environments and three replicates. The results showed that the minimum 100-kernel weight in the population was 9.42 g, the maximum was 32.43 g, and the average was 21.17 g. Figure 4 ).

[0056] The threshold for GWAS results was determined using GEC software; the effective SNP count was 125,678, and the threshold for p was 7.96e-6. Genome-wide association analysis was performed using GEMMA software. Figure 5 A total of 10 SNPs were identified that were significantly associated with the 100-grain weight trait (Table 3).

[0057] Table 3 Information on SNPs that were significantly associated with 100-kernel weight.

[0058] chromosome Location Equivalent 1 Equivalence 2 p-value 1 52872374 T C 2.24E-06 2 227550516 T G 2.06E-06 2 227550540 A G 2.06E-06 2 227615906 A G 1.99E-06 2 228061899 A C 5.17E-06 2 229624549 G C 6.03E-06 3 39972604 T G 6.04E-06 4 18421118 G A 3.55E-06 7 168233075 A T 3.05E-06 9 111761280 G A 4.56E-06

[0059] The SNP marker located at 52872374 bp on chromosome 1 falls within the QTL mapping region. This invention designs primers for the S1_52872374 locus and applies them to marker-assisted breeding for the 100-kernel weight trait in maize. The 200 bp sequences before and after this locus are extracted, as shown in SEQ ID No. 2:

[0060] CCGGATTCAGCCGTAAGAGACAGTCAAATGGCACCGGGCCATAGATTGGTTAAAAAAAAAACCCTGCTAGTGATGTCTCATTTAGTACATCGGAGTCACTGACGACGGACGGATGGAAACGGAAGTATACGCATGACGGTCTTAATGCCTTTTACGAAGCAGCACTTTCAGAGGACGGGACGTAGCAGTACGCGTACCAC CACAAGCGCCGGCGATCTCGTATCTGCAGAGCCGATCGCCATTTCCTCCATCGTACGTTTACAAGGAGGAAGCGGCCGACACGTCACTTTGCCTTTCTTCTCATTTAATACAAACTCTTGCACGGGACATACTTGAACTGATGAATAACCCCCAATTGAGACATCCGTTTGCACTGCCCGTCCGGTTCGTTGCTAGT.

[0061] Primers were designed using NCBI's Primer-BLAST, and the primer sequences are shown in SEQ ID No. 3 and SEQ ID No. 4. The amplification product is shown in SEQ ID No. 1, and the site to be detected is located at position 94 of the amplification product sequence.

[0062] 3. Detection of the effect at the S1_52872374 site

[0063] Using the designed primer pairs SEQ ID No. 3 and SEQ ID No. 4, 364 maize inbred lines (6 of the 370 inbred lines were deletions) were divided into two groups according to alleles TT and CC. Of these, 330 maize inbred lines had the genotype CC, and 34 maize inbred lines had the genotype TT. A t-test was performed on the 100-kernel weights of the two groups, and the p-value was less than 2.22e-16, indicating that the difference in 100-kernel weight between the two groups was real. Figure 6When the S1_52872374 site is detected as CC using the method of the present invention, the kernels of the maize material have a higher 100-kernel weight.

[0064] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A sequence containing SNP molecular markers associated with the kernel weight trait of maize, characterized in that, The nucleotide sequence of the sequence is shown in SEQ ID No. 1, and C and T polymorphisms are present at 94 bp of the nucleotide sequence.

2. The application of a primer pair for detecting the sequence of claim 1 in detecting or assisting in the detection of maize 100-kernel weight and yield-related traits, characterized in that, The primer pair consists of an upstream primer with a nucleotide sequence as shown in SEQ ID No. 3 and a downstream primer as shown in SEQ ID No.

4.

3. A method for detecting the correlation trait of maize kernels, characterized in that, The method involves using maize genomic DNA as a template, performing PCR amplification with primer pairs, and detecting the base type at the 94th bp of the amplification product. The CC genotype is superior to the TT genotype in terms of maize kernel weight correlation. The primer pairs consist of an upstream primer with nucleotide sequences as shown in SEQ ID No. 3 and a downstream primer as shown in SEQ ID No.

4.

4. The method according to claim 3, characterized in that, The PCR amplification program includes: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 60 s, 35 cycles; 72℃ final extension for 5 min.

5. A method for breeding maize, characterized in that, This includes detecting the genotype of the parents according to the method described in claim 3 or 4, selecting varieties with the CC genotype as parents for breeding; or selecting varieties or lines with the CC genotype when screening offspring.

Images