Reagent combination for visually detecting novel muscovy duck parvovirus based on RPA-CRISPR / Cas12a and kit and application thereof

Through the RPA-CRISPR/Cas12a detection system, combined with the fluorescence method or the strip method, the problem of N-MDPV detection is solved and the dependence of precision instruments is achieved, and efficient, sensitive and specific N-MDPV detection is achieved.

CN120536633APending Publication Date: 2025-08-26INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510620930.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-14
Publication Date
2025-08-26

AI Technical Summary

Technical Problem

The detection methods of N-MDPV in the prior art are time-consuming, susceptible to cross-reaction interference, and rely on precision instruments, making it difficult to achieve efficient, sensitive and specific detection.

Method used

The RPA-CRISPR/Cas12a detection system was adopted to quickly enrich the target nucleic acids through RPA and use the dual cleavage activity of Cas12a to achieve signal amplification, and the results were interpreted in combination with fluorescence method or test strip method.

Benefits of technology

It realizes fast, simple, sensitive and specific N-MDPV detection on site, with short detection time, simple operation, high sensitivity, and can complete gene amplification and result interpretation within 35 minutes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120536633A_ABST
    Figure CN120536633A_ABST
Patent Text Reader

Abstract

The invention relates to a reagent combination for detecting N-MDPV based on RPA-CRISPR / Cas12a and a kit thereof. The reagent combination comprises a primer pair and crRNA, the primer pair is N-MDPV-VP3-RPA-F1 / R1, N-MDPV-VP3-RPA-F1 / R2, N-MDPV-VP3-RPA-F1 / R3, N-MDPV-VP3-RPA-F1, N-MDPV-VP3-RPA-R1, N-MDPV-VP3-RPA-R2 and N-MDPV-VP3-RPA-R3, and the sequence of the crRNA is as shown in SEQ ID NO: 1 to SEQ ID NO: 5. The invention also discloses a kit for detecting the crRNA. The RPA-CRISPR / Cas12a detection system of the primer pair and the crRNA provided by the invention has extremely high specificity and sensitivity, can accurately detect the N-MDPV on site, and is negative when being used for detecting other common waterfowl viruses.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of microbial detection, and specifically relates to a reagent combination, a kit and a detection method for RPA-CRISPR / Cas12a detection of a novel Muscovy duck parvovirus. Background Art

[0002] The novel Muscovy duck parvovirus (N-MDPV) differs significantly from Muscovy duck parvovirus (MDPV) in its genome, host range, antigenicity, and pathogenicity. The N-MDPV genome undergoes multiple homologous recombination events with a Muscovy duck-derived GPV strain and a goose parvovirus live vaccine strain. The virus infects not only Muscovy ducks but also semi-Muscovy ducks and white-tailed ducks. Its pathogenicity not only causes pathologies similar to those of classic Muscovy duck parvovirus but also causes short beaks and growth retardation in infected ducks, resulting in significant economic losses to my country's duck farming industry.

[0003] Recombinase Polymerase Isothermal Amplification (RPA) utilizes three core enzymes to achieve efficient nucleic acid amplification: recombinase binds to single-stranded nucleic acid primers to form a complex, single-stranded binding proteins stabilize the displaced DNA strands, and strand-displacing DNA polymerase catalyzes primer extension. This technology mimics the in vivo DNA replication mechanism and enables exponential amplification of target sequences at a constant temperature of 37°C-42°C. Due to its mild reaction conditions, lack of thermal cycling equipment, and rapid detection, RPA has been widely used in both primary and point-of-care testing for pathogens such as viruses, mycoplasmas, and bacteria.

[0004] The CRISPR-Cas12a system is derived from bacterial adaptive immunity. Its crRNA specifically recognizes double-stranded DNA targets containing a PAM sequence and cleaves the target sequence through cis-cleavage. Simultaneously, the activated Cas12a protein exhibits trans-cleavage activity, nonspecifically cleaving free single-stranded DNA probes. The separation of the fluorophore and quencher allows for visualization of the fluorescent signal. This property makes it a highly sensitive molecular diagnostic tool, particularly suitable for use with isothermal amplification techniques.

[0005] Current detection methods for N-MDPV have significant limitations: pathogen identification can take days, serological tests are susceptible to cross-reaction interference, and traditional PCR techniques rely on sophisticated instruments and are complex to operate. Given this, there is an urgent need to develop a detection system that integrates the efficient amplification of RPA with the precise identification of CRISPR-Cas12a. This system rapidly enriches target nucleic acids through RPA and then amplifies the signal using the dual cleavage activity of Cas12a. It combines portability, high sensitivity, and strong specificity, significantly improving on-site detection efficiency. Summary of the Invention

[0006] The purpose of the present invention is to overcome the shortcomings of the existing technology and propose a CRISPR / Cas12a reagent combination, kit and detection method for N-MDPV on-site detection, which can detect N-MDPV efficiently, sensitively and specifically.

[0007] The purpose of the present invention is achieved through the following technical solutions:

[0008] The present invention provides a crRNA for N-MDPV detection, the sequence of crRNA is as follows: UAAUUUCUACUAAGUGUAGAUGCUAAAGAUCCAUACAGAUCUG

[0009] On the other hand, the present invention provides a primer set for N-MDPV detection, the sequence of the primer set is as follows:

[0010]

[0011] After experimental verification, the present invention finally selected a reagent combination for detecting N-MDPV based on RPA-CRISPR / Cas12a, which includes a primer pair and crRNA;

[0012] The primer pair is any one of the three primer pairs: N-MDPV-VP3-RPA-F1 / N-MDPV-VP3-RPA-R1, N-MDPV-VP3-RPA-F1 / N-MDPV-VP3-RPA-R2, and N-MDPV-VP3-RPA-F1 / N-MDPV-VP3-RPA-R3;

[0013] The nucleotide sequences of primers N-MDPV-VP3-RPA-F1, N-MDPV-VP3-RPA-R1, N-MDPV-VP3-RPA-R2, and N-MDPV-VP3-RPA-R3 are: N-MDPV-VP3-RPA-F1: 5′-ACTCACACAGAAGCAGAGGCTTCCAGCATCC-3′ (SEQ ID NO: 1);

[0014] N-MDPV-VP3-RPA-R1: 5'-GGAGCTCTAGTAGTGTTTTGTTCATTCGTTA-3' (SEQ ID NO: 2);

[0015] N-MDPV-VP3-RPA-R2: 5'-CTGAACTCGTAGGAGCTCTAGTAGTGTTTTG-3' (SEQ ID NO: 3);

[0016] N-MDPV-VP3-RPA-R3: 5'-ATCAAGATCTGAACTCGTAGGAGCTCTAGTA-3' (SEQ ID NO: 4);

[0017] The nucleotide sequence of the crRNA is:

[0018] 5'-UAAUUUCUACUAAGUGUAGAUGCUAAAGAUCCAUACAGAUCUG-3'

[0019] (SEQ ID NO:5).

[0020] Preferably, the reagent combination for detecting N-MDPV based on RPA-CRISPR / Cas12a includes a primer pair N-MDPV-VP3-RPA-F1 / N-MDPV-VP3-RPA-R3 and crRNA.

[0021] The reagent combination for detecting N-MDPV based on RPA-CRISPR / Cas12a also includes an ssDNA probe, the nucleotide sequence of which is 5'-TTATT-3'

[0022] Both ends of the ssDNA probe are connected to a fluorescent group or biotin respectively, the fluorescent group is FAM or BHQ, and the biotin is Biotin.

[0023] The 5' end of the ssDNA probe is labeled with FAM and the 3' end is labeled with BHQ, that is, the ssDNA probe is 5'-FAM-TTATT-BHQ-3', and the ssDNA probe is mainly used in the fluorescence method; the 5' end of the ssDNA probe is labeled with FAM and the 3' end is labeled with Biotin, that is, the ssDNA probe is 5'-FAM-TTATT-Biotin-3', and the ssDNA probe is mainly used in the test strip method.

[0024] An RPA-CRISPR / Cas12a detection kit for detecting N-MDPV, comprising the reagent combination.

[0025] The RPA-CRISPR / Cas12a detection kit also includes a nucleic acid amplification reagent, a crRNA transcription reagent and a Cas12a enzyme.

[0026] The RPA-CRISPR / Cas12a detection kit, the nucleic acid amplification reagent is an RPA amplification reagent.

[0027] The RPA-CRISPR / Cas12a detection kit further includes an ssDNA probe, the nucleotide sequence of which is 5'-FAM-TTATT-BHQ-3'.

[0028] The use of the RPA-CRISPR / Cas12a detection kit as described in the non-diagnostic detection of N-MDPV.

[0029] The application comprises the following steps:

[0030] (1) Extracting DNA from the sample to be tested as template DNA;

[0031] (2) adding the template DNA obtained in step (1) to the RPA reaction system and mixing thoroughly, and performing a nucleic acid amplification reaction using a primer pair; the nucleic acid amplification reaction is a recombinase-mediated isothermal nucleic acid amplification reaction, including an RPA amplification reaction.

[0032] The RPA amplification system and RPA reaction conditions of the RPA amplification reaction are as follows:

[0033] RPA amplification system: Add 10 μL of Rehydration Buffer, 0.5 μL of each upstream and downstream primer in the primer pair (at a concentration of 20 μM), and 1 μL of a 200 ng / μL DNA template to an RPA reaction tube containing lyophilized enzyme powder. Finally, add 2 μL of Starter and 6 μL of ddH2O to make the total reaction volume 20 μL.

[0034] RPA reaction conditions: Mix the above RPA reaction system thoroughly and amplify at 37-42°C for 10-50 minutes;

[0035] Preferably, the RPA reaction conditions are 37-40° C. and amplification for 10-50 min, more preferably, the reaction temperature is 37° C. and the reaction time is 20 min.

[0036] (3) crRNA, ssDNA probe and Cas12a enzyme are mixed with the RPA product obtained in step (2) to perform Cas12a fluorescence detection reaction; wherein the Cas12a fluorescence detection reaction system is as follows:

[0037] The 20 μL reaction mixture contained 5 μL RPA product, 2 μL cleavage buffer, 1 μL 50 nM crRNA, 1 μL 200 nM LbCas12a, and 0.6 μL 4 μM ssDNA probe 5'-FAM-TTATT-BHQ-3', and 10.4 μL ddH2O was added;

[0038] The reaction conditions for Cas12a fluorescence detection are: incubation at 37°C for 15-75 minutes, fluorescence detection can be photographed under blue light, and the fluorescence signal can be detected by a microplate reader. Preferably, incubation at 37°C for 15 minutes and photographing under blue light.

[0039] The RPA product can also be used for Cas12a test strip detection reaction. In this case, the ssDNA probe is 5'-FAM-TTATT-Biotin-3', and the other components and dosages of the reaction mixture are the same as those of the fluorescence detection method.

[0040] The Cas12a test strip detection reaction conditions are: incubation at 37°C for 15-75 minutes, and the test strip detection can be interpreted according to the test line. Preferably, incubation at 37°C for 15 minutes.

[0041] Mix 2 μL of Cas12a reaction solution with 78 μL of dilution buffer, transfer to the sample well of the test strip, and read the result within 5 minutes. Using the "line elimination" test strip, the crRNA recognizes the RPA product, activating the Cas protein and cleaving the reporter to release the signal. If the test line shows no band (i.e., "line elimination"), while the control line shows a band, the result is considered positive. If both the T line and the C line show color, the result is considered negative.

[0042] In the present invention, recombinase polymerase amplification (RPA) is a commonly used isothermal amplification technique that uses recombinase, single-strand binding protein, and DNA polymerase to rapidly amplify nucleic acids at a constant temperature of 37°C. The recombinase in the RPA system is derived from T4 bacteriophage. In some embodiments of the present invention, commercially available RPA system nucleic acid amplification reagents can be used for the reaction.

[0043] In the present invention, CRISPR / Cas12a, as an emerging molecular biology tool, can be applied to rapid constant temperature detection of pathogens. Researchers have found that Cas12a can specifically identify and cut dsDNA targets containing PAM sequences under the guidance of crRNA, activate trans-cutting activity to cut non-target single-stranded DNA carrying fluorescent groups, and determine the results based on the generated fluorescent signal. The main features of this method are high efficiency and rapidity, simple operation, strong specificity and high sensitivity, and it is suitable for on-site detection. Using the test strip detection method, the results can be determined by directly observing the strips of the test strips with the naked eye. This method is suitable for grassroots use and does not require expensive laboratory instruments to detect.

[0044] Compared with the prior art, the advantages of the present invention are: the present invention provides an RPA-CRISPR / Cas12a detection system composed of a primer pair and crRNA, which has extremely high specificity and sensitivity, and can accurately detect N-MDPV on site, and is negative for other common waterfowl viruses; the detection method of the embodiment of the present invention uses RPA-CRISPR / Cas12a technology to complete efficient gene amplification and result interpretation within 35 minutes, and the RPA-CRISPR / Cas12a detection system established with the primer pair N-MDPV-VP3-RPA-F1 / N-MDPV-VP3-RPA-R3 and crRNA has a minimum detection limit of 3.0×10 0 The DNA of N-MDPV is detected at a rate of 100 copies / μL, which is time-saving, easy to operate, highly sensitive and easy to judge the results. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 This is RPA primer screening. Lanes 1, 2, and 3 represent the amplification products of the N-MDPV-VP3-RPA-F1 / R1, N-MDPV-VP3-RPA-F1 / R2, and N-MDPV-VP3-RPA-F1 / R3 primer sets, respectively. Lanes 4, 5, and 6 represent the control group using ddH2O as the template.

[0046] Figure 2 The PAM site in the conserved sequence of N-MDPV is TTTV, and V is G, A, and C.

[0047] Figure 3 The fluorescence detection results of the RPA-CRISPR / Cas12a detection system for different primer combinations and crRNA matching in Experimental Examples 1-4. Figure 3 A is the fluorescence signal detection results of Experimental Examples 1-3 and the control group with ddH2O as the template; Figure 3B is the fluorescence signal value measured by the reaction solution corresponding to Experimental Examples 1-3 and the control group using ddH2O as the template.

[0048] Figure 4 The fluorescence detection results of the RPA-CRISPR / Cas12a detection system with different concentrations of crRNA and Cas12a protein are shown in Figure 2. Figure 4 A is the fluorescence signal detection results of the RPA-CRISPR / Cas12a detection system with different concentrations of crRNA and Cas12a protein; Figure 4 B is the fluorescence signal value measured in the corresponding reaction solution.

[0049] Figure 5 The results of the sensitivity screening test of the RPA-CRISPR / Cas12a fluorescence detection system are as follows: Figure 5 A is a fluorescence photograph of the sensitivity screening test results of the RPA-CRISPR / Cas12a detection system. The template concentration was diluted to 1.3×10 11 -1.3×10 -1 copies / μL 13 concentration gradients were used for RPA reaction to detect sensitivity; Figure 5 B is the corresponding fluorescence signal value.

[0050] Figure 6 This is the specific detection result of the RPA-CRISPR / Cas12a fluorescence detection system. Figure 6 A is a fluorescence photograph. Figure 6 B is the corresponding fluorescence signal value measured.

[0051] Figure 7 This is the sensitivity test result of the RPA-CRISPR / Cas12a test strip method.

[0052] Figure 8 This is the specific detection result of the RPA-CRISPR / Cas12a test strip method.

[0053] Figure 9 This is a graph showing the detection results of the RPA-CRISPR / Cas12a test strip method and qPCR in Example 9. DETAILED DESCRIPTION

[0054] The following will clearly and completely describe the concept of the present invention and the technical effects produced in conjunction with the embodiments, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention. The test methods used in the embodiments are all conventional methods unless otherwise specified; the materials, reagents, etc. used, unless otherwise specified, can all be reagents and materials obtained from commercial channels.

[0055] Terminology: As used herein, the terms "comprising," "including," and "containing" are used interchangeably and include not only closed definitions but also semi-closed and open definitions. In other words, the terms encompass "consisting of" and "consisting essentially of." The term "crRNA" refers to CRISPR RNA.

[0056] Experimental methods in the following examples, where specific conditions are not specified, were performed according to conventional methods and conditions in the art or according to commercial product specifications. Reagents and raw materials not specified in the following examples are commercially available. Quantitative experiments in the following examples were performed in triplicate.

[0057] The present invention will be further described below with reference to specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods for which specific conditions are not specified in the following examples are generally based on conventional conditions or the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight. Primers and crRNA were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Lyophilized enzyme powder and RPA amplification reagent were purchased from the RPA amplification kit of Shenzhen Yizhi Biotech Co., Ltd.

[0058] Example 1: Determination of RPA primers

[0059] 1.1 Design and synthesis of RPA primers.

[0060] The complete genome sequences of representative N-MDPV isolated from 60 different countries and regions were downloaded from NCBI. The conserved sequence of the VP3 gene of N-MDPV was obtained as the target sequence using MegAlign software, as shown below (5'-3'):

[0061] ACTCACACAGAAGCAGAGGCTTCCAGCATCCCAGCCCAAAATATTTTAGGTTTAGCTAAAGATCCATACAGATCTGGCAGCACTGCAGCAGGAATAAATGATATTATGGTAACGGACGAGCAGGAAGTAGCACCTACAAACGGTGTAGGGTGGAAACCATATGGCAAGACTGTAACGAATGAACAAAACACTACTAGAGCTCCTACGAGTTCAGATCTTGATGTTCTTGGAGCTTTACCAGGAATGGTTT Based on the above sequence, three pairs of RPA primers were designed and synthesized (respectively:

[0062] N-MDPV-VP3-RPA-F1 / N-MDPV-VP3-RPA-R1 (abbreviated as

[0063] The primer sequences are shown in Table 1.

[0064] Table 1 RPA primers for detecting N-MDPV

[0065]

[0066] 1.2 Verification of RPA primer detection for N-MDPV.

[0067] The N-MDPV nucleic acid samples stored in this laboratory were used as templates, and negative controls were set up. RPA amplification was performed using the RPA primers listed in Table 1 above.

[0068] The RPA amplification system is as follows: add 10 μL of Rehydration Buffer, 0.5 μL of each upstream and downstream primer (20 μM) in the primer pair, and 1 μL of template (200 ng / ul) to the RPA reaction tube containing lyophilized enzyme powder. Finally, add 2 μL of Starter and 6 μL of ddH2O to a total reaction system of 20 μL.

[0069] RPA reaction conditions: Mix the above RPA reaction system thoroughly and amplify at 37°C for 20 minutes.

[0070] The purified amplified product and the DL 2000 DNA Marker for molecular labeling were electrophoresed in a 2% agarose gel at 120V for 30 minutes. Figure 1 As shown, the electrophoresis results showed that the three primer sets N-MDPV-VP3-RPA-F1 / R1, N-MDPV-VP3-RPA-F1 / R2, and N-MDPV-VP3-RPA-F1 / R3 could successfully amplify the target fragment, and the size was in line with expectations.

[0071] Example 2 crRNA design and RPA-CRISPR / Cas12a detection system establishment

[0072] 2.1 crRNA sequence design.

[0073] The crRNA sequence was designed based on the above three primer pairs and their amplification product sequences containing PAM sites (TTTV, V is G, A, C). Figure 2 The crRNA sequence is: 5'-UAAUUUCUACUAAGUGUAGAUGCUAAAGAUCCAUACAGAUCUG-3'

[0074] (SEQ ID NO:5).

[0075] The 5' end of the crRNA (UAAUUUCUACUAAGUGUAGAU) can form a hairpin structure recognized by Cas12a, followed by a 22bp linear target gene sequence, which can recognize the target gene and activate the nonspecific shearing activity of Cas12a to initiate the subsequent reaction.

[0076] 2.2 Primer pairs are preferably matched with crRNA.

[0077] Based on the primer amplification sequence as the target, the corresponding crRNA was selected for Cas12a reaction. The relationship between the primer pair and crRNA combination is shown in Table 2.

[0078] Table 2. Primer combinations and crRNA detection

[0079]

[0080] Table 2 lists the primer pairs and crRNA combinations used in Experimental Examples 1-3. Experimental Examples 1-3 with different combinations were subjected to RPA-CRISPR / Cas12a detection for preliminary screening and verification.

[0081] Among them, the RPA reaction system and reaction conditions are the same as in Example 1. The RPA product obtained by the RPA reaction is mixed with crRNA, ssDNA probe and Cas12a enzyme, respectively, and the Cas12a fluorescence detection reaction is performed.

[0082] The Cas12a fluorescence detection reaction system is as follows: a 20 μL reaction mixture contains 5 μL RPA product, 2 μL cleavage Buffer, 1 μL 50 nM crRNA, 1 μL 200 nM LbCas12a, and 0.6 μL 4 μM ssDNA probe. 10.4 μL ddH2O is added, incubated at 37 ° C for 15 minutes, and photographed under blue light.

[0083] The sequence of the ssDNA probe is 5'-FAM-TTATT-BHQ-3', and the 5' end of the ssDNA probe is labeled with 6-FAM and the 3' end is labeled with BHQ-1.

[0084] The results are as follows Figure 3 As shown in A, the combination of Experimental Examples 1, 2, and 3 can all enable the complex in the system to activate ssDNA cleavage and release fluorescent signals, thereby achieving rapid visual detection of N-MDPV.

[0085] like Figure 3 As shown in Figure B, obvious fluorescence can be observed in the combinations of Experimental Examples 1, 2, and 3. Among them, the fluorescence signal value measured by the detection reaction solution of Experimental Example 3 is higher than that of Experimental Examples 1 and 2, indicating that the fluorescence signal of Experimental Example 3 is the strongest.

[0086] Based on the above results, it can be seen that the combination of N-MDPV-VP3-RPA-F1 / R3 and crRNA is the best, which can enable the complex in the system to activate ssDNA cleavage, release fluorescent signals and test strip detection signals, and realize rapid visual detection of N-MDPV.

[0087] Example 4 Optimization of RPA-CRISPR / Cas12a concentration ratio

[0088] In order to achieve rapid detection of the RPA-CRISPR / Cas12a detection system, the concentrations of Cas12a and crRNA were optimized based on the above primer screening.

[0089] 1 μL (200 ng / μL) of the template was added to the RPA reaction system and mixed thoroughly. The RPA reaction was performed using the N-MDPV-VP3-RPA-F1 / R3 primer pair. The reaction system and reaction conditions were the same as in Example 1.

[0090] The results are as follows Figure 4 As shown, using the N-MDPV-VP3-RPA-F1 / R3 primer pair and crRNA detection system, the Cas protein concentration was 200 nmol / L and the crRNA was 50 nmol / L, and a strong fluorescence signal could still be detected, proving that this concentration can be used for N-MDPV detection.

[0091] Example 5 Sensitivity detection of RPA-CRISPR / Cas12a fluorescence detection system

[0092] Take N-MDPV nucleic acid sample as template. Dilute the template solution to 10 times the concentration and prepare 3.0×10 11 -3.0×10 0 copies / μL, 12 concentration gradients.

[0093] 1 μL of template was added to the RPA reaction system and mixed thoroughly. The RPA reaction was performed using the N-MDPV-VP3-RPA-F1 / R3 primer set. The reaction system and reaction conditions were the same as those in Example 1.

[0094] 5 μL RPA reaction product was added to the Cas12a fluorescence detection reaction system. The 20 μL reaction mixture contained 5 μL RPA product, 2 μL cleavage Buffer, 1 μL 50nM crRNA, 1 μL 200nM LbCas12a, 0.6 μL 4 μM single-stranded DNA (ssDNA probe) reporter probe and 10.4 μL ddH2O, incubated at 37 ° C for 15 minutes, photographed under blue light and measured the fluorescence signal value. The ssDNA probe is 5 `-FAM-TTATT-BHQ-3 '.

[0095] The results are as follows Figure 5 As shown in AB, the detection system was established using the N-MDPV-VP3-RPA-F1 / R3 primer pair and crRNA, with an initial template amount of 1.3×10 11 -1.3×10 0 The fluorescence signal can be detected at 10 copies / μL, so the minimum detection limit of this system is 1.3×10 0 This experiment proves that the N-MDPV-VP3-RPA-F1 / R3 primer pair and crRNA detection system of the present invention can achieve high-sensitivity visual detection of N-MDPV.

[0096] Example 6 Specificity of the RPA-CRISPR / Cas12a fluorescence detection system

[0097] DNA or RNA (reverse transcribed into DNA) was extracted from N-MDPV and eight other waterfowl viruses, including duck adenovirus type 3 (DAdV-3), avian adenovirus type 4 (AdV-4), duck astrovirus (DAstV), duck plague virus (DPV), duck hepatitis virus (DHV), duck circovirus (DuCV), duck Tembusu virus (DTMUV) and duck reovirus (DRV). Each viral DNA template was diluted to 200 ng / μL and amplified and detected using the RPA-CRISPR / Cas12a detection system established with the N-MDPV-VP3-RPA-F1 / R3 primer pair and crRNA. Blue light photography and fluorescence signal value measurement were performed to determine the specificity of the detection method.

[0098] like Figure 6 As shown in AB, using the N-MDPV-VP3-RPA-F1 / R3 primer pair and crRNA RPA-CRISPR / Cas12a detection system, only N-MDPV showed strong fluorescence and high fluorescence signal values, and no obvious strong fluorescence and fluorescence signal values ​​were detected for other viruses, proving that the detection method has good specificity for N-MDPV and can distinguish N-MDPV from other common waterfowl viruses.

[0099] Example 7 RPA-CRISPR / Cas12a test strip method sensitivity detection

[0100] Take N-MDPV nucleic acid sample as template to extract DNA. Dilute the template solution to 10 times the concentration and prepare 1.3×10 11 -1.3×10 0 copies / μL, 13 concentration gradients.

[0101] 1 μL of template was added to the RPA reaction system and mixed thoroughly. The RPA reaction was performed using the N-MDPV-VP3-RPA-F1 / R3 primer set. The reaction system and reaction conditions were the same as those in Example 1.

[0102] The Cas12a test strip adopts a chromatographic double antibody sandwich method, which can quickly and specifically detect the signal generated by the Cas protein cutting the reporter, and the test results are determined by observing the appearance of the band. The ssDNA probe of the Cas12a test strip detection reaction is 5'-FAM-TTATT-Biotin-3', and the other components and dosages of the reaction mixture are the same as in Example 5. The amplification products obtained above were detected separately using the test strips. The specific detection method is as follows: take 2 μL of the product of the Cas12a test strip detection reaction, add 78 μL of diluent, mix well, and drop into the sample well on the test strip, and read the test results within 5 minutes.

[0103] The results are as follows Figure 7As shown, the test strip detection system was established using the N-MDPV-VP3-RPA-F1 / R3 primer pair and crRNA, and the initial template amount was 1.3×10 11 -1.3×10 0 When the initial template amount was diluted to 1.3×10 -1 copies / μL, the detection line of the test strip is weakened, so the minimum detection limit of this system is 1.3×10 0 This experiment proves that the test strip detection system of the present invention has good sensitivity and can achieve high-sensitivity on-site detection of N-MDPV.

[0104] Example 8 RPA-CRISPR / Cas12a test strip method specific detection

[0105] DNA or RNA (reverse transcribed into DNA) of N-MDPV and eight other waterfowl viruses, DAdV-3, AdV-4, DAstV, DPV, DHV, DuCV, DTMUV and DRV, were taken, and each viral DNA template was diluted to 200 ng / μL. Amplification and detection were performed using the RPA-CRISPR / Cas12a test strip detection system established using the N-MDPV-VP3-RPA-F1 / R3 primer pair and crRNA. The test results were determined by test strip detection to determine the specificity of the detection method.

[0106] like Figure 8 As shown, using the RPA-CRISPR / Cas12a test strip system using the N-MDPV-VP3-RPA-F1 / R3 primer pair and crRNA, all test strips showed bands on the quality control line, indicating that the test strip is effective. On the test line, only the N-MDPV test case successfully "cleared"; clear bands were observed in the test cases of other viruses, demonstrating the high specificity of the test strip detection method and its ability to effectively distinguish N-MDPV from several other common waterfowl viruses.

[0107] Example 9: Detection of N-MDPV Clinical Samples by RPA-CRISPR / Cas12a Detection System

[0108] In order to verify the reliability of the RPA-CRISPR / Cas12a test strip method established by the N-MDPV-VP3-RPA-F1 / R3 primer pair and crRNA of the present invention, the RPA-CRISPR / Cas12a test strip method established by the present invention was used to detect 98 sample nucleic acids. The detection results of the RPA-CRISPR / Cas12a test strip method are shown in FIG. Figure 9, 51 of the samples tested were positive and 47 were negative, while fluorescent quantitative PCR detected 52 positive and 46 negative samples, with a concordance rate of 98.98%. A comparison of CRISPR and fluorescent PCR test results is shown in Table 3.

[0109] Table 3. Comparison of the consistency of CRISPR and fluorescent PCR detection results of DAdV-3

[0110]

[0111] From the above results, it can be seen that the RPA-CRISPR / Cas12a detection system established using the N-MDPV-VP3-RPA-F1 / R3 primer pair and crRNA of the present invention can achieve high specificity, high sensitivity and visual detection of N-MDPV positive samples, which is of great value to the detection and prevention of N-MDPV diseases.

[0112] While the embodiments of the present invention have been described in detail above with reference to the accompanying drawings, the present invention is not limited to the embodiments described above. Various modifications may be made within the scope of knowledge possessed by a person skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof may be combined with one another unless there is a conflict.

Claims

1. A reagent combination for detecting a novel Muscovy duck parvovirus based on RPA-CRISPR / Cas12a, characterized by: It includes primer pairs and crRNA; The primer pair is any one of the three primer pairs: N-MDPV-VP3-RPA-F1 / N-MDPV-VP3-RPA-R1, N-MDPV-VP3-RPA-F1 / N-MDPV-VP3-RPA-R2, and N-MDPV-VP3-RPA-F1 / N-MDPV-VP3-RPA-R3; The nucleotide sequences of primers N-MDPV-VP3-RPA-F1, N-MDPV-VP3-RPA-R1, N-MDPV-VP3-RPA-R2, and N-MDPV-VP3-RPA-R3 are: N-MDPV-VP3-RPA-F1: 5'-ACTCACACAGAAGCAGAGGCTTCCAGCATCC-3'; N-MDPV-VP3-RPA-R1: 5'-GGAGCTCTAGTAGTGTTTTGTTCATTCGTTA-3'; N-MDPV-VP3-RPA-R2: 5'-CTGAACTCGTAGGAGCTCTAGTAGTGTTTTG-3'; N-MDPV-VP3-RPA-R3: 5'-ATCAAGATCTGAACTCGTAGGAGCTCTAGTA-3'; The nucleotide sequence of the crRNA is: 5'-UAAUUUCUACUAAGUGUAGAUGCUAAAGAUCCAUACAGAUCUG-3'.

2. The reagent combination for detecting the novel Muscovy duck parvovirus based on RPA-CRISPR / Cas12a according to claim 1, characterized in that: It includes the primer pair N-MDPV-VP3-RPA-F1 / N-MDPV-VP3-RPA-R3 and crRNA.

3. The reagent combination for detecting the novel Muscovy duck parvovirus based on RPA-CRISPR / Cas12a according to claim 1 or 2, characterized in that: It also includes a ssDNA probe, the nucleotide sequence of the ssDNA probe being 5'-TTATT-3'.

4. The reagent combination for detecting the novel Muscovy duck parvovirus based on RPA-CRISPR / Cas12a according to claim 3, characterized in that: The 5' end of the ssDNA probe is labeled with FAM and the 3' end is labeled with BHQ, or the 5' end of the ssDNA probe is labeled with FAM and the 3' end is labeled with Biotin.

5. An RPA-CRISPR / Cas12a detection kit for detecting a novel Muscovy duck parvovirus, characterized in that: It comprises the reagent combination as claimed in claim 1.

6. The RPA-CRISPR / Cas12a detection kit according to claim 5, characterized in that: It also includes nucleic acid amplification reagents, crRNA transcription reagents and Cas12a enzyme.

7. The RPA-CRISPR / Cas12a detection kit according to claim 6, characterized in that: The nucleic acid amplification reagent is an RPA amplification reagent.

8. The RPA-CRISPR / Cas12a detection kit according to claim 5 or 6, characterized in that: It also includes a ssDNA probe, the nucleotide sequence of which is 5'-FAM-TTATT-BHQ-3'.

9. Use of the RPA-CRISPR / Cas12a detection kit as claimed in claim 8 in the non-diagnostic detection of novel Muscovy duck parvovirus.

10. The use according to claim 9, characterized in that: The following steps are involved: (1) Extracting DNA from the sample to be tested as template DNA; (2) adding the template DNA obtained in step (1) to the RPA reaction system and mixing thoroughly, and performing a nucleic acid amplification reaction using a primer pair; the nucleic acid amplification reaction is a recombinase-mediated isothermal nucleic acid amplification reaction, including an RPA amplification reaction; The RPA amplification system and RPA reaction conditions of the RPA amplification reaction are as follows: RPA amplification system: Add 10 μL of Rehydration Buffer, 0.5 μL of each upstream and downstream primer in the primer pair (at a concentration of 20 μM), and 1 μL of a 200 ng / μL DNA template to an RPA reaction tube containing lyophilized enzyme powder. Finally, add 2 μL of Starter and 6 μL of ddH2O to make the total reaction volume 20 μL. RPA reaction conditions: Mix the above RPA reaction system thoroughly and amplify at 37-42°C for 10-50 minutes; (3) crRNA, ssDNA probe and Cas12a enzyme are mixed with the RPA product obtained in step (2) to perform Cas12a fluorescence detection reaction; wherein the Cas12a fluorescence detection reaction system is as follows: The 20 μL reaction mixture contained 5 μL RPA product, 2 μL cleavage buffer, 1 μL 50 nM crRNA, 1 μL 200 nM LbCas12a, and 0.6 μL 4 μM ssDNA probe 5'-FAM-TTATT-BHQ-3', and 10.4 μL ddH2O was added; The reaction conditions for Cas12a fluorescence detection are: incubation at 37°C for 15-75 minutes. Fluorescence detection can be photographed under blue light, and the fluorescence signal can be detected by a microplate reader.