Antibodies against baFF protein and use thereof

Abstract

The application relates to the technical field of biomedicine, in particular to an antibody pair against BAFF protein and application thereof. The antibody pair comprises two monoclonal antibodies; the monoclonal antibodies comprise a heavy chain variable region and a light chain variable region; one of the monoclonal antibodies in the monoclonal antibody pair is named as 6F10 antibody, and the other monoclonal antibody is named as 2F2 antibody. Wherein, the 6F10 antibody serves as a capture antibody, and the 2F2 antibody serves as a labeling antibody. The results of the embodiment of the application show that the antibody pair can be used to monitor the BAFF level of a patient, and further detect the graft rejection of the body, thereby providing strong support for clinical diagnosis and treatment.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to an antibody pair against BAFF protein and its application. Background Technology

[0002] B cell activating factor (BAFF), also known as BLS, TALL-1, THANK, or TNFSF13B, is a ligand belonging to the tumor necrosis factor (TNF) family and plays a crucial role in the development and survival of B cell lines. BAFF can form a homotrimer or a heterodimer by binding to the related protein APRIL. It is produced by various hematopoietic cells, and its soluble form can be released by activated neutrophils.

[0003] BAFF is first synthesized and localized on the cell membrane, then treated with furin hydrolase to form soluble BAFF (sBAFF). sBAFF, in trimer or multimer form, binds to the BAFF receptor (BAFF-R), transmembrane activator, and calcium-modulating cyclophilin ligand interactor (TACI), and B cell maturation antigen (BCMA) receptor on the target cell membrane, regulating downstream signaling pathways and promoting B cell survival, proliferation, antigen presentation, and B cell differentiation into plasma cells. Mice overexpressing BAFF exhibit increased B cell numbers, affect the formation and size of germinal centers, and induce autoimmune symptoms. Furthermore, BAFF can stimulate T cell differentiation into Th1 cells and promote the increase of Treg cells. Studies have shown that elevated BAFF levels may exacerbate many autoimmune diseases; therefore, BAFF is considered a potential therapeutic target for autoimmune diseases.

[0004] Multiple studies have shown that patients who develop graft-versus-host disease (GVHD) after hematopoietic stem cell transplantation (HSCT) have significantly higher BAFF levels than controls. In solid organ transplantation, BAFF can serve as a predictor of graft rejection risk; preoperative BAFF levels are significantly higher in pre-sensitized kidney transplant patients than in non-sensitized patients, and BAFF levels are significantly negatively correlated with graft survival. A meta-analysis of nine clinical studies involving 1302 kidney transplant patients found that the incidence of antibody-mediated rejection (ABMR) was significantly higher in the high BAFF group than in the low BAFF group. Studies on Chinese patients have also shown the same trend, with BAFF levels exhibiting dynamic changes. A predictive model based on the maximum rate of change in BAFF reaching its peak within one week to three months post-transplantation can effectively predict the occurrence of DSA and ABMR. By detecting the patient's BAFF level, graft rejection can be monitored.

[0005] Therefore, there is an urgent need to develop a substance that can detect BAFF levels, providing valuable support for clinical diagnosis and treatment. Summary of the Invention

[0006] The purpose of this invention is to provide an antibody pair against BAFF protein and its application. The antibody pair provided by this invention can specifically bind to BAFF protein, thereby realizing the quantitative detection of BAFF protein expression level.

[0007] To achieve the above objectives, the present invention provides the following technical solution:

[0008] This invention provides an antibody pair against BAFF protein, the antibody pair comprising two monoclonal antibodies; the monoclonal antibodies comprising a heavy chain variable region and a light chain variable region; the heavy chain variable region comprising heavy chain HCDR1, heavy chain HCDR2, and heavy chain HCDR3; the light chain variable region comprising light chain LCDR1, light chain LCDR2, and light chain LCDR3.

[0009] One of the monoclonal antibodies in the antibody pair is the 2F2 antibody, and the sequence information of the 2F2 antibody is as follows:

[0010] The amino acid sequence of the heavy chain HCDR1 is shown in SEQ ID NO.1;

[0011] The amino acid sequence of the heavy chain HCDR2 is shown in SEQ ID NO.2;

[0012] The amino acid sequence of the heavy chain HCDR3 is shown in SEQ ID NO.3;

[0013] The amino acid sequence of the light chain LCDR1 is shown in SEQ ID NO.4;

[0014] The amino acid sequence of the light chain LCDR2 is shown in SEQ ID NO.5;

[0015] The amino acid sequence of the light chain LCDR3 is shown in SEQ ID NO.6;

[0016] The other monoclonal antibody in the antibody pair is the 6F10 antibody, and the sequence information of the 6F10 antibody is as follows:

[0017] The amino acid sequence of the heavy chain HCDR1 is shown in SEQ ID NO.7;

[0018] The amino acid sequence of the heavy chain HCDR2 is shown in SEQ ID NO.8;

[0019] The amino acid sequence of the heavy chain HCDR3 is shown in SEQ ID NO.9;

[0020] The amino acid sequence of the light chain LCDR1 is shown in SEQ ID NO.10;

[0021] The amino acid sequence of the light chain LCDR2 is shown in SEQ ID NO.11;

[0022] The amino acid sequence of the light chain LCDR3 is shown in SEQ ID NO.12.

[0023] Preferably, the amino acid sequence of the heavy chain of the 2F2 antibody is shown in SEQ ID NO.13; the amino acid sequence of the light chain of the 2F2 antibody is shown in SEQ ID NO.14; the amino acid sequence of the heavy chain of the 6F10 antibody is shown in SEQ ID NO.15; and the amino acid sequence of the light chain of the 6F10 antibody is shown in SEQ ID NO.16.

[0024] The present invention also provides a nucleotide molecule that encodes the amino acid sequence of the above-mentioned 2F2 antibody or 6F10 antibody.

[0025] Preferably, the nucleotide molecule encoding the 2F2 antibody heavy chain sequence is shown in SEQ ID NO.17; the nucleotide molecule encoding the 2F2 antibody light chain sequence is shown in SEQ ID NO.18; the nucleotide molecule encoding the 6F10 antibody heavy chain sequence is shown in SEQ ID NO.19; and the nucleotide molecule encoding the 6F10 antibody light chain sequence is shown in SEQ ID NO.20.

[0026] The present invention also provides a biomaterial, said biomaterial comprising one of the following substances:

[0027] (1) A nucleotide molecule encoding the amino acid sequence of a 2F2 antibody or a 6F10 antibody;

[0028] (2) A carrier containing the nucleotide molecule described in (1);

[0029] (3) A host cell containing the nucleotide molecule of (1) and / or the vector of (2) or transformed or transfected by the nucleotide molecule of (1) and / or the vector of (2).

[0030] Preferably, the vector is a vector plasmid, bacteriophage vector, viral vector, or artificial chromosome vector.

[0031] Preferably, the host cell is a microbial cell, an insect cell, or a non-insect animal cell.

[0032] The present invention also provides a kit for detecting BAFF protein, the kit comprising the antibody pair described above.

[0033] Preferably, the 2F2 antibody is a labeled antibody, and the 6F10 antibody is a capture antibody.

[0034] This invention also provides the application of the above-mentioned antibody pair in the preparation of reagents for detecting BAFF protein.

[0035] The beneficial effects of this invention are:

[0036] The anti-BAFF protein antibody pair provided by this invention, with 6F10 antibody and 2F2 antibody serving as the capture antibody and labeling antibody respectively, exhibits high specificity and good sensitivity for BAFF protein. This antibody pair enables quantitative detection of BAFF protein, thereby monitoring graft rejection and providing strong support for clinical diagnosis and treatment. Attached Figure Description

[0037] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0038] Figure 1 The binding curves of antibodies 2F2 and 6F10 against human BAFF protein to BAFF are shown.

[0039] Figure 2 The pairing results of antibodies 2F2 and 6F10 against human BAFF protein are shown in the figure.

[0040] Figure 3 This is a standard curve for BAFF protein detection. Detailed Implementation

[0041] This invention provides an antibody pair against BAFF protein, using 6F10 antibody as a capture antibody and 2F2 antibody as a labeling antibody, enabling quantitative detection of BAFF protein. The antibody pair against BAFF protein is a highly sensitive monoclonal antibody targeting BAFF protein.

[0042] In a first aspect, this application provides an antibody pair against BAFF protein, employing the following technical solution:

[0043] An antibody pair against BAFF protein, the antibody pair comprising two monoclonal antibodies; the monoclonal antibodies comprising a heavy chain variable region and a light chain variable region; the heavy chain variable region comprising heavy chain HCDR1, heavy chain HCDR2 and heavy chain HCDR3; the light chain variable region comprising light chain LCDR1, light chain LCDR2 and light chain LCDR3;

[0044] One of the monoclonal antibodies in the antibody pair is named antibody 2F2, and the sequence information of antibody 2F2 is as follows:

[0045] The heavy chain HCDR1 comprises the amino acid sequence shown in SEQ ID NO.1, or an amino acid sequence having one or two conserved amino acid substitutions compared to the sequence shown in SEQ ID NO.1, or an amino acid sequence containing the above sequence;

[0046] The heavy chain HCDR2 comprises an amino acid sequence as shown in SEQ ID NO.2, or an amino acid sequence having one or two conserved amino acid substitutions compared to the sequence shown in SEQ ID NO.2, or an amino acid sequence containing the above sequence;

[0047] The heavy chain HCDR3 comprises an amino acid sequence as shown in SEQ ID NO.3, or an amino acid sequence having one or two conserved amino acid substitutions compared to the sequence shown in SEQ ID NO.3, or an amino acid sequence containing the above sequence;

[0048] The light chain LCDR1 comprises an amino acid sequence as shown in SEQ ID NO.4, or an amino acid sequence having one or two conserved amino acid substitutions compared to the sequence shown in SEQ ID NO.4, or an amino acid sequence containing the above sequence;

[0049] The light chain LCDR2 comprises an amino acid sequence as shown in SEQ ID NO.5, or an amino acid sequence having one or two conserved amino acid substitutions compared to the sequence shown in SEQ ID NO.5, or an amino acid sequence containing the above sequence;

[0050] The light chain LCDR3 comprises an amino acid sequence as shown in SEQ ID NO.6, or an amino acid sequence having one or two conserved amino acid substitutions compared to the sequence shown in SEQ ID NO.6, or an amino acid sequence containing the above sequence;

[0051] The other monoclonal antibody in the antibody pair is named 6F10 antibody, and the sequence information of 6F10 antibody is as follows:

[0052] The heavy chain HCDR1 comprises the amino acid sequence shown in SEQ ID NO.7, or an amino acid sequence having one or two conserved amino acid substitutions compared to the sequence shown in SEQ ID NO.7, or an amino acid sequence containing the above sequence.

[0053] The heavy chain HCDR2 comprises an amino acid sequence as shown in SEQ ID NO.8, or an amino acid sequence having one or two conserved amino acid substitutions compared to the sequence shown in SEQ ID NO.8, or an amino acid sequence containing the above sequence;

[0054] The heavy chain HCDR3 comprises an amino acid sequence as shown in SEQ ID NO.9, or an amino acid sequence having one or two conserved amino acid substitutions compared to the sequence shown in SEQ ID NO.9, or an amino acid sequence containing the above sequence.

[0055] The light chain LCDR1 comprises an amino acid sequence as shown in SEQ ID NO.10, or an amino acid sequence having one or two conserved amino acid substitutions compared to the sequence shown in SEQ ID NO.10, or an amino acid sequence containing the above sequence;

[0056] The light chain LCDR2 comprises an amino acid sequence as shown in SEQ ID NO.11, or an amino acid sequence having one or two conserved amino acid substitutions compared to the sequence shown in SEQ ID NO.11, or an amino acid sequence containing the above sequence;

[0057] The light chain LCDR3 comprises an amino acid sequence as shown in SEQ ID NO.12, or an amino acid sequence having one or two conserved amino acid substitutions compared to the sequence shown in SEQ ID NO.12, or an amino acid sequence containing the above sequence.

[0058] In some alternative embodiments, the antibody pair comprises a heavy chain variable region and a light chain variable region; wherein:

[0059] The heavy chain sequence of the 2F2 antibody includes the amino acid sequence shown in SEQ ID NO. 13; the light chain sequence of the 2F2 antibody includes the amino acid sequence shown in SEQ ID NO. 14. The heavy chain sequence of the 6F10 antibody includes the amino acid sequence shown in SEQ ID NO. 15; the light chain sequence of the 6F10 antibody includes the amino acid sequence shown in SEQ ID NO. 16.

[0060] The antibody pair described in this application comprises at least a heavy chain variable region and a light chain variable region, both of which contain the aforementioned complementarity determining region (CDR) and spaced framework (FR) regions. The arrangement of the domains is as follows: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. The substitution, deletion, or insertion of one or more amino acids, or any combination thereof, occurs in the framework regions FR1, FR2, FR3, and FR4.

[0061] In some alternative embodiments, the antibody includes any form of monoclonal antibody, single-chain antibody, bifunctional antibody, single-domain antibody, nanobody, fully or partially humanized antibody, or chimeric antibody;

[0062] And / or, the antibody is selected from Fab, Fab', Fab'-SH, (Fab')2, Fv, scFv, BsFv, dsFv or (dsFv)2 fragments.

[0063] In some alternative embodiments, the antibody further includes a human or mouse constant region. In other alternative embodiments, the antibody further includes a human or mouse heavy chain constant region and / or a light chain constant region. In still other alternative embodiments, the antibody comprises a heavy chain constant region of IgG, IgA, IgM, IgD, or IgE and / or a κ or λ type light chain constant region.

[0064] In some alternative implementations, the antibody is a mouse, chimeric, or humanized monoclonal antibody.

[0065] In some alternative embodiments, the heavy chain constant region of the monoclonal antibody is an IgG1, IgG2, IgG3, or IgG4 subtype.

[0066] In some alternative implementations, the antibody is a monoclonal antibody.

[0067] In some alternative implementations, the antibody is an IgG antibody.

[0068] Secondly, this application provides a biomaterial, said biomaterial comprising:

[0069] (1) Nucleotide molecules encoding the antibody pair against the anti-BAFF protein. The nucleotide molecule encoding the 2F2 antibody heavy chain sequence comprises the nucleotide sequence shown in SEQ ID NO. 17; the nucleotide molecule encoding the 2F2 antibody light chain sequence comprises the nucleotide sequence shown in SEQ ID NO. 18. The nucleotide molecule encoding the 6F10 antibody heavy chain sequence comprises the nucleotide sequence shown in SEQ ID NO. 19; the nucleotide molecule encoding the 6F10 antibody light chain sequence comprises the nucleotide sequence shown in SEQ ID NO. 20.

[0070] SEQ ID NO.17: CAGGTCCAGTTGCAGCAGTCTGGAGCTGAACTGGTAAGGCCTGGGACTTCAGTGAAGATATCCTGCAAGGCTTCTGGATACGCCTTCACTTACTACTGGCTTGGTTGGATAAAACAGAGGCCTGGACATGGACTTGAGTGGGTTGGAGATATCTTCCCTGGAAGTGGTACT ACTCACTACAGTGAGAAATTCAAGGGCAAAGCCACACTGACTGCAGACAGATCCTCGACCACAGCCTATATGCAGCTCAGTGGCCTGACATCTGAGGACTCTGCTGTCTATTTCTGTGCAAGAGAAGGGGACGGGTTTCTTACTGGGGCCAAGGGACTCTGGTCACTGTCTCTGCA;

[0071] SEQ ID NO.18:GACATTGTGATGACCCAGTCTCCCAAATTCATGTCCACATCAGTAGGAGACAGGGTCAGCATCACCTGCAAGGCCAGTCAGGATGTGGGTACTGCTGTAGCCTGGTATCAAAAAAAACCAGGCCAATCTCCTAAACTACTGATTTACTGGGCATCCACCCGGCACACCGGAGTCCCTGATCGCTTCACAGGCAGTGGATCTGGGACAGATTTCACTCTCACCATTAACAATGTGCAGTCTGAAGACTTGGCAGATTGTTTCTGTCAGCAATATAGGAGCTATCCGTACACGTTCGGAGGGGGGACCAAGCTGGAAATAAAA;

[0072] SEQ ID NO.19:GAGGTTCAGCTGCAGCAGTCTGGGGCAGAGGTTGTGATGCCAGGGGCCTCAGTCAAGTTGTCCTGCACAGCTTCTGGCTTCAAAATTGAAGACACCTATATATACTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGAAGGGTTGATCCTGCGAATGGTAATACTATATATGACCCGAAGTTCCAGGGCAAGGCCACTATAACAGCAGACGCATCCTCCAAAACAGGCTTCCTGCGGCTCAACAGCCTGACATCTGACGACACTGCCGTCTATTACTGTGGTAGAAGTTTCCCCGGTAGTAGCTATGCTATGGACTATTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCAGCCAAAACGACACCCCCATCTGAC;

[0073] SEQ ID NO.20: GATGTTGTGATGACCCAAACTCCACTCTCCCTGCCTGTCAGTCTTGGAGATCAAGCCTCCATCTCTTGCAGATCTGGTCAGAGCCTTGTTCACAGTAATGGAAACACCTATTTACATTGGTACCTGCAGAAGCCAGGCCAGTTCCCAAAGCTCCTGATCTACAAAGTTTCC AACCGATTTTCTGGGGTCCCAGACAGGTTCAGTGGCAGTGGATCAGGGACAGATTTTACACTCAAGATCAGCAGAGTGGAGGCTGAGGATCTGGGAGTTTATTTCTGCTCTCAAAGTACACATGTTCCGCTCACGTTCGGTGCTGGGACCAAGCTGGAGCTGAAACGGGCTGATGC.

[0074] (2) A carrier comprising the nucleotide molecules described in (1);

[0075] (3) A host cell comprising the nucleotide molecules described in (1) and / or the vector described in (2), or the host cell being transformed or transfected by the nucleic acid molecules described in (1) and / or the vector described in (2).

[0076] Based on the amino acid sequence of the antibody described in the first aspect, those skilled in the art can obtain the nucleotide molecule encoding the antibody described in the first aspect. Due to the degeneracy of codons, the nucleotide sequence of a nucleotide molecule is not unique, and all nucleic acid molecules capable of encoding the antibody described in the first aspect are within the scope of protection of this application.

[0077] In some alternative embodiments, the vector includes, but is not limited to, plasmid vectors, bacteriophage vectors, viral vectors, artificial chromosome vectors, etc.

[0078] In some alternative implementations, the host cell includes, but is not limited to, microbial cells, insect cells, or non-insect animal cells.

[0079] In some alternative embodiments, the host cell is selected from prokaryotic cells or eukaryotic cells.

[0080] In some alternative embodiments, the host cell is selected from yeast cells, CHO cells, 293 cells (human embryonic kidney 293 cells) or plant cells.

[0081] Thirdly, this application provides an antibody-drug conjugate comprising the antibody described in the first aspect and a marker conjugated to the antibody described in the first aspect.

[0082] In some alternative embodiments, the marker is selected from at least one of enzyme labeling, biotin labeling, fluorescent dye labeling, chemiluminescent dye labeling, and radioactive labeling.

[0083] Fourthly, this application provides the use of the antibody described in the first aspect, and / or the biological material described in the second aspect, and / or the antibody-drug conjugate described in the third aspect in the preparation of a product for detecting BAFF protein.

[0084] Fifthly, this application provides a detection reagent for detecting BAFF protein, the reagent comprising the antibody described in the first aspect, and / or the biological material described in the second aspect, and / or the antibody-drug conjugate described in the third aspect.

[0085] Sixthly, this application provides a detection kit for detecting BAFF protein, the kit comprising the antibody described in the first aspect, and / or the biological material described in the second aspect, and / or the antibody-drug conjugate described in the third aspect.

[0086] In some alternative implementations, the detection kit is selected from enzyme-linked immunosorbent assay (ELISA) kits, fluorescence immunoassay kits, or chemiluminescence immunoassay kits.

[0087] Definitions or explanations of general terms:

[0088] Unless otherwise stated, implementation of this application will employ conventional techniques of molecular biology (including recombinant technology), microbiology, cell biology, biochemistry, and immunology, all of which are within the scope of the art.

[0089] The term “and / or” as used in this application should be understood to mean any one of the options or any combination of two or more of the options.

[0090] As used in this application, "comprising" or "including" means including the stated elements, integers, or steps, but does not exclude any other elements, integers, or steps.

[0091] The "antibody (Ab)" used in this application refers to an immunoglobulin secreted by lymphocytes after receiving antigen stimulation, which has an immune function (i.e., can specifically bind to the antigen). Antibodies have a tetrameric structure, containing two identical heavy chains (H chains) and two identical light chains (L chains). The regions of the antibody heavy and light chains near the N-terminus where the amino acid sequence varies considerably are called variable regions (V regions). The hypervariable regions (HVRs) of the heavy and light chains, because they are complementary to the antigen epitopes, are called complementarity determining regions (CDRs), denoted as HVR1 (CDR1), HVR2 (CDR2), and HVR3 (CDR3), respectively, with CDR3 showing the greatest variation. The regions of the antibody heavy and light chains near the C-terminus where the amino acid sequence is relatively constant are called constant regions (C regions).

[0092] The terms "complementarity-determining region" or "CDR region" or "hypervariant region" used interchangeably in this application refer to regions within the variable domain of an antibody that are highly variable in sequence and form structurally defined loops ("hypervariant loops") and / or contain antigen contact residues ("antigen contact sites"). The CDR is primarily responsible for binding to antigen epitopes.

[0093] The "monoclonal antibody" used in this application is a specific antibody produced by B lymphocytes under the stimulation of a specific antigen. It has a completely identical chemical structure and is complementary to the antigenic determinant.

[0094] The term "amino acid difference" as used in this application refers to the modification of amino acids (such as amino acid methylation modification) or the substitution of amino acids.

[0095] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0096] The recombinant human BAFF protein of this invention was purchased from Genscript Biotech Co., Ltd. (catalog number Z02976); the HRP-labeled goat anti-mouse IgG antibody was purchased from Jackson Immuno Research (catalog number 115-035-062); the microspheres conjugated with the capture antibody were purchased from Luminex (catalog number MC10053-1); the recombinant human BAFF protein was purchased from Genscript Biotech Co., Ltd. (catalog number Z02976); and the R-phycoerythrin-streptavidin conjugate was purchased from Wuhan Sanying Biotechnology Co., Ltd. (catalog number PF00021).

[0097] Unless otherwise specified, the production processes, experimental methods, or testing methods involved in the embodiments of this invention are all conventional methods in the prior art, and their names and / or abbreviations are all conventional names in the field, which are very clear and distinct in the relevant application areas. Those skilled in the art can understand the conventional process steps based on the names and apply the corresponding equipment, and implement them according to conventional conditions or the conditions recommended by the manufacturer.

[0098] The various instruments, equipment, raw materials or reagents used in the embodiments of this invention are not subject to any special restrictions on their source. They are all conventional products that can be purchased through regular commercial channels and can be prepared according to conventional methods known to those skilled in the art.

[0099] Example 1: Preparation of anti-BAFF protein antibody

[0100] The anti-BAFF protein antibody is a monoclonal antibody obtained by using recombinant human BAFF protein as an immunogen and employing standard mouse immunization and ELISA screening methods. The specific method includes the following steps:

[0101] (1) Animal immunization: 6-8 week old female BALB / c mice (i.e., inbred mice, BALB / c mice are bred through full-sib mating and have a highly consistent genetic background with little difference between individuals) were selected. The recombinant human BAFF protein was diluted to 1 mg / mL, mixed with an equal volume of Freund's adjuvant and emulsified before being used to immunize the mice.

[0102] The initial immunization dose was 50 μg / mouse, and subsequent immunizations were 25 μg / mouse. The immunization interval was two weeks. After three immunizations, blood was collected from the submandibular vein of the mice, and the antibody titer in response to recombinant human BAFF protein was detected by ELISA. After five immunizations, the mice were euthanized by cervical dislocation, and the spleen was aseptically removed and prepared as a single-cell suspension for later use.

[0103] (2) Cell fusion: Mouse spleen cells and SP2 / 0 cells (full name: SP2 / 0-Ag14 cells; SP2 / 0 cells are obtained by fusing immunized BALB / c mouse spleen cells with P3X63Ag8 myeloma cells, belonging to the B-cell hybridoma cell line) were mixed in a centrifuge tube at a ratio of 5:1, and the supernatant was discarded after centrifugation. The centrifuge tube was placed in a 37°C water bath and gently shaken. The fusion agent PEG1500 solution (50%, sterile) was slowly added over 1 min, and the mixture was allowed to stand for 1 min. Then, 2 mL of IMEM medium was added while shaking, which should be completed within 2 min. Then, 10 mL of IMEM medium was slowly added, and the mixture was centrifuged at 800 rpm and the supernatant was discarded. IMEM medium containing double antibiotics and 10% FBS was added to the centrifuge tube, and the cells were plated in a 96-well plate. The 96-well plate was placed in a 37°C cell culture incubator and cultured for 10 days. The growth of single clones was observed.

[0104] (3) ELISA screening of positive supernatant and clones: BAFF protein was prepared to a concentration of 0.5 μg / mL using coating buffer, and plated at 50 μL / well, incubating overnight at 2–8°C. The next day, unbound antigen was discarded from the plate, and 200 μL of PBS-T was added to each well for washing, followed by patting dry on paper. 200 μL of blocking buffer (PBS containing 1% (w / v) BSA) was added to each well, and incubated at room temperature for 60 min. Primary antibody was diluted and added according to the specific experimental dilution requirements and methods, and incubated at room temperature for 60 min. Unbound primary antibody was discarded from the plate, and the plate was washed 3 times with PBS-T (using a plate washer), followed by patting dry on paper. 50 μL of working concentration HRP secondary antibody was added to each well, and incubated at 37°C for 30 min. Unbound secondary antibody was discarded from the plate, and the plate was washed 3 times with PBS-T (using a plate washer), followed by patting dry on paper. Add 50 μL TMB of chromogenic reagent to each well, react at room temperature for 5 min, and then add 50 μL of stop solution to terminate the reaction. Detect the OD value at 450 nm using a microplate reader in absorbance mode, and process the data.

[0105] (4) Antibody V gene analysis: DNA sequencing was performed on the PCR products, and homology comparison was performed on the sequencing results to obtain the sequence information of the target antibody. All target antibodies are monoclonal antibodies against BAFF protein.

[0106] As shown in Table 1, antibody 2F2 has a heavy chain variable region with the amino acid sequence shown in SEQ ID NO. 13 and a light chain variable region with the amino acid sequence shown in SEQ ID NO. 14. The amino acid sequences of the complementarity-determining regions CDR1, CDR2, and CDR3 in the heavy chain variable region are shown in SEQ ID NO. 1, 2, and 3, respectively. The amino acid sequences of the complementarity-determining regions CDR1, CDR2, and CDR3 in the light chain variable region are shown in SEQ ID NO. 4, 5, and 6, respectively.

[0107] The 6F10 antibody has a heavy chain variable region with the amino acid sequence shown in SEQ ID NO. 15 and a light chain variable region with the amino acid sequence shown in SEQ ID NO. 16. The amino acid sequences of the complementarity-determining regions CDR1, CDR2, and CDR3 in the heavy chain variable region are shown in SEQ ID NO. 7, 8, and 9, respectively. The amino acid sequences of the complementarity-determining regions CDR1, CDR2, and CDR3 in the light chain variable region are shown in SEQ ID NO. 10, 11, and 12, respectively.

[0108] Table 1. Sequence information of amino acid sequences SEQ ID NO. 1–16

[0109]

[0110] Example 2: Affinity test between anti-BAFF protein antibody and BAFF protein

[0111] This embodiment uses ELISA to detect the affinity between anti-BAFF protein antibody and BAFF protein, and specifically includes the following steps:

[0112] (1) Coating: BAFF protein was prepared with coating buffer at a concentration of 0.5 μg / mL and plated at a rate of 50 μL / well. The plate was incubated overnight at 2–8°C. The next day, unbound antigen was discarded from the plate.

[0113] (2) Washing: Add 200 μL of PBS-T to each well and blot dry on paper. Repeat the above steps for a total of 3 washes.

[0114] (3) Blocking: Add 200 μL of blocking solution (PBS containing 1% (w / v) BSA) to each well and incubate at room temperature for 60 min.

[0115] (4) Wash the plate: Repeat step (2).

[0116] (5) Primary antibody incubation: Add 50 μL of anti-BAFF protein antibody solution to each well and incubate at room temperature or 37°C for 30–60 min. The preparation of the anti-BAFF protein antibody is as follows: Dilute the anti-BAFF protein antibody to 1000 ng / mL in a centrifuge tube with PBS-T (labeled S1), and prepare 8 centrifuge tubes containing 100 μL of diluent (labeled S2–S9). Transfer 50 μL of the anti-BAFF protein antibody solution from centrifuge tube S1 to centrifuge tube S2 and mix thoroughly. Transfer 50 μL of the anti-BAFF protein antibody solution from centrifuge tube S2 to centrifuge tube S3 and mix thoroughly, and so on, until S9. The antibody concentration gradients against BAFF protein were: 1000.00, 333.33, 111.11, 37.04, 12.35, 4.12, 1.23, 0.41, and 0.14 ng / mL. PBS-T was used as a blank.

[0117] (6) Wash the plate: Repeat step (2).

[0118] (7) Secondary antibody incubation: Add 50-100 μL of working concentration HRP secondary antibody to each well and incubate at room temperature or 37°C for 30-60 min.

[0119] (8) Wash the plate: Repeat step (2).

[0120] (9) Color development: Add 50-100 μL TMB color developer to each well and react at room temperature or 37°C in the dark for 5-15 minutes.

[0121] (10) Termination: Add 50-100 μL of stop solution to each well and gently tap the microplate.

[0122] (11) Detection: The OD value at 450 nm was detected using an ELISA reader in absorbance mode. The affinity curve between the anti-BAFF monoclonal antibody and the BAFF protein was plotted with the concentration of the anti-BAFF protein antibody on the x-axis and OD 450 nm on the y-axis.

[0123] EC 50 The half-maximal effective concentration (WMC) is an important parameter in pharmacology and biology, used to describe the concentration at which a drug or compound produces 50% of its maximum effect on a biological system.

[0124] The results are as follows Figure 1 As shown, the EC50 of the monoclonal antibodies 2F2 and 6F10 against BAFF protein of the present invention... 50The concentrations are 10.05 ng / mL and 21.18 ng / mL, respectively. Both antibodies exhibit high specificity and high affinity for BAFF protein, enabling quantitative detection of BAFF.

[0125] Example 3: Screening of capture-labeled antibody pairs against human BAFF protein using a double-antibody sandwich method.

[0126] The detection procedure for quantifying anti-human BAFF protein antibodies based on the double-antibody sandwich method includes the following steps:

[0127] (1) Preparation of working solution for capturing microbeads: Microbeads conjugated with anti-human BAFF protein antibody were taken out of the refrigerator and shaken at room temperature in the dark for 10-30 minutes. The working solution for the microbeads was prepared with PBS-T according to the ratio of approximately 1000 microbeads per well.

[0128] (2) Preparation of human BAFF protein solution: Recombinant human BAFF protein was diluted with PBS-T to a concentration of 5 ng / mL.

[0129] (3) Sample loading: Add 50 μL of microbead working solution and 50 μL of BAFF protein dilution solution to each well, and incubate at room temperature at 500-800 rpm for 1-2 hours in the dark.

[0130] (4) Washing: Place the 96-well plate on a magnetic plate for magnetic separation for 3 minutes, then shake off the liquid. Add 150 μL of PBS-T to each well and gently tap the plate wall. Separate magnetically on a magnetic plate for 3 minutes, then shake off the liquid. Repeat the above steps twice, for a total of 3 washes.

[0131] (5) Incubation of biotin-labeled anti-human BAFF protein antibody: Dilute the biotin-labeled anti-human BAFF protein antibody according to the specific dilution requirements and methods of the experiment. Add 50-100 μL of biotin-labeled anti-human BAFF protein antibody working solution to each well and incubate at room temperature at 500-800 rpm for 0.5-1 hour in the dark.

[0132] (6) Washing: Repeat step (4).

[0133] (7) Incubation of R-phycoerythrin-streptavidin conjugate: Dilute the R-phycoerythrin-streptavidin conjugate according to the dilution requirements and methods of the specific experiment. Add 50-100 μL of R-phycoerythrin-streptavidin conjugate working solution to each well and incubate at room temperature at 500-800 rpm for 0.5-1 hour in the dark.

[0134] (8) Washing: Repeat step (4).

[0135] (9) Detection: Add 100 μL of PBS-T to each well, gently tap to mix, and measure the fluorescence value on a multi-functional flow cytometer (Luminex 200).

[0136] The results are as follows Figure 2 As shown, the monoclonal antibodies 6F10 and 2F2 against BAFF protein of the present invention can be used as capture antibodies and labeling antibodies, respectively, to achieve quantitative detection of BAFF.

[0137] Example 4: Detection kit for human BAFF protein based on double antibody sandwich immunofluorescence assay

[0138] The working principle of this kit for detecting anti-human BAFF protein based on the double-antibody sandwich method is as follows: Microspheres conjugated with capture antibodies are added to a 96-well plate; human BAFF protein standards or test samples are added to the wells of the 96-well plate, and the human BAFF protein in the standards or test samples binds to the capture antibodies on the microspheres; biotin-labeled antibodies against human BAFF protein are added to the wells of the 96-well plate, so that the biotin-labeled antibodies bind to human BAFF protein, forming a capture antibody-human BAFF protein-labeled antibody complex; PE-labeled secondary antibody is added to the wells of the 96-well plate; the fluorescence value is measured using a multi-functional flow cytometer (NovaPlex-1200), and the concentration of human BAFF protein in the test sample is calculated by plotting a standard curve.

[0139] The working process of this detection kit based on the double antibody sandwich method for detecting human BAFF protein includes the following steps:

[0140] (1) Preparation of working solution for capture beads: Remove the beads coupled with capture antibodies from the refrigerator and shake at room temperature in the dark for 10-30 minutes. Prepare working solution for the beads with PBS-T according to approximately 1000 beads per well.

[0141] (2) Preparation of BAFF protein standards: Dilute recombinant human BAFF protein to a 5000 pg / mL BAFF protein standard solution (numbered S1) with PBS-T in a centrifuge tube, and prepare 6 centrifuge tubes containing 150 μL of PBS-T (numbered S2 to S7). Transfer 75 μL of BAFF protein standard solution from centrifuge tube S1 to centrifuge tube S2 and mix thoroughly. Transfer 75 μL of BAFF protein standard solution from centrifuge tube S2 to centrifuge tube S3 and mix thoroughly, and so on, until S7. The BAFF protein standard concentration gradient is: 5000.00, 1666.67, 555.56, 185.19, 61.73, 20.58, and 6.86 pg / mL.

[0142] (3) Preparation of test samples: Dilute the blood sample to be tested 3 to 10 times with PBS-T in a centrifuge tube.

[0143] (4) Sample addition: Add 50 μL of working solution of microbeads to each well, then add 50 μL of standard or sample to be tested, and incubate at room temperature at 500-800 rpm for 1-2 hours in the dark.

[0144] (5) Washing: Place the 96-well plate on a magnetic plate for magnetic separation for 3 minutes, then shake off the liquid. Add 150 μL of PBS-T to each well and gently tap the plate wall. Separate magnetically on a magnetic plate for 3 minutes, then shake off the liquid. Repeat the above steps twice, for a total of 3 washes.

[0145] (6) Biotin antibody incubation: Dilute the biotin antibody according to the specific dilution requirements and methods of the experiment, add 50-100 μL of biotin antibody working solution to each well, and incubate at room temperature and in the dark at 500-800 rpm for 0.5-1 hour.

[0146] (7) Washing: Repeat step (5).

[0147] (8) Incubation of R-phycoerythrin-streptavidin conjugate: Dilute the R-phycoerythrin-streptavidin conjugate according to the dilution requirements and methods of the specific experiment. Add 50-100 μL of R-phycoerythrin-streptavidin conjugate working solution to each well and incubate at room temperature at 500-800 rpm for 0.5-1 hour in the dark.

[0148] (9) Washing: Repeat step (5).

[0149] (10) Detection: Add 50-100 μL of PBS-T to each well, gently tap to mix, and measure the fluorescence value on a multifunctional flow cytometer (NovaPlex-1200).

[0150] The standard curve for detecting human BAFF protein is shown below. Figure 3 As shown.

[0151] The kit in this embodiment was used to detect the concentration of human BAFF protein in blood samples numbered 1# to 8#. The results are shown in Table 2.

[0152] Table 2. Concentration of human BAFF protein in blood samples #1 to #8

[0153]

[0154] As shown in Table 2, the detection kit of this application, using the anti-human BAFF protein antibody pair of the present invention, is suitable for the detection of blood samples or samples from other tissue sources, and has promising clinical application prospects.

[0155] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An antibody pair against BAFF protein, characterized in that, The antibody pair comprises two monoclonal antibodies; the monoclonal antibodies comprise a heavy chain variable region and a light chain variable region; the heavy chain variable region comprises a heavy chain HCDR1, a heavy chain HCDR2, and a heavy chain HCDR3; the light chain variable region comprises a light chain LCDR1, a light chain LCDR2, and a light chain LCDR3; One of the monoclonal antibodies in the antibody pair is a 2F2 antibody, and the sequence information of the 2F2 antibody is as follows: The amino acid sequence of the heavy chain HCDR1 is as shown in SEQ ID NO. 1; The amino acid sequence of the heavy chain HCDR2 is as shown in SEQ ID NO. 2; The amino acid sequence of the heavy chain HCDR3 is as shown in SEQ ID NO. 3; The amino acid sequence of the light chain LCDR1 is as shown in SEQ ID NO. 4; The amino acid sequence of the light chain LCDR2 is as shown in SEQ ID NO. 5; The amino acid sequence of the light chain LCDR3 is as shown in SEQ ID NO. 6; The other monoclonal antibody in the antibody pair is a 6F10 antibody, and the sequence information of the 6F10 antibody is as follows: The amino acid sequence of the heavy chain HCDR1 is as shown in SEQ ID NO. 7; The amino acid sequence of the heavy chain HCDR2 is as shown in SEQ ID NO. 8; The amino acid sequence of the heavy chain HCDR3 is as shown in SEQ ID NO. 9; The amino acid sequence of the light chain LCDR1 is as shown in SEQ ID NO. 10; The amino acid sequence of the light chain LCDR2 is as shown in SEQ ID NO. 11; The amino acid sequence of the light chain LCDR3 is as shown in SEQ ID NO.

12. The amino acid sequence of the heavy chain sequence of the 2F2 antibody is as shown in SEQ ID NO. 13; the amino acid sequence of the light chain sequence of the 2F2 antibody is as shown in SEQ ID NO. 14; the amino acid sequence of the heavy chain sequence of the 6F10 antibody is as shown in SEQ ID NO. 15; and the amino acid sequence of the light chain sequence of the 6F10 antibody is as shown in SEQ ID NO.

16. The nucleic acid molecule encodes the amino acid sequence of the 2F2 antibody or the 6F10 antibody according to claim 1 or claim 2. The nucleic acid molecule encoding the heavy chain sequence of the 2F2 antibody is as shown in SEQ ID NO. 17; the nucleic acid molecule encoding the light chain sequence of the 2F2 antibody is as shown in SEQ ID NO. 18; the nucleic acid molecule encoding the heavy chain sequence of the 6F10 antibody is as shown in SEQ ID NO. 19; and the nucleic acid molecule encoding the light chain sequence of the 6F10 antibody is as shown in SEQ ID NO.

20. The biological material comprises one of the following substances: ​ 2. The antibody pair according to claim 1, characterized in that, ​ ​ ​ ​ 3. A nucleic acid molecule, characterized in that, ​ ​ 4. The nucleic acid molecule of claim 3, wherein, ​ ​ ​ ​ 5. A biomaterial, characterized by, ​ (1) a nucleic acid molecule encoding the amino acid sequence of claim 1 or claim 2; (2) a vector comprising the nucleic acid molecule of (1); (3) a host cell comprising the nucleic acid molecule of (1) and / or the vector of (2) or transformed or transfected with the nucleic acid molecule of (1) and / or the vector of (2). The vector is a vector plasmid, a phage vector, a viral vector or an artificial chromosome vector.

6. The biomaterial of claim 5, wherein, The host cell is a microbial cell, an insect cell or a non-insect animal cell. The kit comprises the antibody pair of claim 1 or claim 2.

7. The biomaterial of claim 5, wherein, The 2F2 antibody is a labeled antibody, and the 6F10 antibody is a capture antibody.

10. Use of the antibody pair of claim 1 or claim 2 in the preparation of a reagent for detecting BAFF protein.

8. A kit for detecting BAFF protein, characterized by, ​ ​ 9. The kit of claim 8, wherein ​ ​ ​ ​

Images