A strain of chondrosteum and its application in decolorization and degradation of refractory lignin
By screening out Bjerkandera adusta 59620 and its highly active manganese peroxidase, the problem of depolymerization and transformation of recalcitrant lignin has been solved, achieving efficient lignin degradation and decolorization, and promoting the comprehensive utilization of biomass resources and environmental protection.
Patent Information
- Application Number
- CN202510764179.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-10
- Publication Date
- 2026-02-10
- Estimated Expiration
- 2045-06-10
AI Technical Summary
Existing technologies are unable to effectively depolymerize and transform lignin, resulting in low efficiency of comprehensive utilization of biomass resources. Furthermore, lignin causes resource waste and environmental pollution in the paper industry.
The study employed *Bjerkandera adusta* 59620, selected from the Changsha Bamboo Slips Museum, to decolorize and degrade recalcitrant lignin using its highly active manganese peroxidase. The highly active manganese peroxidase catalyzes the oxidation of Mn²⁺ to Mn³⁺, which penetrates the lignin network structure and triggers a chain of free radical reactions, thus achieving efficient degradation of kraft lignin.
The degradation rate of Kraft lignin by *Bacillus citrinum* 59620 reached 47.49%, and the decolorization rate reached 77.77%, providing an efficient way to utilize lignin resources. It has the advantages of mild reaction conditions, simple operation, low cost, and green environmental protection.
Smart Images

Figure CN120555204B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial technology, specifically relating to a strain of *Bacillus citrinum* and its application in the decolorization and degradation of recalcitrant lignin. Background Technology
[0002] Lignin is the second most abundant natural biopolymer on Earth after cellulose, with an annual production of nearly 100 to 150 million tons. Therefore, lignin's renewable nature, wide availability, and sustainability make it an ideal alternative to traditional polymers.
[0003] Lignin is a natural amorphous organic polymer with a three-dimensional network structure formed by a series of carbon-oxygen and carbon-carbon bonds. It forms the cell walls of plants along with cellulose and hemicellulose and is ubiquitous in biomass resources. This structure gives lignin a protective role in biomass, but it also presents a challenge in biomass conversion. Due to its complex structure and high chemical stability, lignin can effectively inhibit or slow down the degradation of cellulose and hemicellulose, thereby reducing the conversion efficiency of these useful polysaccharides. Furthermore, as the most abundant aromatic polymer on Earth, lignin is still mainly used for heating and power generation, resulting in serious resource waste. Lignin is also a major cause of COD and color formation in black liquor emissions from the paper industry and is currently recognized as one of the most difficult-to-degrade aromatic compounds by microorganisms. Therefore, the depolymerization and conversion of lignin are key to promoting the comprehensive utilization of biomass resources, the high-value conversion of lignocellulose, and the efficient treatment of wastewater.
[0004] Biodegradation technology plays a crucial role in the degradation and transformation of lignin. Fungi, as the primary decomposers on Earth, have evolved the most powerful enzyme systems and degradation pathways, offering advantages such as high efficiency, mildness, environmental friendliness, and energy conservation, making them the most promising method for lignin depolymerization. Utilizing fungi to depolymerize and transform lignin to produce chemicals, materials, and energy is a necessary approach to promote the high-value utilization of lignin and drive the comprehensive transformation of biomass resources. However, the complex chemical structure and unique physicochemical properties of lignin make the screening of highly efficient and specific microbial strains for lignin degradation a top priority. Summary of the Invention
[0005] In view of this, the present invention provides a strain of *Cymbidium faberi* isolated from Han Dynasty bamboo slips in the Changsha Bamboo Slips Museum. This strain possesses the function of secreting lignin-degrading enzymes. Unexpectedly, the manganese peroxidase secreted by the *Cymbidium faberi* exhibits high enzyme activity, enabling the strain to effectively decolorize and degrade recalcitrant lignin. Verification has shown that the *Cymbidium faberi* provided by this invention achieves a degradation rate of 47.49% for Kraft lignin and a decolorization rate as high as 77.77%. The *Cymbidium faberi* provided by this invention will provide strong technical support for the rational and effective utilization of lignin resources and has broad application prospects in papermaking, environmental protection, feed, and fertilizer fields.
[0006] This invention includes the following technical solutions:
[0007] In a first aspect, the present invention provides a strain of *Bacillus cibarius* (…). Bjerkander is silent. Its strain number is 59620, and its classification name is: *Bacillus cibarius*. Bjerkander is silent. It is deposited at the China General Microbiological Culture Collection Center, accession number CGMCC No. 41892.
[0008] The flue bacteria ( Bjerkander is silent. The colonies formed by 59620 are round, with a white, cottony texture on the surface. They are opaque, with neat edges, and no spores are observed on the surface of the colonies.
[0009] Sequencing analysis revealed that the *Flavobacterium cirrhifolium* provided by this invention (…) Bjerkander is silent. The ITS (internal transcribed spacer) sequence of 59620 is shown in SEQ ID NO.1.
[0010] In a second aspect, the present invention provides a microbial agent containing the *Bacterium tumefaciens* described in the first aspect of the present invention. Bjerkander is silent. )59620, Smoking pipe bacteria ( Bjerkander is silent. Metabolites of 59620 and / or *Flavobacterium tumefaciens* ( Bjerkander is silent. )59620 fermentation broth.
[0011] In a specific embodiment of the present invention, the microbial agent further includes an acceptable carrier, which is selected from solid or liquid carriers. The carrier is an adjuvant commonly used in the art that has a protective effect on live bacteria, such as one or more of corn flour, starch, and soybean flour.
[0012] The microbial agent formulation described in this invention is selected from any one of powder, granules, wettable powder, water-dispersible granules, liquid preparations, emulsions, or suspensions.
[0013] In one specific embodiment of the present invention, the microbial agent is *Bacillus citrinum* (…). Bjerkander in the dark The fermentation broth of 59620 is prepared by the following method:
[0014] Tobacco tube bacteria ( Bjerkander is silent. )59620 was inoculated into HB2 medium and cultured in a shaker at 25-27℃ and 125-150 rpm / min for 6-18 days to obtain the fermentation broth of Tobacco Tube Bacteria.
[0015] Preferred to be *Bacillus cirrhosa* ( Bjerkander is silent. )59620 was cultured in a shaker at 27℃ and 125 rpm / min for 6-9 days.
[0016] The active substances in the fermentation broth include *Fungiformis* (… Bjerkander is silent. ) 59620 bacterial cells and *Bacillus cirrhosa* ( Bjerkander is silent. Metabolites of 59620. The "active substance" mentioned in this invention refers to the component that exerts the effects of lignin degradation and decolorization.
[0017] In a third aspect, the present invention provides a *Bacterium cirrhifolium* as described in the first aspect of the present invention (…). Bjerkander is silent. Application of 59620 in the production of lignin-degrading enzymes, which include laccase and manganese peroxidase.
[0018] Preferably, the lignin-degrading enzyme is selected from manganese peroxidase.
[0019] The present invention unexpectedly discovered that the *Tobacco tube bacteria* (smokers) screened from Han Dynasty bamboo slips in the Changsha Bamboo Slips Museum... Bjerkander is silent. The manganese peroxidase secreted by 59620 has significantly higher enzyme activity than other *Cymbidium* species in the prior art. Therefore, the *Cymbidium* species provided by this invention ( Bjerkander is silent. 59620 can be used to prepare manganese peroxidase.
[0020] In a fourth aspect, the present invention provides a method for preparing manganese peroxidase, the method comprising: reacting *Bacillus cibarius* (… Bjerkander is silent. )59620 was inoculated into HB2 medium and cultured at 25-27℃ in a shaker at 125-150 rpm / min for 6-12 days. After centrifugation, the supernatant was collected. The supernatant contained manganese peroxidase.
[0021] In the most preferred embodiment of the present invention, the culture conditions are 27°C and 125 rpm / min in a shaker for 9 days.
[0022] Furthermore, the preparation method also includes freeze-drying the supernatant to form a freeze-dried powder containing manganese peroxidase.
[0023] The HB2 culture medium described in this invention is composed of the following components: 17.0g malt extract, 3.0g fungal peptone, and 1000mL distilled water; the pH of the HB2 culture medium is 5.2-5.6.
[0024] Furthermore, the HB2 culture medium was sterilized before use under the following conditions: sterilization at 121°C and 0.1 MPa for 20 min in a high-temperature and high-pressure autoclave.
[0025] In a fifth aspect, the invention provides for the use of any of the following in the degradation of lignin:
[0026] I) The *Bacterium tumefaciens* as described in the first aspect of this invention (… Bjerkander is silent. 59620;
[0027] II) The microbial agent described in the second aspect of the present invention.
[0028] In a sixth aspect, the present invention provides any one of the following applications in lignin decolorization:
[0029] I) The *Bacterium tumefaciens* as described in the first aspect of this invention (… Bjerkander is silent. 59620;
[0030] II) The microbial agent described in the second aspect of the present invention.
[0031] The lignin described in this invention is a recalcitrant lignin, selected from one or more combinations of Kraft lignin, industrial lignin, and bamboo lignin. Compared to conventional lignin (such as lignin monomers, lignin sulfonates, native lignin, and ball-milled lignin), the recalcitrant lignin described in this invention is characterized by its recalcitrant nature. The recalcitrant lignin is industrial lignin. Commonly used industrial methods for extracting lignin include the Kraft method, sulfate extraction, organic solvent extraction, steam explosion, and soda extraction. Industrial lignin obtained through these methods suffers from reduced reactivity due to the destruction of active groups, resulting in its recalcitrant nature.
[0032] The kraft lignin described in the specific embodiments of this invention mainly originates from kraft papermaking waste liquor, which is a processing residue obtained after the raw material is treated with sodium hydroxide and sodium sulfite under high temperature and high pressure. Kraft lignin typically contains 1%-5% sulfur; structurally, compared to natural lignin, kraft lignin exhibits severe condensation, leading to a significant reduction in its reactivity and enhanced thermal stability, making it difficult to degrade.
[0033] An unexpected discovery by those skilled in the art is that, compared to conventional flue bacteria, the flue bacteria provided by this invention (…) (Bjerkandera adusta) 59620 has relatively good decolorization and decolorization effects against the above-mentionedAnalysis suggests that the effectiveness of this technology is related to the highly active manganese peroxidase secreted by the *Bacillus citrinum*. Those skilled in the art know that recalcitrant lignin typically possesses a highly cross-linked three-dimensional network structure. Its phenolic components (such as guaiacol and syringyl units) often form stubborn domains due to β-O-4 ether polymerization, methoxylation modification, or steric hindrance, making it difficult for traditional enzyme systems to effectively reach the catalytic site. The highly active manganese peroxidase secreted by the *Bacillus citrinum* achieves a specific breakthrough through the following mechanism: On the one hand, the highly active manganese peroxidase can rapidly catalyze the oxidation of Mn²⁺ to generate a strong oxidant, Mn³⁺, which can chelate with small molecules such as oxalate and acetate. These chelated Mn... 3+ Oxidants, with their small molecular size and high diffusion capacity, can penetrate the complex network structure of lignin, non-specifically attacking and oxidizing various phenolic or non-phenolic compounds, and initiating a chain of free radical reactions, promoting the cleavage of β-O-4 bonds in phenolic domains and the oxidation of side chains. On the other hand, highly active manganese peroxidase ensures a continuous redox cycle, maintaining a stable Mn³⁺ generation rate even when lignin degradation intermediates (such as oligophenols) competitively bind to the enzyme's active site, thus exhibiting good degradation and decolorization effects on recalcitrant lignin. In specific experiments of this invention, it was verified that the *Bacillus citrinum* (… Bjerkander is silent. The degradation rate of the recalcitrant lignin Kraft by 59620 reached 47.49%, and the decolorization rate reached 77.77%.
[0034] In a seventh aspect of the invention, the invention provides a product comprising the use of the *Bacterium tumefaciens* described in the first aspect of the invention. Bjerkander is silent. The degradation products formed by the microbial inoculant degrading lignin, as described in 59620 or the second aspect of this invention. These degradation products can be used in biomedicine, textile materials, surfactants, and food preservation, etc.
[0035] The *Bacillus spp.* 59620 provided by this invention has the following beneficial technical effects:
[0036] 1) The *Bacillus cirrhosa* 59620 provided by this invention was screened from Han Dynasty bamboo slips in the Changsha Bamboo Slips Museum. The Han Dynasty bamboo slips are about 2,000 years old. The special storage environment gave the *Bacillus cirrhosa* 59620 a very unique characteristic of secreting highly active manganese peroxidase. It was determined that the enzyme activity of manganese peroxidase secreted by *Bacillus cirrhosa* 59620 was as high as 1495.65 U / mL on the 9th day of culture.
[0037] 2) The *Bacillus citrinum* 59620 provided by this invention has a strong ability to decompose kraft lignin, achieving a decolorization rate of 77.77% and a degradation rate of 47.49% for kraft lignin, thus providing a new pathway for the biodegradation of recalcitrant lignin.
[0038] 3) The *Bacillus cirrhosa* 59620 provided by this invention is a highly efficient lignin-degrading bacterium. Utilizing this bacterium to degrade lignin has advantages such as mild reaction conditions, simple operation, low cost, and environmental friendliness, providing strong technical support for the rational and effective utilization of lignin resources.
[0039] Copyright notice
[0040] Latin name of *Fungiformis*: Bjerkander is silent.
[0041] CGMCC Registration Number: 41892
[0042] Preservation Institution: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee
[0043] Collection institution abbreviation: CGMCC
[0044] Address of the depository: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing
[0045] Deposit date: April 14, 2025 Attached Figure Description
[0046] Figure 1 Comparative results of decolorization of *Fumiginium 59620* in Azure B-HA2 medium;
[0047] Figure 2 A frontal view of the colony morphology of *Flavobacterium tumefaciens* 59620 in HA2 solid medium;
[0048] Figure 3 Growth curve of *Bacillus cibarius* strain 59620 in HB2 liquid medium;
[0049] Figure 4 Phylogenetic tree constructed using *Fungiformis 59620*;
[0050] Figure 5 Laccase activity-time curve of Tobaccopus 59620 in HB2 liquid medium;
[0051] Figure 6 Manganese peroxidase activity-time curve of *Bacillus cirrhosa* 59620 in HB2 liquid medium;
[0052] Figure 7 Graph showing the time-varying rates of Kraft lignin degradation and decolorization of *Flavobacterium tumefaciens* 59620 in HB2 liquid medium;
[0053] Figure 8 Kraft lignin solution white light images before (a) and after (b) degradation by *Cymbidium faberi* 59620;
[0054] Figure 9 Scanning electron microscope images of Kraft lignin before (a) and after (b) degradation of Tobacco Tube 59620. Detailed Implementation
[0055] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0056] The culture medium and preparation method used in the specific embodiments of the present invention are as follows:
[0057] HA2 medium: 30.0g malt extract, 5.0g fungal peptone, 15.0g agar, 1000mL distilled water, pH 5.2-5.6.
[0058] HB2 medium: 17.0g malt extract, 3.0g fungal peptone, 1000mL distilled water, pH 5.2-5.6.
[0059] Azure B-HA2 medium: 30.0g malt extract, 5.0g fungal peptone, 15.0g agar, 2.5mg azurine B, 1000mL distilled water, natural pH.
[0060] The above culture medium was sterilized in a high-temperature and high-pressure autoclave at 0.1 MPa and 121°C for 20 min.
[0061] Example 1: Isolation and purification of bacterial strains
[0062] (1) Source of the strain
[0063] Use sterile cotton swabs to gently scrape the surface of Han Dynasty bamboo slips from the Changsha Bamboo Slips Museum, pack them in sterile bags, store them at 4°C, and transfer them to the laboratory within 2 hours for microbial isolation and screening.
[0064] (2) Isolation and purification of strains
[0065] In a sterile laminar flow hood, the collected samples were inoculated onto HA2 plates and incubated at a constant temperature of 27°C for 3 days. Based on the colony characteristics of the microorganisms, mycelia were picked up with an inoculation needle and repeatedly purified until a single colony was obtained. Finally, the isolated pure strain was placed in 20% glycerol and stored in a refrigerator at -80°C.
[0066] In this embodiment, seven bacterial strains were isolated, numbered 45326-3, 53279-5, 53279-2, WF-1, BL-3, 59620, and CN6-2. A phylogenetic tree was constructed for these seven strains, and the results are as follows: Figure 4 As shown.
[0067] Example 2: Strain Screening
[0068] (1) Initial screening of lignin-degrading strains
[0069] The lignin-degrading strains were initially screened using Tianqing B-HA2 medium. Specifically, the seven strains isolated and purified in Example 1 were inoculated into Tianqing B-HA2 identification medium and cultured at a constant temperature of 27°C. The strains were initially screened by observing the color change of the Tianqing B-HA2 medium.
[0070] (2) Initial screening results of lignin-degrading strains
[0071] Observation of the color changes in the identification medium revealed that strain number 59620 showed the most significant decolorization reaction to Azure B-HA2 medium. Specifically... Figure 1 As shown, the HA2 medium was yellow, and the Azure B-HA2 medium was grayish-blue. Fourteen days after inoculation with strain 59620, the Azure B-HA2 medium changed from grayish-blue to yellowish-green, exhibiting a significant fading phenomenon. This preliminarily indicates that the bacterium can secrete lignin oxidase and has the ability to degrade lignin. The decolorization reaction of the screening plates only preliminarily reflects the strain's ability to secrete lignin oxidase, and there is no significant positive correlation between the diameter of the decolorization zone and enzyme activity. Therefore, further lignin oxidase activity assays for strain 59620 are needed to evaluate the ability of the screened strain to secrete lignin oxidase.
[0072] Example 3: Strain Identification
[0073] Before assessing enzyme activity, the present invention identifies the morphology and species of strain 59620.
[0074] (1) Morphological identification of the strain
[0075] In a clean bench, a fresh agar block of strain 59620 obtained from Example 2 was cut using a sterile punch with a diameter of 6.0 mm and placed in the center of HA2 medium. The block was then incubated statically in a 27°C constant temperature incubator. The growth, morphology, and color of the colonies were observed in real time. Based on the colony culture characteristics and cell structure characteristics, a preliminary identification was made with reference to the "Handbook of Fungal Identification".
[0076] Strain morphological characteristics: On day 5 of culture on HA2 medium, the mycelium of the colony expanded rapidly; by day 7, the strain had completely covered the petri dish. The colonies were round, with a white, cottony surface, opaque, regular edges, and no spores were produced. Figure 2 As shown.
[0077] Growth characteristics of the strain: Ten uniformly sized mycelial discs were inoculated into sterilized HB2 medium and cultured in a shaker at 27℃ and 125 rpm / min. The mycelia agglomerated to form mycelial balls. In the initial stage of culture, the strain grew rapidly due to sufficient nutrients in the medium; however, with continued culture, mycelial growth was limited as nutrients were consumed and metabolic products were generated. The growth curve of the strain is shown below. Figure 3 As shown, the strain exhibited the fastest growth rate during the first 3 days of culture, slowed down from days 6 to 9, and stabilized after day 12. This growth dynamic characteristic is consistent with the temporal variation trend of lignin oxidase activity secreted by strain 59620 in HB2 medium (as shown in Example 4).
[0078] (2) Species identification of strains
[0079] The selected strains underwent molecular biological identification. Fungal DNA was extracted using a fungal genomic DNA extraction kit. Using the extracted genomic DNA as a template, PCR amplification was performed with primers ITS1 (TCCGTAGGTGAACCTGCGG, SEQ ID NO.2) and ITS4-R (TCCTCCGCTTATTGATATGC, SEQ ID NO.3). Sequencing was performed by Shanghai Sangon Biotech Co., Ltd. Sequencing analysis revealed that the ITS (internal transcribed spacer) sequence of the strain is shown in SEQ ID NO.1. Specific sequence information is as follows:
[0080] CCTGCGGAAGGATCATTATCGAGTTTTGAATGGGTTGTCTGCTGGCTCGCAAGGGCATGTGCACGCCTGTCTCATCCACTCTCAACTTCTGTGCACTTTTCATAGGCCGGCTTGTGGGTGCGTTCGCGCACTTGTAGGTGTCGGGCTTAT GCTTTACTACAAACGATTCAGTTTTAGAATGTCATACTTTGCTATAACGCAATTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATC ATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTCTCATGGAATTCTCAACCTTCAGCTTTATTGATGAAGGCTTGGACTTGGAGGTCGTGCCGGCTCTCGTAGTCGGCTCCTCTGAAATGCAT TAGTGCGAACGTACCAGCCGCTTCAGCGTGATAATTATCTGCGTTGCTGTGGAGGGTATTCTAGTGTTCACGCTTCTAACCGTCTTCGGACAAATTTCTGAACTCTGAGCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATC
[0081] The sequenced gene sequences were compared using a BLAST search in the NCBI GenBank database to identify strains most closely related to the target strain. Sequence similarity was calculated using MEGA 11 software, and a phylogenetic tree was constructed using the Neighbor-Joining method to determine the species' phylogenetic position. Figure 4 As shown. The results indicate that strain 59620 and Bjerkander is silent. WZ-199 clustered on the same branch, indicating a close phylum relation. Based on morphological characteristics (hyphae, spores, colony morphology), the strain was identified as belonging to the Basidiomycota (…). Basidiomycotina Polyporaceae ( Polyporaceae ) under the smoke tube bacteria ( Bjerkander is silent. ), named Bjerkander is silent. 59620.
[0082] Example 4 Enzyme Activity Assay of Strains 59620
[0083] In a sterile laminar flow hood, colonies of 59620 cells grown for 7 days in HA2 medium were ablated into mycelial discs using a sterilized 6.0 mm punch. Ten uniformly sized mycelial discs were inoculated into sterilized HB2 medium and cultured in a shaker at 27°C and 125 rpm / min. From day 0 to 18 post-inoculation, 2.0 mL of fermentation broth was extracted every 3 days, centrifuged at 4°C and 10000 rpm for 10 min to remove the precipitate, and the supernatant was collected. One mL of the supernatant was boiled in water for 10 min for inactivation, serving as a blank control. Enzyme activity was measured using a UV-Vis spectrophotometer. Enzyme activity was calculated as follows: the amount of enzyme required to oxidize 1 μmol of substrate per minute is defined as one enzyme activity unit (U).
[0084] (1) Lac activity assay
[0085] Using the ABTS method, laccase can catalyze the generation of ABTS radicals that exhibit a characteristic absorption peak at 420 nm (ε420 = 36000 L (mol·cm)). -1 Laccase activity can be assessed by the rate of change in absorbance. Before using a UV-Vis spectrophotometer, preheat it for approximately 30 minutes, set the wavelength to 420 nm, and zero it using distilled water. In a quartz cuvette, with a total reaction volume of 900 μL, add 600 μL of 0.1 mol·L⁻¹ laccase. -1 Acetic acid-sodium acetate buffer (pH 4.5), 150 μL 1 mol·L⁻¹ -1 2,2-Aza-bis(3-ethyl-benzothiazole-6-sulfonic acid) (ABTS) was preheated in a 30°C water bath for 3 min, and then 150 μL of crude enzyme solution was added to initiate the reaction. The absorbance at 420 nm was measured using a UV-Vis spectrophotometer over 3 min. Enzyme activity was calculated according to the definition of enzyme activity. Each treatment had three replicates. One unit of enzyme activity (U) is defined as the amount of enzyme required to oxidize 1 μmol of ABTS per minute. Figure 5 As shown, laccase activity reached its maximum value of 34.57 U / mL on day 6 of culture.
[0086] (2) Determination of manganese peroxidase (MnP) activity
[0087] Using the 2,6-DMP method, manganese peroxidase can oxidize 2,6-dimethylphenol (DMP) to generate 2,6-DMP cationic radicals with a characteristic absorption peak at 465 nm (ε465=49600 L(mol·cm)). -1The activity of manganese peroxidase was assessed by changes in absorbance. Before using the UV-Vis spectrophotometer, it was preheated for approximately 30 minutes, the wavelength was set to 465 nm, and zeroed using distilled water. In a quartz cuvette, the total reaction volume was 900 μL, and 450 μL of 50 mmol·L⁻¹ was added. -1 Tartaric acid-sodium tartrate buffer (pH 4.5), 150 μL 5 mmol·L⁻¹ -1 MnSO4, 150 μL 5 mmol·L -1 2,6-DMP and 120 μL of crude enzyme solution were preheated in a 30°C water bath for 3 min, and finally 30 μL of 4 mmol·L⁻¹ enzyme solution was added. -1 The reaction was initiated by H₂O₂. The absorbance at 469 nm was measured using a UV-Vis spectrophotometer over 3 minutes. Enzyme activity was calculated based on the definition of enzyme activity. Each treatment had three replicates. One unit of enzyme activity (U) is defined as the amount of enzyme required to oxidize 1 μmol of 2,6-DMP per minute. Figure 6 As shown, the manganese peroxidase activity reached its maximum value of 1495.65 U / mL on day 9 of culture.
[0088] (3) Assay of lignin peroxidase (LiP) activity
[0089] Using the resveratrol method, lignin peroxidase can oxidize resveratrol to generate veratral, which has a characteristic absorption peak at 310 nm (ε310=9300 L(mol·cm)). -1 The activity of lignin peroxidase was assessed by changes in absorbance. Before using the UV-Vis spectrophotometer, it was preheated for approximately 30 minutes, the wavelength was set to 310 nm, and zeroed using distilled water. In a quartz cuvette, the total reaction volume was 900 μL, and 450 μL of 50 mmol·L⁻¹ sodium chloride was added. -1 Tartaric acid-sodium tartrate buffer (pH 3.0), 300 μL 10 mmol·L⁻¹ -1 Resveratrol (VA) and 120 μL of crude enzyme solution were preheated in a 30°C water bath for 3 min, and finally 30 μL of 10 mmol·L⁻¹ enzyme solution was added. -1 The reaction was initiated by H₂O₂. The absorbance at 310 nm was measured using a UV-Vis spectrophotometer over 3 minutes, and enzyme activity was calculated according to the definition of enzyme activity. Each treatment had three replicates. One unit of enzyme activity (U) is defined as the amount of enzyme required to oxidize 1 μmol of resveratrol per minute. Lignin peroxidase activity was not detected in this experiment.
[0090] Example 5: Degradation of Kraft lignin by *Bacillus citrinum* 59620
[0091] (1) Determination of Kraft lignin decolorization rate
[0092] In a sterile laminar flow hood, colonies of *Fungiformis 59620* grown for 7 days in HA2 medium were dissected into mycelial cakes using a sterilized 6.0 mm punch. Ten uniformly sized mycelial cakes were inoculated into HB2 medium containing 0.2 g / 100 mL of kraft lignin and cultured at 27°C and 125 rpm / min in a shaker. From day 0 to 24 after incubation, 2.0 mL of culture medium was extracted every 3 days, centrifuged at 12000 rpm for 10 min, the precipitate was removed, and the supernatant was collected. 1 mL of the supernatant was added to 4 mL of PBS buffer (pH 7.6), and the absorbance of the sample at 465 nm was measured. The decolorization rate was calculated based on the absorbance change. Before using the UV-Vis spectrophotometer, it was preheated for approximately 30 min, the wavelength was set to 465 nm, and zeroed using distilled water. The corresponding control group was conducted under the same conditions without inoculation. Each treatment had three replicates.
[0093] The results of the decolorization rate of Kraft lignin by *Bacillus citrinum* 59620 are as follows: Figure 7 As shown, on day 24, the decolorization rate of kraft lignin by *Bacillus citrinum* 59620 reached 77.77%.
[0094] (2) Determination of Kraft lignin degradation rate
[0095] Consistent with the Kraft method for determining lignin decolorization, a certain amount of supernatant was taken and diluted 75 times with PBS buffer (pH 7.6), and the absorbance of the sample at 280 nm was measured. The lignin concentration was calculated based on the change in absorbance. Each treatment had three replicates.
[0096] The degradation rate of Kraft lignin by *Bacillus citrinum* 59620 is as follows: Figure 7 As shown, on day 24, the degradation rate of kraft lignin by *Bacillus citrinum* 59620 reached 47.49%.
[0097] (3) Morphological changes of kraft lignin before and after degradation
[0098] In a sterile laminar flow hood, colonies of *Bacillus citrinum* 59620 grown on HA2 medium for 7 days were ablated into mycelial cakes using a sterilized 6.0 mm punch. Ten mycelial cakes were inoculated into HB2 medium containing 0.2 g / 100 mL of kraft lignin as the sample group, and uninoculated mycelial cakes served as the control group. All mycelial cakes were incubated at 27°C and 125 rpm in a shaker. After 30 days of incubation, the samples were collected. Figure 8As shown, compared with before degradation, the color of the Kraft lignin medium containing the strain changed from dark brown to orange-yellow, indicating that the lignin has been degraded.
[0099] Kraft lignin was collected from HB2 culture medium, and the changes in the surface morphology of kraft lignin before and after degradation by *Cymbidium faberi* 59620 were examined using a GeminiSEM360 environmental scanning electron microscope. Figure 9 It can be seen that after degradation by *C. citrinum* 59620, the surface integrity of kraft lignin was disrupted, and its morphology changed from irregular spheres to irregular polyhedra. The particle size was significantly smaller than that of the undegraded kraft lignin before inoculation. The changes in the size and shape of kraft lignin particles indicate that kraft lignin was fully degraded by *C. citrinum* 59620.
[0100] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A strain of *Bacillus cibarius* ( Bjerkandera adusta )59620, deposited at the China General Microbiological Culture Collection Center, accession number CGMCC No.41892.
2. A microbial agent, said microbial agent containing the *Bacillus cirrhosa* as described in claim 1 (…). Bjerkandera adusta )59620 or Smoke tube bacteria ( Bjerkandera adusta )59620 fermentation broth.
3. The microbial agent according to claim 2, characterized in that, The microbial agent also includes an acceptable carrier, which is selected from solid or liquid carriers.
4. The microbial agent according to claim 2, characterized in that, The dosage form of the microbial agent is selected from any one of powder, granule or liquid preparation.
5. The microbial agent according to claim 2, characterized in that, The microbial agent is *Bacillus citrinum* (…). Bjerkandera adusta The fermentation broth of 59620 is prepared by the following method: To the smoke tube bacteria ( Bjerkandera adusta )59620 was inoculated into HB2 medium and cultured in a shaker at 25-27℃ and 125-150 rpm / min for 6-18 days to obtain the fermentation broth of Tobacco Tube Bacteria; The HB2 culture medium consists of the following components: 17.0 g of malt extract, 3.0 g of fungal peptone, and 1000 mL of distilled water, with a pH of 5.2-5.
6.
6. The *Bacillus septicemia* as described in claim 1 (… Bjerkandera adusta Application of 59620 in the production of lignin-degrading enzyme, wherein the lignin-degrading enzyme is selected from manganese peroxidase.
7. A method for preparing manganese peroxidase, the method comprising: The *Fungi* of claim 1 ( Bjerkandera adusta )59620 was inoculated into HB2 medium and cultured at 25-27℃ in a shaker at 125-150 rpm / min for 6-12 days. After centrifugation, the supernatant was collected, which contained manganese peroxidase. The HB2 culture medium consists of the following components: 17.0 g of malt extract, 3.0 g of fungal peptone, and 1000 mL of distilled water, with a pH of 5.2-5.
6.
8. Any of the following applications in the degradation of lignin: I) The *Bacterium tumefaciens* as described in claim 1 ( Bjerkandera adusta 59620; II) The microbial agent according to any one of claims 2-5; The lignin is kraft lignin.
9. Any of the following applications in lignin decolorization: I) The *Bacterium tumefaciens* as described in claim 1 ( Bjerkandera adusta 59620; II) The microbial agent according to any one of claims 2-5; The lignin is kraft lignin.
Citation Information
Patent Citations
Bjerkandera adusta G14 and application thereof
CN111925945A
Smoke pipe fungus strain and application thereof
CN117417839A