Mesh pathway product directed synthesis

Abstract

The invention relates to the technical field of biology, in particular to directional synthesis of a net-shaped path product. Compared with a method for converting a steroid substrate by using an endogenous path of natural microorganisms, the method disclosed by the invention has the advantages that under a yeast chassis, directional synthesis of node products can be realized by reconstructing an artificial heterologous reticular path and rationally combining path component proteins. The path conversion efficiency can be further improved through combined expression of path component homologous proteins with different catalytic specificity. Meanwhile, an artificial pregnenolone synthesis path is constructed under a microbial chassis, and specific downstream androstenedione synthesis path components are introduced, so that the androstenedione path node compound is directionally synthesized by taking a simple carbon source as a substrate.

Description

[0001] This application is a divisional application of the patent application submitted to the State Intellectual Property Office on December 30, 2022, with application number 202211741254.X and invention name "Directed Synthesis of Network Path Products". Technical Field

[0002] The present invention relates to the field of biotechnology, in particular to the directional synthesis of network pathway products. Background Art

[0003] In chordates, the steroid hormone synthesis pathway is composed of numerous non-specific catalytic enzymes, which can modify a variety of structurally similar substrates. Therefore, the enzymes often share multiple substrates. The cross-reactions between pathways ultimately make the steroid synthesis pathway present a complex network catalysis, which greatly increases the difficulty of microorganisms to heterologously synthesize intermediate node compounds in the network pathway.

[0004] Steroid hormones are a class of tetracyclic aliphatic hydrocarbons with a cyclopentahydrophenanthrene nucleus as their basic structure. This class of compounds is diverse, with over 400 steroidal drugs currently produced worldwide. They are widely used for their anti-inflammatory, anti-allergic, and endocrine-regulating properties. By 2017, global sales of steroid hormones reached $100 billion, making them the second-largest class of chemical drugs. The "pregnenolone-androstenedione" synthesis pathway, comprised of the CYP17-3β-HSD, lies at the intersection of the vertebrate steroid synthesis pathway and contains key precursors for numerous steroidal hormones (pregnenolone, progesterone, 17-hydroxyprogesterone, 17-hydroxypregnenolone, DHEA, androstenedione, and testosterone).

[0005] The development of steroid hormone intermediate production processes has progressed through stages, including plant-based saponin extraction, chemical synthesis, semi-synthesis, and novel microbial synthesis. Plant extraction and microbial transformation are the primary methods for producing steroid hormones. However, plant and animal extraction methods are costly, have limited sources, and are associated with environmental pollution. Chemical synthesis of steroid molecules also presents limitations, such as lengthy processes, complex reactions, and environmental pollution.

[0006] Compared to steroids isolated from animal sources, microbial steroid synthesis carries a lower risk of viral / prion contamination. It also avoids the tedious reaction steps involved in chemical synthesis. Previous studies have used Saccharomyces cerevisiae, Escherichia coli, and Yarrowia lipolytica to study the synthesis of pregnenolone and other steroids. Experiments with Saccharomyces cerevisiae have demonstrated the de novo synthesis of pregnenolone and its downstream product, hydrocortisone, from glucose. Pregnenolone has also been synthesized from the bioconversion of sterol substrates using Saccharomyces cerevisiae, E. coli, and Yarrowia lipolytica. Pregnenolone bioconversion has been achieved by introducing the P450scc catalytic system into Saccharomyces cerevisiae or E. coli and supplementing the culture medium with sterols, which are the direct substrates of the P450scc catalytic system. Sterol-feeding the culture medium of Saccharomyces lipolytica diploid chassis cells heterologously expressing the P450scc and P450c17 systems has enabled the bioconversion of sterols to produce pregnenolone or 17α-hydroxypregnenolone. However, the strong hydrophobicity of steroids, the poor robustness of commonly used microorganisms Mycobacteria, and the high cost of sterilization result in low microbial conversion efficiency.

[0007] Synthetic biology offers a new microbial synthesis method. The artificial construction of functional microorganisms with heterologous synthesis pathways enables the low-energy, high-efficiency, and environmentally friendly production of structurally specific steroid hormone drugs. Specific steroid compounds can be produced using only glucose, glycerol, and other carbon sources. In 1998, Catherine Duport et al. achieved the synthesis of campesterol by knocking out the native gene erg5 in Saccharomyces cerevisiae and introducing the exogenous gene DHCR7, providing a synthetic precursor for pregnenolone. Subsequently, the introduction of the bovine P450scc catalytic system and 3β-HSD enabled the de novo synthesis of progesterone using glucose as a substrate. In 2019, our research group, building on the high-yielding campesterol chassis, constructed an engineered lipolytic yeast strain capable of de novo synthesis of pregnenolone through enzyme source screening and promoter-assisted development. In 2003, Florence Ménard Szczebara et al. successfully achieved de novo hydrocortisone synthesis by knocking out ATF2 and simultaneously introducing CYP17A1, CYP21A1, and CYP11B1 in a high-progesterone-producing Saccharomyces cerevisiae strain. In 2019, patent US10400261B2, based on Saccharomyces cerevisiae, integrated multiple copies of the hydrocortisone pathway gene, generating a high-hydrocortisone-producing strain.

[0008] Corticosteroids, androgens, and estrogens have been widely used in the medical field. The synthesis of these downstream products in the animal steroid hormone synthesis pathway requires Δ 5 -To Δ 4 The process of conversion of -type steroids (Δ 5 - and Δ 4-: olefinic double bonds at positions 5.6 and 4.5, respectively). This process uses pregnenolone (P5) as a substrate and is catalyzed by 3β-hydroxysteroid dehydrogenase (3β-hsd) and 17α-hydroxylase / 17,20-lyase (Cyp17). CYP17 is catalyzed by Δ 5 - and Δ 4 -steroids as substrates, undergo 17α-hydroxylation modification, and under the condition of cytochrome b5 (Cyb5), CYP17 will show stronger 17,20-lyase activity (C17-C20 bond cleavage), CYP17 can; while 3β-HSD has isomerase activity, which can convert Δ 5 -steroids are converted to the corresponding Δ 4 -isomers, and achieve metabolic flux by Δ 5 -Path to Δ 4 -pathway migration. However, in the synthesis of Δ 4 -steroid production, due to the sharing of multiple substrates between CYP17 and 3β-HSD, 17α-hydroxylation, 17,20-cleavage and Δ 5 -Δ 4 Isomerization does not occur strictly sequentially, which gives the target Δ 4 -Steroids pose a big challenge.

[0009] Steroid hormones are often toxic to microorganisms. In an environment containing steroid compounds, microbial endogenous metabolism can modify the exogenous steroid nucleus (for example, by hydroxylation) to reduce its cytotoxicity. Leveraging this property, researchers have used the endogenous metabolism of microorganisms such as Mycobacterium as a medium to synthesize target steroids through biotransformation using sterols and steroidal intermediates as substrates.

[0010] The traditional use of microbial endogenous metabolism to biotransform steroid substrates to synthesize target steroids has the following disadvantages: ① The strong modification activity of traditional biotransformation microbial chassis on the steroid parent nucleus may not be suitable for the synthesis of specific target steroid compounds. At the same time, it may compete with the target synthesis pathway for steroid substrates, resulting in the accumulation of by-products and substrate loss. Therefore, it is more advantageous to use the Yarrowia lipolytica chassis with a relatively pure and clear metabolic background. ② In the endogenous modification pathways of steroids in traditional biotransformation microorganisms such as Mycobacterium, many key catalytic reaction-related genes are still unclear, which greatly increases the difficulty of pathway modification to achieve the directed synthesis of intermediate node products during the biotransformation process. Summary of the Invention

[0011] In view of this, the present invention provides a network-pathway-directed synthesis of products.

[0012] The present invention provides for the directed synthesis of products from a reticular pathway. Compared to the conversion of steroidal substrates using natural microbial endogenous pathways, the present invention utilizes a reconstructed artificial heterologous reticular pathway within a yeast chassis and rationally combines pathway component proteins to achieve the directed synthesis of node products. By combining and expressing homologous pathway component proteins with different catalytic specificities, pathway conversion efficiency can be further improved. Furthermore, by constructing an artificial pregnenolone synthesis pathway within a microbial chassis and introducing specific downstream androstenedione synthesis pathway components, the directed synthesis of androstenedione pathway node compounds using simple carbon sources as substrates can be achieved.

[0013] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0014] The present invention provides the use of any of the following expressions in the synthesis of steroid compounds and / or steroid hormone drugs:

[0015] (I), CYP17A1 and POR from Equus caballus, Ovis aries, Mesocricetus auratus or Xenopus laevis; and / or

[0016] (II), CYB5 from Equus caballus, Ovis aries, Mesocricetus auratus or Susscrofa; and / or

[0017] (III), 3β-HSD from Mus musculus, Bos taurus, Vaccinia virus, Arabidopsisthaliana, Mycobacterium tuberculosis, Homosapiens (type I), Homo sapiens (type II), Homosapiens (type I, L237S mutation), or Homosapiens (type II, L236S mutation); and / or

[0018] (IV), mCYP11A1 from Susscrofa.

[0019] In some specific embodiments of the present invention, the CYP17A1, POR, CYB5, 3β-HSD and / or mCYP11A1 are synthesized by codon optimization and addition of sequence 1 and / or sequence 2;

[0020] The codon optimization was performed using Yarrowia lipolytica;

[0021] The sequence 1 has a 5' end added, and the sequence 1 includes:

[0022] (I), the nucleotide sequence shown in SEQ ID NO: 1; or

[0023] (II) a nucleotide sequence encoding the same protein as the nucleotide sequence shown in (I) but differing from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or

[0024] (III) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and having the same or similar functions as the nucleotide sequence shown in (I) or (II); or

[0025] (IV) a nucleotide sequence having at least 80% sequence homology with the nucleotide sequence described in any one of (I) to (III);

[0026] The sequence 2 adds a 3' end, and the sequence 2 includes:

[0027] (I), the nucleotide sequence shown in SEQ ID NO: 2; or

[0028] (II) a nucleotide sequence encoding the same protein as the nucleotide sequence shown in (I) but differing from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or

[0029] (III) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and having the same or similar functions as the nucleotide sequence shown in (I) or (II); or

[0030] (IV) a nucleotide sequence having at least 80% sequence homology with the nucleotide sequence described in any one of (I) to (III);

[0031] The steroids include: pregnenolone, progesterone, 17-hydroxyprogesterone, 17-hydroxypregnenolone, dehydroepiandrosterone, androstenedione and / or testosterone;

[0032] In the conversion experiment using pregnenolone (P5) as the substrate, Vv_3β-HSD showed the highest pregnenolone conversion efficiency, with a conversion efficiency of 6.8%. The second strongest catalytic efficiency included type I human and mutant 3β-HSD, with a catalytic efficiency of 4.6-4.8%.

[0033] In the conversion experiment using 17-hydroxypregnenolone (17OHP5) as the substrate, the types I human 3β-HSD and its mutants, and the type II human 3β-HSD and its mutants showed strong conversion efficiency. The type I human 3β-HSD had the highest progesterone conversion rate of 3.1%.

[0034] Using dehydroepiandrosterone (DHEA) as a substrate, the catalytic activities of the 3β-HSDs of type II human, bovine, and mycobacterium origin are relatively strong; the conversion efficiency of the type II human 3β-HSD is 10.5%.

[0035] The present invention also provides a module, including any of the following expressions:

[0036] (I), CYP17A1 and POR from Equus caballus, Ovis aries, Mesocricetus auratus or Xenopus laevis; and / or

[0037] (II), CYB5 from Equus caballus, Ovis aries, Mesocricetus auratus, or Susscrofa; and / or

[0038] (III), 3β-HSD from Mus musculus, Bos taurus, Vaccinia virus, Arabidopsisthaliana, Mycobacterium tuberculosis, Homo sapiens (type I), Homo sapiens (type II), Homo sapiens (type I, L237S mutation), or Homo sapiens (type II, L236S mutation); and / or

[0039] (IV), mCYP11A1 from Sus scrofa.

[0040] Based on the above research, the present invention also provides a plasmid comprising the expression element.

[0041] The present invention also provides a host comprising the plasmid.

[0042] In some specific embodiments of the present invention, the host comprises one or more of module one, module two, module three, module four, module five, module six, module seven, module A, module B, module C or module D:

[0043] The module one comprises CYP17A1 and POR derived from Equus caballus, Ovis aries, Mesocricetus auratus or Xenopus laevis; the module one comprises an IntD integration site and / or a Leu2 tag with LoxP sites at both ends; and / or

[0044] The second module comprises CYB5 derived from Equus caballus, Ovis aries, Mesocricetus auratus or Susscrofa; the second module comprises an IntB integration site and / or a Ura3 tag; and / or

[0045] The module three comprises 3β-HSD derived from Mus musculus, Bos taurus, Vaccinia virus, Arabidopsis thaliana, Mycobacterium tuberculosis, Homo sapiens (type I), Homo sapiens (type II), Homo sapiens (type I, L237S mutation) or Homo sapiens (type II, L236S mutation); the vector connected to the module three comprises pINA1269-Nat; and / or

[0046] The module four comprises CYP17A1 and POR derived from Equus caballus; the module four comprises an IntF integration site and / or a Leu2 tag with LoxP sites at both ends; and / or

[0047] The module five comprises: CYP17A1 and POR derived from Ovis aries; the module five knocks out the Leu2 tag; and / or

[0048] The module six comprises: 3β-HSD derived from Homo sapiens (type II); the module six comprises an IntC integration site and / or a Leu2 tag with LoxP sites at both ends; and / or

[0049] The module seven comprises: CYP17A1 and POR derived from Mesocricetus auratus, 3β-HSD derived from Homo sapiens (type II) and 3β-HSD derived from Vaccinia virus; the CYP17A1 and POR comprise an IntD integration site and / or a Leu2 tag with LoxP sites at both ends; the vector to which the 3β-HSD derived from Vaccinia virus is connected comprises pINA1269-Nat; the vector to which the 3β-HSD derived from Homo sapiens (type II) is connected comprises pUC57-Kan-Simple; and / or

[0050] The module A comprises: CYP17A1 and POR derived from Equus caballus, Ovis aries, Mesocricetus auratus or Xenopus laevis; the module A comprises an IntD integration site and / or a Leu2 tag with LoxP sites at both ends; and / or

[0051] The module B comprises: CYB5 derived from Equus caballus, Ovis aries or Mesocricetus auratus; the module B comprises an IntB integration site and / or a Ura3 tag; and / or

[0052] The module C comprises: 3β-HSD derived from Mus musculus, Bos taurus, Vaccinia virus, Arabidopsis thaliana, Mycobacterium tuberculosis or Homo sapiens (type II) and mCYP11A1 derived from Sus scrofa; the vector to which the module C is connected comprises pINA1269; and / or

[0053] The module D includes: CYP17A1 and POR derived from Ovis aries and Mesocricetus auratus; the module D includes an IntF integration site and / or a Leu2 tag with LoxP sites at both ends.

[0054] In some specific embodiments of the present invention, the construction of module one includes: splicing the left arm of the IntD integration site and terminator 1; splicing the terminal sequence of terminator 2, the leucine nutritional screening tag Leu2 with LoxP sites at both ends, and the right arm of the IntD integration site to obtain IntD-L and IntD-R; connecting CYP17A1 and POR with the expression module after BsmBI digestion to obtain an integration plasmid, assembling CYP17A1 and POR modules with the same species source with pUC18H to obtain an integration plasmid, and obtaining module one after enzyme digestion;

[0055] The terminator 1 is the Saccharomyces cerevisiae GPM1t terminator; the terminator 2 is the Saccharomyces cerevisiae FBA1t;

[0056] The splicing method includes OE-PCR; the expression modules include TEF1inp-LIP2t-GPDt, GPDt-TEF1inp-OCT1t-FBA1t; the sources of the CYP17A1 and POR modules include Equus caballus, Ovis aries, Mesocricetus auratus or Xenopus laevis; the pUC18H is pUC18H digested with IntD-L, IntD, and HincII; the assembly method includes Gibson; and the enzyme digestion includes NotI digestion.

[0057] In some specific embodiments of the present invention, the construction of the module 2 includes: splicing the left arm of the IntB integration site, the tag, the right arm of the IntB integration site, the promoter, the terminator, and CYB5 to obtain an integration plasmid, and then performing enzyme digestion to obtain the module 2;

[0058] The tag includes the auxotrophic uracil tag Ura3; the promoter includes TEF1in; the terminator includes ACOt; the CYB5 source includes Equus caballus, Ovis aries, Mesocricetus auratus or Susscrofa; the splicing method includes Gibson; and the enzyme digestion includes NotI digestion.

[0059] In some specific embodiments of the present invention, the construction of module three includes: 3β-HSD is integrated into a vector by assembly, sequence 3 is introduced at the 5' end of the gene by PCR, and sequence 4 is introduced at the 3' end of the gene, and after linearization of the vector assembly, the recombinant plasmid is integrated, i.e., module three;

[0060] The 3β-HSD source includes Mus musculus, Bos taurus, Vaccinia virus, Arabidopsisthaliana, Mycobacterium tuberculosis, Homosapiens (type I), Homo sapiens (type II), Homosapiens (type I, L237S mutation) or Homosapiens (type II, L236S mutation);

[0061] The vector includes pINA1269-Nat;

[0062] The sequence 3 includes:

[0063] (I), the nucleotide sequence shown in SEQ ID NO: 3; or

[0064] (II) a nucleotide sequence encoding the same protein as the nucleotide sequence shown in (I) but differing from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or

[0065] (III) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and having the same or similar functions as the nucleotide sequence shown in (I) or (II); or

[0066] (IV) a nucleotide sequence having at least 80% sequence homology with the nucleotide sequence described in any one of (I) to (III);

[0067] The sequence 4 includes:

[0068] (I), the nucleotide sequence shown in SEQ ID NO: 3; or

[0069] (II) a nucleotide sequence encoding the same protein as the nucleotide sequence shown in (I) but differing from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or

[0070] (III) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and having the same or similar functions as the nucleotide sequence shown in (I) or (II); or

[0071] (IV) a nucleotide sequence having at least 80% sequence homology with the nucleotide sequence described in any one of (I) to (III);

[0072] The enzymes used for linearization include BamHI and KpnI;

[0073] The 3β-HSD derived from Homo sapiens (type I) has a higher activity and uses DHEA as its main substrate, while the 3β-HSD derived from Homo sapiens (type II) tends to use P5 and 17OHP5 as substrates.

[0074] In some specific embodiments of the present invention, the construction of module four includes: splicing the left arm of the IntF integration site, pUC18H, a leucine nutritional screening tag Leu2 with LoxP sites at both ends, the right arm of the IntF integration site, CYP17A1, and POR (the method is the same as that of module one) to obtain a fragment containing restriction sites at both ends, and then performing enzyme digestion to obtain module four;

[0075] The pUC18H is pUC18H digested with HincII;

[0076] The CYP17A1 and POR sources include Equus caballus;

[0077] The splicing method includes Gibson; the restriction enzyme site includes NotI; and the restriction enzyme cleavage includes NotI cleavage.

[0078] In some specific embodiments of the present invention, the construction of module five includes: knocking out the Leu2 selection marker of SyBE_Y12091004 to obtain SyBE_Y12091004 without the Leu2 tag;

[0079] The knockout method includes the Cre-loxP system.

[0080] In some specific embodiments of the present invention, the construction of module six includes: splicing the left arm of the IntC integration site, the artificial promoter hp8d, Hs_3β-HSD2, the Yarrowia lipolytica terminator OCTt, the leucine nutritional screening tag Leu2 with LoxP sites at both ends, and the right arm of the IntC integration site by the OE-PCR method to obtain a fragment containing NotI restriction sites at both ends; the above fragment is connected with the plasmid pUC57-Kan-Simple linearized with HindIII to obtain an integration plasmid.

[0081] In some specific embodiments of the present invention, the construction of module seven includes: simultaneously integrating module one expressing CYP17A1-POR from golden hamster (Mesocricetus auratus), module six, and module three expressing Vv_3β-HSD into ATCC201249.

[0082] In some specific embodiments of the present invention, the construction of module A includes: the construction of module A includes: the left arm of the IntD integration site and terminator 1 are spliced; the terminal sequence of terminator 2, the leucine nutritional screening tag Leu2 with LoxP sites at both ends, and the right arm of the IntD integration site are spliced ​​to obtain IntD-L and IntD-R; CYP17A1 and POR are connected to the expression module after BsmBI enzyme digestion, and the CYP17A1 and POR modules with the same species source are assembled with IntD-L, IntD-R, and pUC18H to obtain an integration plasmid, and module A is obtained after enzyme digestion;

[0083] The terminator 1 is the Saccharomyces cerevisiae GPM1t terminator; the terminator 2 is the Saccharomyces cerevisiae FBA1t;

[0084] The splicing method includes OE-PCR; the expression modules include TEF1inp-LIP2t-GPDt, GPDt-TEF1inp-OCT1t-FBA1t; the sources of the CYP17A1 and POR modules include Equus caballus, Ovis aries, Mesocricetus auratus or Xenopus laevis; the pUC18H is pUC18H digested with IntD-L, IntD, and HincII; the assembly method includes Gibson; and the enzyme digestion includes NotI digestion.

[0085] The integration plasmids include pIntD-Oa_CYP17-POR, pIntD-Ma_CYP17-POR, pIntD-Ec_CYP17-POR, and pIntD-Xl_CYP17-POR.

[0086] In some specific embodiments of the present invention, the construction of module B comprises: splicing the left arm of the IntB integration site, the tag, the right arm of the IntB integration site, the promoter, the terminator, and CYB5 to obtain an integration plasmid, and then performing enzyme digestion to obtain module B;

[0087] The tag includes an auxotrophic uracil tag Ura3; the promoter includes TEF1in; the terminator includes ACOt; the CYB5 source includes Equus caballus, Ovis aries or Mesocricetus auratus; the splicing method includes Gibson; and the enzyme digestion includes NotI digestion.

[0088] In some specific embodiments of the present invention, the construction of module C includes: integrating mCYP11A1 into an expression cassette with promoter 1, integrating 3β-HSD into an expression cassette with promoter 2, and assembling the mCYP11A1 expression cassette and the 3β-HSD expression cassette into a pINA1269 integration plasmid after enzyme digestion, and finally linearizing the plasmid after NotI digestion to obtain module C;

[0089] The mCYP11A1 source includes Susscrofa; the promoter 1 includes TEF1p; the 3β-HSD source includes Mus musculus, Bos taurus, Vaccinia virus, Arabidopsis thaliana, Mycobacterium tuberculosis or Homosapiens (type II); the promoter 2 includes EXP1p; the assembly method includes Gibson; the enzymes used for pINA1269 digestion include SalI and ClaI.

[0090] In some specific embodiments of the present invention, the construction of module D includes: splicing the left arm of the IntF integration site, pUC18H, a leucine nutritional screening tag Leu2 with LoxP sites at both ends, the right arm of the IntD integration site, CYP17A1, and the POR module to obtain a fragment containing restriction sites at both ends, and then performing enzyme digestion to obtain module D;

[0091] The pUC18H is pUC18H digested with HincII; the sources of the CYP17A1 and POR modules include Ovisaries and Mesocricetus auratus; the splicing method includes Gibson; the restriction enzyme cleavage site includes NotI; and the restriction enzyme cleavage includes NotI.

[0092] The present invention also provides the use of any of the following in the synthesis of steroid compounds and / or steroid hormone drugs:

[0093] (I), the expression element; and / or

[0094] (II), the plasmid; and / or

[0095] (III) the host.

[0096] In some specific embodiments of the present invention, the steroid compound and / or steroid hormone drug includes progesterone, pregnenolone, 17-hydroxypregnenolone, 17-hydroxyprogesterone, dehydroepiandrosterone, androstenedione and / or testosterone;

[0097] In some embodiments of the present invention, the progesterone is synthesized de novo in a microbial chassis using a carbon source and / or 3β-HSD.

[0098] In some embodiments of the present invention, the 17-hydroxyprogesterone is synthesized de novo in a microbial chassis using a carbon source, 3β-HSD, CYP17A1, and POR.

[0099] In some embodiments of the present invention, the 17-hydroxypregnenolone is synthesized de novo in a microbial chassis using a carbon source, CYP17A1, and POR.

[0100] In some embodiments of the present invention, the dehydroepiandrosterone is synthesized de novo in a microbial chassis using a carbon source, CYP17A1, POR and / or CYB5.

[0101] In some embodiments of the present invention, the androstenedione and testosterone are synthesized de novo in a microbial chassis using a carbon source, CYP17A1, POR, CYB5 and / or 3β-HSD.

[0102] In some specific embodiments of the present invention, the carbon source comprises glucose; the microbial chassis comprises the high-yielding campesterol Yarrowia lipolytica chassis strain SyBE_Y12060077 and / or the wild-type Yarrowia lipolytica strain ATCC201249;

[0103] The 3β-HSD source includes Mus musculus, Bos taurus, Vaccinia virus, Arabidopsisthaliana, Mycobacterium tuberculosis, Homosapiens (type I), Homo sapiens (type II), Homosapiens (type I, L237S mutation) or Homosapiens (type II, L236S mutation);

[0104] The CYP17A1 and POR sources include Equus caballus, Ovis aries, Mesocricetusauratus or Xenopus laevis;

[0105] The CYB5 sources include Equus caballus, Ovis aries, Mesocricetus auratus or Susscrofa.

[0106] In some specific embodiments of the present invention, the directed synthesis of androstenedione comprises co-culturing an upstream module expressing 3β-HSD and a downstream module expressing CYP17A1, POR and / or CYB5.

[0107] In some specific embodiments of the present invention, the source of the 3β-HSD comprises Bos taurus; the source of the CYP17A1, POR and / or CYB5 comprises Mycobacterium tuberculosis and / or Ovis aries;

[0108] In some specific embodiments of the present invention, the upstream module includes the module C;

[0109] The downstream module includes one or more of the module A, the module B, the module four, the module two or the module five.

[0110] In some specific embodiments of the present invention, the construction of the upstream module includes: the mCYP11A1 is expressed under promoter 1, the 3β-HSD is expressed under promoter 2, and both are integrated into the pBR322 site; the promoter 1 includes TEF1p; the promoter 2 includes EXP1p;

[0111] The construction of the downstream module includes: the CYP17A1 and POR are both expressed under the promoter and integrated into the IntD site of the chassis strain genome; the promoter includes TEF1inp; the chassis strain includes the high-yielding rape sterol Yarrowia lipolytica chassis strain SyBE_Yl2060077 and / or the wild-type Yarrowia lipolytica strain ATCC201249.

[0112] In some specific embodiments of the present invention, the combination with the highest directed synthesis of androstenedione includes a co-culture of a host expressing module C and a host expressing module five, module four and / or module two; the module C is selected from Bos taurus; and the module two is selected from Equus caballus.

[0113] In some embodiments of the present invention, the synthesis of 17-hydroxyprogesterone comprises co-culturing an upstream module that co-expresses the pregnenolone pathway and / or 3β-HSD with a downstream module that only expresses CYP17A1, CYB5, and POR.

[0114] In some specific embodiments of the present invention, the source of the 3β-HSD comprises Bos taurus; the source of the CYP17A1, POR and / or CYB5 comprises Mycobacterium tuberculosis and / or Ovis aries;

[0115] The combination with the highest synthesis of 17-hydroxyprogesterone includes co-culturing a host expressing module C with a host expressing module A and / or module B; module C is selected from Bos taurus; and module A and / or module B are selected from Ovis aries.

[0116] In some specific embodiments of the present invention, the CYP17A1 that efficiently 17α-hydroxylates steroidal substrates in the directed synthesis of androstenedione and / or the synthesis of 17-hydroxyprogesterone comprises a Mesocricetus auratus source and / or an Ovisaries source.

[0117] In some specific embodiments of the present invention, the CYP17A1 with efficient 17,20-cleavage activity for steroidal substrates in the directed synthesis of androstenedione and / or the synthesis of 17-hydroxyprogesterone comprises a Mesocricetus auratus source and / or an Equus caballus source.

[0118] In some specific embodiments of the present invention, P5 is used as a substrate to synthesize one or more of P4, 17OHP5, 17OHP4 or DHEA.

[0119] In some specific embodiments of the present invention, synthesizing P4 using P5 as a substrate includes expressing 3β-HSD; the source of 3β-HSD includes one or more of Vaccinia virus, Bos taurus, Mycobacterium tuberculosis, Homosapiens (type I) or Homosapiens (type II).

[0120] In some specific embodiments of the present invention, the synthesis of 17OHP5 using P5 as a substrate includes co-expressing CYP17A1 and POR; the sources of CYP17A1 and POR include Ovis aries and / or Mesocricetus auratus.

[0121] In some specific embodiments of the present invention, the synthesis of 17OHP4 using P5 as a substrate includes co-expressing 3β-HSD, CYP17A1 and POR; the source of 3β-HSD includes Homo sapiens (type II) and / or Vaccinia virus; the sources of CYP17A1 and POR include Ovis aries.

[0122] In some specific embodiments of the present invention, synthesizing DHEA using P5 as a substrate includes co-expressing CYP17A1, POR and / or CYB5; the sources of CYP17A1 and POR include Ovis aries and / or Equus caballus; and the source of CYB5 includes Equus caballus.

[0123] In some specific embodiments of the present invention, 17OHP4 is synthesized using 17OHP5 as a substrate.

[0124] In some specific embodiments of the present invention, the synthesis of 17OHP4 using 17OHP5 as a substrate includes expressing 3β-HSD; the source of 3β-HSD includes Homo sapiens (type I) and / or Homo sapiens (type II).

[0125] In some specific embodiments of the present invention, DHEA is synthesized using 17OHP5 as a substrate.

[0126] In some specific embodiments of the present invention, synthesizing DHEA using 17OHP5 as a substrate includes co-expressing CYP17A1, POR and / or CYB5; the sources of CYP17A1 and POR include Ovis aries; the source of CYB5 includes Mesocricetus auratus, Equus caballus or Susscrofa.

[0127] In some specific embodiments of the present invention, 4AD and TS are synthesized using DHEA as a substrate.

[0128] In some specific embodiments of the present invention, the synthesis of 17OHP4 using 17OHP5 as a substrate includes expressing 3β-HSD; the source of 3β-HSD includes one or more of Vaccinia virus, Mycobacterium tuberculosis, Homo sapiens (type I), Homo sapiens (type II), or Bos taurus;

[0129] In some specific embodiments of the present invention, 4AD and TS are synthesized from the 17OHP4.

[0130] In some specific embodiments of the present invention, the synthesis of 4AD and TS by 7OHP4 comprises co-expressing CYP17A1, POR and / or CYB5; the sources of CYP17A1 and POR include Mesocricetus auratus, Equus caballus or Ovisaries; the sources of CYB5 include Equus caballus, Ovis aries, Mesocricetus auratus or Susscrofa.

[0131] The present invention provides a method for achieving directed synthesis of complex network path node products by combining and expressing different path modules;

[0132] a) For example: directed synthesis of androstenedione (as described in Example 7);

[0133] b) For example, for the synthesis of 17-hydroxyprogesterone: the upstream module bacteria co-express the pregnenolone pathway and 3β-HSD; the downstream module bacteria only express CYP17A1, CYB5, and POR. Co-culturing the upstream and downstream modules can synthesize 17-hydroxyprogesterone from glucose.

[0134] Two CYP17A1s that can efficiently 17α-hydroxylate steroidal substrates in heterologous synthesis: Ma_CYP17A1 and Oa_CYP17A1;

[0135] Two CYP17A1s with efficient 17,20-cleavage activity on steroidal substrates in heterologous synthesis: Ma_CYP17A1 and Ec_CYP17A1;

[0136] Combinatorial expression of specific network pathway products in yeast chassis enables directed synthesis of node products;

[0137] a) Synthesis of P4 using P5 as substrate: expression of 3β-HSD;

[0138] b) Synthesis of 17OHP5 using P5 as substrate: co-expression of CYP17A1 and POR;

[0139] c) Synthesis of 17OHP4 using P5 as substrate: co-expression of 3β-HSD, CYP17A1, and POR;

[0140] d) Synthesis of DHEA using P5 as substrate: co-expression of CYP17A1, POR, and CYB5;

[0141] Combinatorial expression of homologous proteins with complementary catalytic specificities to construct efficient biotransformation pathways;

[0142] a) For the synthesis of P4 using P5 as substrate: single expression of Vv_3β-HSD;

[0143] b) For the synthesis of P4 using P5 as substrate: single expression of Bt_3β-HSD;

[0144] c) For the synthesis of P4 using P5 as substrate: single expression of Mt_3β-HSD;

[0145] d) For the synthesis of P4 using P5 as substrate: single expression of Hs_3β-HSD1 (type I human Hs_3β-HSD);

[0146] e) For the synthesis of P4 using P5 as substrate: single expression of Hs_3β-HSD2 (type II human Hs_3β-HSD);

[0147] f) For the synthesis of P4 using P5 as a substrate: Combined expression of 3β-HSD in a) to e);

[0148] g) For the synthesis of 17OHP4 using 17OHP5 as a substrate: single expression of Hs_3β-HSD1 (type I human Hs_3β-HSD);

[0149] h) For the synthesis of 17OHP4 using 17OHP5 as a substrate: single expression of Hs_3β-HSD2 (type II human Hs_3β-HSD);

[0150] i) For the synthesis of 17OHP4 using 17OHP5 as a substrate: combined expression of Hs_3β-HSD1 and Hs_3β-HSD2;

[0151] j) For the synthesis of 4AD and TS (testosterone) using DHEA as substrate: single expression of Vv_3β-HSD;

[0152] k) For the synthesis of 4AD and TS (testosterone) using DHEA as substrate: single expression of Mt_3β-HSD;

[0153] l) For the synthesis of 4AD and TS (testosterone) using DHEA as a substrate: single expression of Hs_3β-HSD1 (type I human Hs_3β-HSD);

[0154] m) For the synthesis of 4AD and TS (testosterone) using DHEA as a substrate: single expression of Hs_3β-HSD2 (type II human Hs_3β-HSD);

[0155] n) For the synthesis of 4AD and TS (testosterone) using DHEA as substrate: single expression of Bt_3β-HSD2;

[0156] o) For the synthesis of 4AD and TS (testosterone) using DHEA as a substrate: combined expression of 3β-HSD in j) to n);

[0157] p) For DHEA synthesis using P5 as substrate: co-expression of Oa_CYP17A1, Oa_POR, Ec_CYP17A1, Ec_POR, and Ec_CYB5;

[0158] q) For the synthesis of 17OHP4 using P5 as a substrate: co-expression of Hs_3β-HSD2 (type II human Hs_3β-HSD), Vv_3β-HSD, Oa_CYP17A1, and Oa_POR;

[0159] r) For the synthesis of 17OHP5 using P5 as a substrate: co-express Oa_CYP17A1 and Oa_POR;

[0160] s) For the synthesis of 17OHP5 using P5 as a substrate: co-expression of Ma_CYP17A1 and Ma_POR;

[0161] t) For the synthesis of 17OHP5 using P5 as a substrate: combined expression of CYP17A1 and POR in r) to s);

[0162] u) For DHEA synthesis by 17OHP5: co-expression of Oa_CYP17A1, Ma_CYB5, and Oa_POR;

[0163] v) For DHEA synthesis by 17OHP5: co-expression of Oa_CYP17A1, Ec_CYB5, and Oa_POR;

[0164] w) For DHEA synthesis by 17OHP5: co-expression of Oa_CYP17A1, Ss_CYB5, and Oa_POR;

[0165] x) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Ma_CYP17A1, Ss_CYB5, and Ma_POR;

[0166] y) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Ec_CYP17A1, Ss_CYB5, and Ec_POR;

[0167] z) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Oa_CYP17A1, Ss_CYB5, and Oa_POR;

[0168] aa) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Ma_CYP17A1, Ec_CYB5, and Ma_POR;

[0169] ab) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Ec_CYP17A1, Ec_CYB5, and Ec_POR;

[0170] ac) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Oa_CYP17A1, Ec_CYB5, and Oa_POR;

[0171] ad) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Ec_CYP17A1, Oa_CYB5, and Ec_POR;

[0172] ae) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Ec_CYP17A1, Ma_CYB5, and Ec_POR;

[0173] af) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Ma_CYP17A1, Oa_CYB5, and Ma_POR;

[0174] ag) For the synthesis of 4AD and TS (testosterone) by 17OHP4: Ma_CYP17A1, Ma_CYB5, and Ma_POR are co-expressed.

[0175] In some specific embodiments of the present invention, the combination with the highest directed synthesis of androstenedione includes a co-culture of a host expressing module C and a host expressing module five, module four and / or module two; the module C is selected from Bos taurus; and the module two is selected from Equus caballus.

[0176] In some specific embodiments of the present invention, in the conversion experiment using pregnenolone (P5) as the substrate, the one exhibiting the strongest pregnenolone conversion efficiency was Vv_3β-HSD; the conversion efficiency was 6.8%; the ones exhibiting the second strongest catalytic efficiency included type I human and mutant 3β-HSD; the catalytic efficiency was 4.6-4.8%;

[0177] In the conversion experiment using 17-hydroxypregnenolone (17OHP5) as the substrate, the types I human 3β-HSD and its mutants, and the type II human 3β-HSD and its mutants showed strong conversion efficiency. The type I human 3β-HSD had the highest progesterone conversion rate of 3.1%.

[0178] Using dehydroepiandrosterone (DHEA) as a substrate, the catalytic activities of the 3β-HSDs of type II human, bovine, and mycobacterium origin are relatively strong; the conversion efficiency of the type II human 3β-HSD is 10.5%.

[0179] In some specific embodiments of the present invention, the host includes strains SyBE_Yl2091001 to SyBE_Yl2091004 containing module one, strains SyBE_Yl2091005 to SyBE_Yl2091016 and SyBE_Yl2090013 to SyBE_Yl2090016 containing module one and module two, strain SyBE_Yl2091030 containing module five, module four and module two derived from Equuscaballus, and strain SyBE_Yl2090007 containing module seven, module six and module three derived from Vacciniavirus.

[0180] In some specific embodiments of the present invention, the strains SyBE_Yl2091001 to SyBE_Yl2091004 and SyBE_Yl2091005 to SyBE_Yl2091016 are cultured to direct the synthesis of 17-hydroxypregnenolone;

[0181] The SyBE_Y12091030 strain was cultivated to achieve efficient conversion of P5 to DHEA or 4AD and P4 to DHEA or 4AD; in the bioconversion with P5 as the substrate, the SyBE_Y12091030 strain synthesized 12.6 mg / L of DHEA, which was 7.32 times higher than that of the SyBE_Y12091016 strain; in the bioconversion with P4 as the substrate, the SyBE_Y12091030 strain achieved 13.9 mg / L of androstenedione synthesis, which was 86.2 times higher than that of the SyBE_Y12091016 strain;

[0182] The SyBE_Yl2090007 strain was cultured and directed to synthesize 17OHP4 using P5 as a substrate; the amount of 17OHP4 synthesized reached 3.90 mg / L.

[0183] In some specific embodiments of the present invention, the host further comprises an upstream module strain and a downstream module strain;

[0184] The upstream module strains include SyBE_Yl2090018, SyBE_Yl2090006, SyBE_Yl2091025 to SyBE_Yl2091028 containing the module three; the downstream module strains include SyBE_Yl2091006 containing the module A and module B and SyBE_Yl2091016 containing the module A and module B, and SyBE_Yl2091030.

[0185] In some specific embodiments of the present invention, progesterone is obtained by culturing the SyBE_Yl2090018, SyBE_Yl2090006, and SyBE_Yl2091025 to SyBE_Yl2091028 strains alone.

[0186] In some specific embodiments of the present invention, the SyBE_Yl2091025 and SyBE_Yl2091006 are co-cultured to synthesize 0.25 mg / L of 17-hydroxyprogesterone, 0.74 mg / L of 17-hydroxypregnenolone, and 0.88 mg / L of androstenedione.

[0187] In some specific embodiments of the present invention, the mixed co-culture system of SyBE_Yl2091025 and SyBE_Yl2091016 synthesizes 0.91 mg / L of 17-hydroxyprogesterone, 0.29 mg / L of 17-hydroxyprogesterone, and 1.03 mg / L of androstenedione.

[0188] In some specific embodiments of the present invention, the SyBE_Yl2091026-SyBE_Yl2091006 are mixed and co-cultured to synthesize 2.13 mg / L of dehydroepiandrosterone.

[0189] In some specific embodiments of the present invention, the SyBE_Yl2091025 and SyBE_Yl2091030 are co-cultured to synthesize 5.02 mg / L of androstenedione and 1.09 mg / L of testosterone with androstenedione as the main product.

[0190] In some specific embodiments of the present invention, module three in the SyBE_Yl2091025 is derived from Bostaurus; module three in the SyBE_Yl2091026 is derived from Vaccinia virus; module one and module two in the SyBE_Yl2091006 are derived from Mesocricetus auratus; and module one and module two in the SyBE_Yl2091016 are derived from Ovis aries.

[0191] The present invention also provides a drug comprising any of the following and pharmaceutically acceptable excipients or adjuvants:

[0192] (I), the expression element; and / or

[0193] (II), the plasmid; and / or

[0194] (III) the host.

[0195] The present invention also provides a pharmaceutical combination comprising the drug and any other effective ingredients.

[0196] The present invention also provides a method for synthesizing steroid compounds and / or steroid hormone drugs, comprising taking the host, culturing, and collecting the culture.

[0197] In some specific embodiments of the present invention, the method comprises:

[0198] (I) de novo synthesis of progesterone in a microbial chassis using a carbon source and / or 3β-HSD; and / or

[0199] (II) de novo synthesis of 17-hydroxyprogesterone in a microbial chassis using a carbon source, 3β-HSD, CYP17A1 and POR; and / or

[0200] (III) de novo synthesis of 17-hydroxypregnenolone in a microbial chassis using a carbon source, CYP17A1 and POR; and / or

[0201] (IV) de novo synthesis of dehydroepiandrosterone in a microbial chassis using a carbon source, CYP17A1, POR and / or CYB5; and / or

[0202] (V) de novo synthesis of androstenedione and testosterone in a microbial chassis using carbon sources, CYP17A1, POR, CYB5 and / or 3β-HSD; and / or

[0203] (VI) Directed synthesis of androstenedione: co-culturing an upstream module expressing 3β-HSD with a downstream module expressing CYP17A1, POR and / or CYB5; and / or

[0204] (VII) Synthesis of 17-hydroxyprogesterone: co-culture of upstream modules that co-express the pregnenolone pathway and / or 3β-HSD with downstream modules that only express CYP17A1, CYB5, and POR; and / or

[0205] (VIII) synthesizing one or more of P4, 17OHP5, 17OHP4 or DHEA using P5 as a substrate; and / or

[0206] (IX) synthesizing 17OHP4 using 17OHP5 as a substrate; and / or

[0207] (X) synthesizing DHEA using 17OHP5 as a substrate; and / or

[0208] (ⅩⅠ), synthesizing 4AD and TS using DHEA as a substrate; and / or

[0209] (XII) Synthesis of 4AD and TS using 17OHP4.

[0210] In some specific embodiments of the present invention, the carbon source comprises glucose; the microbial chassis comprises the high-yielding campesterol Yarrowia lipolytica chassis strain SyBE_Y12060077 and / or the wild-type Yarrowia lipolytica strain ATCC201249;

[0211] The 3β-HSD source includes Mus musculus, Bos taurus, Vaccinia virus, Arabidopsisthaliana, Mycobacterium tuberculosis, Homosapiens (type I), Homo sapiens (type II), Homosapiens (type I, L237S mutation) or Homosapiens (type II, L236S mutation);

[0212] The CYP17A1 and POR sources include Equus caballus, Ovis aries, Mesocricetusauratus or Xenopus laevis;

[0213] The CYB5 source includes Equus caballus, Ovis aries, Mesocricetus auratus or Susscrofa;

[0214] In some specific embodiments of the present invention, the source of the 3β-HSD comprises Bos taurus; the source of the CYP17A1, POR and / or CYB5 comprises Mycobacterium tuberculosis and / or Ovis aries.

[0215] In some specific embodiments of the present invention, the upstream module includes the module C;

[0216] The downstream module includes one or more of the module A, the module B, the module four, the module two or the module five.

[0217] In some specific embodiments of the present invention, the construction of the upstream module includes: the mCYP11A1 is expressed under promoter 1, the 3β-HSD is expressed under promoter 2, and both are integrated into the pBR322 site; the promoter 1 includes TEF1p; the promoter 2 includes EXP1p;

[0218] The construction of the downstream module includes: the CYP17A1 and POR are both expressed under the promoter and integrated into the IntD site of the chassis strain genome; the promoter includes TEF1inp; the chassis strain includes the high-yielding rape sterol Yarrowia lipolytica chassis strain SyBE_Yl2060077 and / or the wild-type Yarrowia lipolytica strain ATCC201249.

[0219] In some specific embodiments of the present invention, the combination with the highest directed synthesis of androstenedione includes a co-culture of a host expressing module C and a host expressing module five, module four and / or module two; the module C is selected from Bos taurus; and the module two is selected from Equus caballus.

[0220] In some specific embodiments of the present invention, the source of the 3β-HSD comprises Bos taurus; the source of the CYP17A1, POR and / or CYB5 comprises Mycobacterium tuberculosis and / or Ovis aries;

[0221] The combination with the highest synthesis of 17-hydroxyprogesterone includes co-culturing a host expressing module C with a host expressing module A and / or module B; module C is selected from Bos taurus; and module A and / or module B are selected from Ovis aries.

[0222] In some specific embodiments of the present invention, the CYP17A1 that efficiently 17α-hydroxylates steroidal substrates in the directed synthesis of androstenedione and / or the synthesis of 17-hydroxyprogesterone comprises a Mesocricetus auratus source and / or an Ovisaries source.

[0223] In some specific embodiments of the present invention, the CYP17A1 with high 17,20-cleavage activity for steroidal substrates in the directed synthesis of androstenedione and / or the synthesis of 17-hydroxyprogesterone comprises a Mesocricetus auratus source and / or an Equus caballus source;

[0224] In some specific embodiments of the present invention, the synthesis of P4 using P5 as a substrate includes expressing 3β-HSD; the source of 3β-HSD includes one or more of Vaccinia virus, Bos taurus, Mycobacterium tuberculosis, Homosapiens (type I) or Homosapiens (type II).

[0225] In some specific embodiments of the present invention, the synthesis of 17OHP5 using P5 as a substrate includes co-expressing CYP17A1 and POR; the sources of CYP17A1 and POR include Ovis aries and / or Mesocricetus auratus.

[0226] In some specific embodiments of the present invention, the synthesis of 17OHP4 using P5 as a substrate includes co-expression of 3β-HSD, CYP17A1 and POR; the source of 3β-HSD includes Homo sapiens (type II) and / or Vaccinia virus; the source of CYP17A1 and POR includes Ovis aries.

[0227] In some specific embodiments of the present invention, the synthesis of DHEA using P5 as a substrate includes co-expression of CYP17A1, POR and / or CYB5; the sources of CYP17A1 and POR include Ovis aries and / or Equus caballus; the source of CYB5 includes Equus caballus.

[0228] In some specific embodiments of the present invention, the synthesis of 17OHP4 using 17OHP5 as a substrate includes expressing 3β-HSD; the source of 3β-HSD includes Homo sapiens (type I) and / or Homo sapiens (type II).

[0229] In some specific embodiments of the present invention, the synthesis of DHEA using 17OHP5 as a substrate includes co-expression of CYP17A1, POR and / or CYB5; the sources of CYP17A1 and POR include Ovis aries; the source of CYB5 includes Mesocricetus auratus, Equus caballus or Susscrofa.

[0230] In some specific embodiments of the present invention, the synthesis of 17OHP4 using 17OHP5 as a substrate includes expressing 3β-HSD; the source of 3β-HSD includes one or more of Vaccinia virus, Mycobacterium tuberculosis, Homo sapiens (type I), Homo sapiens (type II) or Bos taurus.

[0231] In some specific embodiments of the present invention, the synthesis of 4AD and TS by 7OHP4 includes co-expression of CYP17A1, POR and / or CYB5; the sources of CYP17A1 and POR include Mesocricetus auratus, Equus caballus or Ovisaries; the sources of CYB5 include Equus caballus, Ovis aries, Mesocricetus auratus or Susscrofa.

[0232] The present invention provides a method for achieving directed synthesis of complex network path node products by combining and expressing different path modules:

[0233] a) For example: directed synthesis of androstenedione (as described in Example 7);

[0234] b) For example, for the synthesis of 17-hydroxyprogesterone: the upstream module bacteria co-express the pregnenolone pathway and 3β-HSD; the downstream module bacteria only express CYP17A1, CYB5, and POR. Co-culturing the upstream and downstream modules can synthesize 17-hydroxyprogesterone from glucose.

[0235] Two CYP17A1s that can efficiently 17α-hydroxylate steroidal substrates in heterologous synthesis: Ma_CYP17A1 and Oa_CYP17A1;

[0236] Two CYP17A1s with efficient 17,20-cleavage activity on steroidal substrates in heterologous synthesis: Ma_CYP17A1 and Ec_CYP17A1;

[0237] Combinatorial expression of specific network pathway products in yeast chassis enables directed synthesis of node products;

[0238] a) Synthesis of P4 using P5 as substrate: expression of 3β-HSD;

[0239] b) Synthesis of 17OHP5 using P5 as substrate: co-expression of CYP17A1 and POR;

[0240] c) Synthesis of 17OHP4 using P5 as substrate: co-expression of 3β-HSD, CYP17A1, and POR;

[0241] d) Synthesis of DHEA using P5 as substrate: co-expression of CYP17A1, POR, and CYB5;

[0242] Combinatorial expression of homologous proteins with complementary catalytic specificities to construct efficient biotransformation pathways;

[0243] a) For the synthesis of P4 using P5 as substrate: single expression of Vv_3β-HSD;

[0244] b) For the synthesis of P4 using P5 as substrate: single expression of Bt_3β-HSD;

[0245] c) For the synthesis of P4 using P5 as substrate: single expression of Mt_3β-HSD;

[0246] d) For the synthesis of P4 using P5 as substrate: single expression of Hs_3β-HSD1 (type I human Hs_3β-HSD);

[0247] e) For the synthesis of P4 using P5 as substrate: single expression of Hs_3β-HSD2 (type II human Hs_3β-HSD);

[0248] f) For the synthesis of P4 using P5 as a substrate: Combined expression of 3β-HSD in a) to e);

[0249] g) For the synthesis of 17OHP4 using 17OHP5 as a substrate: single expression of Hs_3β-HSD1 (type I human Hs_3β-HSD);

[0250] h) For the synthesis of 17OHP4 using 17OHP5 as a substrate: single expression of Hs_3β-HSD2 (type II human Hs_3β-HSD);

[0251] i) For the synthesis of 17OHP4 using 17OHP5 as a substrate: combined expression of Hs_3β-HSD1 and Hs_3β-HSD2;

[0252] j) For the synthesis of 4AD and TS (testosterone) using DHEA as substrate: single expression of Vv_3β-HSD;

[0253] k) For the synthesis of 4AD and TS (testosterone) using DHEA as substrate: single expression of Mt_3β-HSD;

[0254] l) For the synthesis of 4AD and TS (testosterone) using DHEA as a substrate: single expression of Hs_3β-HSD1 (type I human Hs_3β-HSD);

[0255] m) For the synthesis of 4AD and TS (testosterone) using DHEA as a substrate: single expression of Hs_3β-HSD2 (type II human Hs_3β-HSD);

[0256] n) For the synthesis of 4AD and TS (testosterone) using DHEA as substrate: single expression of Bt_3β-HSD2;

[0257] o) For the synthesis of 4AD and TS (testosterone) using DHEA as a substrate: combined expression of 3β-HSD in j) to n);

[0258] p) For DHEA synthesis using P5 as substrate: co-expression of Oa_CYP17A1, Oa_POR, Ec_CYP17A1, Ec_POR, and Ec_CYB5;

[0259] q) For the synthesis of 17OHP4 using P5 as a substrate: co-expression of Hs_3β-HSD2 (type II human Hs_3β-HSD), Vv_3β-HSD, Oa_CYP17A1, and Oa_POR;

[0260] r) For the synthesis of 17OHP5 using P5 as a substrate: co-express Oa_CYP17A1 and Oa_POR;

[0261] s) For the synthesis of 17OHP5 using P5 as a substrate: co-expression of Ma_CYP17A1 and Ma_POR;

[0262] t) For the synthesis of 17OHP5 using P5 as a substrate: combined expression of CYP17A1 and POR in r) to s);

[0263] u) For DHEA synthesis by 17OHP5: co-expression of Oa_CYP17A1, Ma_CYB5, and Oa_POR;

[0264] v) For DHEA synthesis by 17OHP5: co-expression of Oa_CYP17A1, Ec_CYB5, and Oa_POR;

[0265] w) For DHEA synthesis by 17OHP5: co-expression of Oa_CYP17A1, Ss_CYB5, and Oa_POR;

[0266] x) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Ma_CYP17A1, Ss_CYB5, and Ma_POR;

[0267] y) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Ec_CYP17A1, Ss_CYB5, and Ec_POR;

[0268] z) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Oa_CYP17A1, Ss_CYB5, and Oa_POR;

[0269] aa) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Ma_CYP17A1, Ec_CYB5, and Ma_POR;

[0270] ab) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Ec_CYP17A1, Ec_CYB5, and Ec_POR;

[0271] ac) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Oa_CYP17A1, Ec_CYB5, and Oa_POR;

[0272] ad) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Ec_CYP17A1, Oa_CYB5, and Ec_POR;

[0273] ae) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Ec_CYP17A1, Ma_CYB5, and Ec_POR;

[0274] af) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Ma_CYP17A1, Oa_CYB5, and Ma_POR;

[0275] ag) For the synthesis of 4AD and TS (testosterone) by 17OHP4: Ma_CYP17A1, Ma_CYB5, and Ma_POR are co-expressed.

[0276] Specifically, the method for synthesizing steroid compounds and / or steroid hormone drugs comprises: culturing the host, adding a steroid substrate mother solution for incubation, and quantifying pregnenolone (P5), progesterone (P4), 17-hydroxypregnenolone (17OHP5), 17-hydroxyprogesterone (17OHP4), dehydroepiandrosterone (DHEA), androstenedione (4AD) or testosterone (TS);

[0277] The culturing includes culturing in a seed culture medium, a biotransformation culture medium or a YPD fermentation culture medium;

[0278] The seed culture medium comprises: 20 g / L glucose, 20 g / L peptone, and 10 g / L yeast extract powder; the seed culture medium is cultured at a temperature of 30° C., a rotation speed of 220 rpm, and a culture time of 14 to 16 hours;

[0279] The formula of the biotransformation medium includes: 20g / L glucose, 20g / L peptone, and 10g / L yeast extract powder; the culture temperature of the biotransformation medium is 28°C, the rotation speed is 220rpm, and the culture time is 24h;

[0280] The YPD fermentation medium comprises: 50 g / L glucose, 20 g / L peptone, and 10 g / L yeast extract powder; the culture temperature using the YPD fermentation medium is 28° C., the rotation speed is 220 rpm, and the culture time is 8 days;

[0281] The synthesis of the steroid compounds includes 3β-HSD isomerization conversion, 17-hydroxylation conversion, 17,20-cleavage conversion, DHEA synthesis and / or 4AD synthesis.

[0282] The steroid substrate mother liquor added to the 3β-HSD isomerization conversion includes P4 and 17OHP4 solutions; the concentration of the P4 and 17OHP4 solutions is 1.75 g / L (50% EtOH-Tween80);

[0283] The steroid substrate mother solution added to the 17-hydroxylation conversion includes P4 and P5 solutions; the concentration of the P4 and P5 solutions is 1.75 g / L (50% EtOH-Tween80);

[0284] The steroid substrate mother solution added to the 17,20-cleavage conversion includes 17OHP4 and 17OHP5 solutions; the concentration of the 17OHP4 and 17OHP5 solutions is 1.75 g / L (50% EtOH-Tween80);

[0285] The steroid substrate mother solution added to the DHEA synthesis includes P5 solution; the concentration of the P5 solution is 3.5 g / L (50% EtOH-Tween80);

[0286] The steroid substrate mother solution added to the 4AD synthesis includes a P4 solution; the concentration of the P4 solution is 3.5 g / L (50% EtOH-Tween80);

[0287] The method for quantifying pregnenolone comprises: taking the cultured host, centrifuging, resuspending, boiling, adding a saponification reaction solution to react, adding an extraction solvent, concentrating, and detecting;

[0288] The centrifugal speed is 12000g, and the centrifugation time is 2 minutes. The resuspension solution is hydrochloric acid, and the concentration of the hydrochloric acid is 3 mol / L. The boiling temperature is 100°C. The saponification reaction solution is a potassium hydroxide-methanol solution, and the concentration of the potassium hydroxide-methanol solution is 2 mol / L. The extraction solvent is n-hexane. The concentration is performed using a vacuum centrifugal concentrator, and the concentration temperature is 25°C, the time is 30 minutes, and the speed is 7000 rpm.

[0289] The method for quantifying progesterone, 17-hydroxypregnenolone, 17-hydroxyprogesterone, DHEA or androstenedione comprises: taking a cultured host, adding glass beads and an extraction solvent, concentrating, and detecting;

[0290] The extraction solvent is ethyl acetate; the concentration temperature is 25° C., the time is 1200 min, and the rotation speed is 7000 rpm.

[0291] The present invention provides a network-pathway product-directed synthesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0292] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for describing the embodiments or the prior art.

[0293] Figure 1 The synthesis pathway of androstenedione from pregnenolone in Example 1 is shown;

[0294] Figure 2 Synthesis of progesterone from pregnenolone in Example 1;

[0295] Figure 3 Synthesis of dehydroepiandrosterone from pregnenolone in Example 1;

[0296] Figure 4 Synthesis of 17-hydroxyprogesterone from pregnenolone in Example 1;

[0297] Figure 5 Synthesis of 17-hydroxypregnenolone from pregnenolone in Example 1;

[0298] Figure 6 The isomerization efficiency of 3β-HSD from different sources in Example 1 is shown using pregnenolone, 17-hydroxypregnenolone, and DHEA as substrates in the context of yeast lipolytica.

[0299] Figure 7The figures show the 17α-hydroxylation efficiency of CYP17A1 from different sources with pregnenolone and progesterone as substrates in the context of Saccharomyces lipolytica in Example 2; the left figure shows the 17α-hydroxylation efficiency of CYP17A1 from different sources with pregnenolone as substrate in the context of Saccharomyces lipolytica; the right figure shows the 17α-hydroxylation efficiency of CYP17A1 from different sources with progesterone as substrate in the context of Saccharomyces lipolytica;

[0300] Figure 8 The figures show the 17,20-cleavage efficiency of different CYP17A1 and CYB5 source combinations with 17-hydroxypregnenolone and 17-hydroxyprogesterone as substrates in the context of lipolytica in Example 2; wherein the left figure shows the 17,20-cleavage efficiency of different CYP17A1 and CYB5 source combinations with 17-hydroxypregnenolone as substrate in the context of lipolytica; the right figure shows the 17,20-cleavage efficiency of different CYP17A1 and CYB5 source combinations with 17-hydroxyprogesterone as substrate in the context of lipolytica;

[0301] Figure 9 The efficiency of synthesizing dehydroepiandrosterone by the recombinant strain in Example 3 using pregnenolone as a substrate is shown;

[0302] Figure 10 The figure shows the production of androstenedione synthesized by the recombinant strain in Example 3 using progesterone as a substrate; wherein the left figure shows SyBE_Yl2091016; the right figure shows SyBE_Yl2091030;

[0303] Figure 11 In Example 4, strain SyBE_Y12090007 synthesizes 17-hydroxyprogesterone using pregnenolone as a substrate;

[0304] Figure 12 The results of Example 5 show the effects of 3β-HSD from different sources on the synthesis of progesterone in recombinant yeast;

[0305] Figure 13 The graph shows the yield of androstenedione synthesized by the mixed bacteria system in Example 6 (bar graph); wherein, the left graph shows the yield of androstenedione synthesized by the mixed bacteria SyBE_Y12091025-SyBE_Y12091016; the right graph shows the yield of androstenedione synthesized by the mixed bacteria SyBE_Y12091025-SyBE_Y12091006;

[0306] Figure 14 The mixed bacteria synthesis of dehydroepiandrosterone in Example 7 is shown;

[0307] Figure 15The figure shows the efficiency of 17α-hydroxylation and 17,20-cleavage catalyzed by CYP17A1 and CYB5 components from different sources in the biotransformation test in Example 8. The left figure shows the efficiency of 17α-hydroxylation catalyzed by P4 as a substrate, and the right figure shows the efficiency of 17,20-cleavage catalyzed by 17OHP4 as a substrate.

[0308] Figure 16 The figure shows the yield of 4AD synthesized from scratch by the mixed bacteria system in Example 8 (bar graph); wherein, the left figure shows the yield of 4AD synthesized from scratch by the mixed bacteria SyBE_Yl2091025-SyBE_Yl2091016; the right figure shows the yield of 4AD synthesized from scratch by the mixed bacteria SyBE_Yl2091025-SyBE_Yl2091030. DETAILED DESCRIPTION

[0309] The present invention discloses a reticular pathway product directed synthesis, and those skilled in the art can refer to the contents of this article and appropriately improve the process parameters to achieve it. It is particularly important to point out that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0310] This invention, using the targeted synthesis of androstenedione pathway node products in Yarrowia lipolytica as an example, provides a method for decoupling network pathways within a microbial chassis to achieve the targeted synthesis of target compounds. Briefly, the invention utilizes: ① the Yarrowia lipolytica chassis; ② enzyme-catalyzed substrate specificity to construct a hormone-steroid synthesis pathway; ③ selective expression of pathway component proteins to construct the synthesis pathway based on the synthesis needs of the target compound; and ④ de novo synthesis of steroid hormone compounds using the microbial chassis. By combining and optimizing these methods, efficient synthesis of specific target steroids in a microbial system is achieved.

[0311] As an unconventional yeast, Yarrowia lipolytica offers the following advantages for steroid synthesis: ① Its genome sequence is known, allowing for genetic manipulation and high proliferation capacity, facilitating metabolic engineering and large-scale production. ② Acetyl-CoA, a precursor for steroid synthesis, has a high metabolic flux in Y. lipolytica, facilitating steroid synthesis. ③ This species exhibits high levels of heterologous protein expression after metabolic engineering. Furthermore, its post-transcriptional glycosylation patterns are more similar to those of mammalian cells than those of Saccharomyces cerevisiae, facilitating the expression of mammalian-derived proteins and, consequently, the synthesis of animal-derived steroids. ④ Its GRAS (generally regarded as safe) safety rating makes it a viable candidate for use as a substrate for drug synthesis. ⑤ Y. lipolytica has a broad substrate spectrum, utilizing oils in addition to glucose, allowing it to utilize industrial byproducts and waste products for the production of desired products. ⑥ When Y. lipolytica utilizes oil as a carbon source, the accumulation of intracellular lipids leads to larger lipid droplets, providing storage space for non-polar products (such as steroids), thereby alleviating the burden of product accumulation on the cell. ⑦ Compared with Saccharomyces cerevisiae, the traditional host for heterologous steroid synthesis, Saccharomyces lipolytica does not have a homologous gene for ATF2 (alcohol O-acetyltransferase), which causes steroid esterification in Saccharomyces cerevisiae and hinders further biotransformation of steroids in the cell.

[0312] In the present invention, under the yeast chassis with a relatively pure and clear metabolic background, the exogenous steroid synthesis pathway is orthogonal to the endogenous metabolism of the microorganism, so that steroid biotransformation can be carried out in a relatively pure background, and the directional synthesis of intermediate node products can be better achieved.

[0313] The exploration of de novo synthesis of steroid hormone compounds using microorganisms is relatively limited. The present invention realizes the directed synthesis of androstenedione network pathway node products using simple carbon sources.

[0314] The construction of artificial synthetic pathways can achieve the directed synthesis of pathway node compounds and pathway flux enhancement by combining and heterologously expressing different catalytic specific proteins.

[0315] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a method for achieving directed synthesis of a target compound.

[0316] The present invention provides the following:

[0317] 1. Construct artificial pathways in the microbial chassis to achieve steroid compound synthesis.

[0318] 2. Construct an artificial pathway in the Yarrowia lipolytica chassis to achieve steroid compound synthesis.

[0319] 3. A method for synthesizing 17-hydroxyprogesterone de novo in a microbial environment by using the combined expression of nine 3β-HSDs and four CYP17A1s in Example 1.

[0320] 4. Method for synthesizing 17-hydroxypregnenolone de novo in a microbial environment using the four CYP17A1 species in the table of Example 1 using combined expression.

[0321] 5. A method for synthesizing de novo dehydroepiandrosterone in a microbial environment by using the combined expression of the four CYP17A1s and four CYB5s in the table of Example 1.

[0322] 6. A method for synthesizing androstenedione and testosterone de novo in a microbial environment by using the combined expression of the four CYP17A1s, four CYB5s, and nine 3β-HSDs in the table of Example 1.

[0323] 7. A method for synthesizing 17-hydroxyprogesterone de novo in the Yarrowia lipolytica chassis by using the combined expression of the nine 3β-HSDs and four CYP17A1s in the table of Example 1.

[0324] 8. A method for synthesizing 17-hydroxypregnenolone de novo in a Yarrowia lipolytica chassis using the four CYP17A1 proteins in the table of Example 1.

[0325] 9. A method for synthesizing de novo dehydroepiandrosterone in the Yarrowia lipolytica chassis by using the combined expression of the four CYP17A1s and four CYB5s in the table of Example 1.

[0326] 10. A method for de novo synthesis of androstenedione and testosterone in the Yarrowia lipolytica chassis by using the combined expression of the four CYP17A1s, four CYB5s, and nine 3β-HSDs in the table of Example 1.

[0327] 11. A method for constructing an engineered bacterium that can synthesize progesterone from scratch using bovine 3β-HSD.

[0328] 12. A method for constructing an engineered bacterium that can synthesize progesterone from scratch using human 3β-HSD.

[0329] 13. A method for constructing an engineered bacterium that can synthesize progesterone from scratch using a simple carbon source by using 3β-HSD derived from cowpox virus.

[0330] 14. A method for constructing an engineered bacterium that can synthesize progesterone from scratch using a simple carbon source by using Mycobacterium-derived 3β-HSD.

[0331] 15. A method for achieving directed synthesis of complex network path node products by combining different path modules.

[0332] a) For example: Directed synthesis of androstenedione (as described in Example 7)

[0333] b) For example, for the synthesis of 17-hydroxyprogesterone: the upstream module bacteria co-express the pregnenolone pathway and 3β-HSD; the downstream module bacteria only express CYP17A1, CYB5, and POR. Co-culturing the upstream and downstream modules allows the synthesis of 17-hydroxyprogesterone from glucose.

[0334] 16. Two CYP17A1s that can efficiently 17α-hydroxylate steroidal substrates in heterologous synthesis: Ma_CYP17A1 and Oa_CYP17A1

[0335] 17. Two CYP17A1s with high 17,20-cleavage activity for steroidal substrates in heterologous synthesis: Ma_CYP17A1 and Ec_CYP17A1

[0336] 18. Combinatorial expression of specific network pathway products in the yeast chassis enables directed synthesis of node products.

[0337] a) Synthesis of P4 using P5 as substrate: Expression of 3β-HSD

[0338] b) Synthesis of 17OHP5 using P5 as substrate: Co-expression of CYP17A1 and POR

[0339] c) Synthesis of 17OHP4 using P5 as substrate: Co-expression of 3β-HSD, CYP17A1, and POR

[0340] d) Synthesis of DHEA using P5 as substrate: Co-expression of CYP17A1, POR, and CYB5

[0341] 19. Combined expression of homologous proteins with complementary catalytic specificities to construct efficient biotransformation pathways

[0342] a) For the synthesis of P4 using P5 as substrate: Single expression of Vv_3β-HSD

[0343] b) For the synthesis of P4 using P5 as substrate: single expression of Bt_3β-HSD

[0344] c) For the synthesis of P4 using P5 as substrate: single expression of Mt_3β-HSD

[0345] d) For the synthesis of P4 using P5 as a substrate: Single expression of Hs_3β-HSD1 (type I human Hs_3β-HSD)

[0346] e) For the synthesis of P4 using P5 as a substrate: Single expression of Hs_3β-HSD2 (type II human Hs_3β-HSD)

[0347] f) For the synthesis of P4 using P5 as a substrate: Combined expression of 3β-HSD in a) to e)

[0348] g) For the synthesis of 17OHP4 using 17OHP5 as a substrate: Single expression of Hs_3β-HSD1 (type I human Hs_3β-HSD)

[0349] h) For the synthesis of 17OHP4 using 17OHP5 as a substrate: Single expression of Hs_3β-HSD2 (type II human Hs_3β-HSD)

[0350] i) For the synthesis of 17OHP4 using 17OHP5 as a substrate: Combined expression of Hs_3β-HSD1 and Hs_3β-HSD2

[0351] j) For the synthesis of 4AD and TS (testosterone) using DHEA as a substrate: Single expression of Vv_3β-HSD

[0352] k) For the synthesis of 4AD and TS (testosterone) using DHEA as a substrate: single expression of Mt_3β-HSD

[0353] l) For the synthesis of 4AD and TS (testosterone) using DHEA as a substrate: Single expression of Hs_3β-HSD1 (type I human Hs_3β-HSD)

[0354] m) For the synthesis of 4AD and TS (testosterone) using DHEA as a substrate: Single expression of Hs_3β-HSD2 (type II human Hs_3β-HSD)

[0355] n) For the synthesis of 4AD and TS (testosterone) using DHEA as a substrate: single expression of Bt_3β-HSD2

[0356] o) For the synthesis of 4AD and TS (testosterone) using DHEA as a substrate: Combined expression of 3β-HSD in j) to n)

[0357] p) For DHEA synthesis using P5 as substrate: co-expression of Oa_CYP17A1, Oa_POR, Ec_CYP17A1, Ec_POR, Ec_CYB5

[0358] q) For the synthesis of 17OHP4 using P5 as substrate: co-expression of Hs_3β-HSD2 (type II human Hs_3β-HSD), Vv_3β-HSD, Oa_CYP17A1, Oa_POR

[0359] r) For the synthesis of 17OHP5 using P5 as a substrate: co-express Oa_CYP17A1, Oa_POR

[0360] s) For the synthesis of 17OHP5 using P5 as substrate: co-expression of Ma_CYP17A1, Ma_POR

[0361] t) For the synthesis of 17OHP5 using P5 as substrate: Combined expression of CYP17A1 and POR in r) to s)

[0362] u) For DHEA synthesis by 17OHP5: co-expression of Oa_CYP17A1, Ma_CYB5, Oa_POR

[0363] v) For DHEA synthesis by 17OHP5: co-expression of Oa_CYP17A1, Ec_CYB5, Oa_POR

[0364] w) For DHEA synthesis by 17OHP5: co-expression of Oa_CYP17A1, Ss_CYB5, Oa_POR

[0365] x) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Ma_CYP17A1, Ss_CYB5, Ma_POR

[0366] y) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Ec_CYP17A1, Ss_CYB5, Ec_POR

[0367] z) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Oa_CYP17A1, Ss_CYB5, Oa_POR aa) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Ma_CYP17A1, Ec_CYB5, Ma_POR

[0368] ab) For the synthesis of 4AD and TS (testosterone) from 17OHP4: co-expression of Ec_CYP17A1, Ec_CYB5, and Ec_POR ac) For the synthesis of 4AD and TS (testosterone) from 17OHP4: co-expression of Oa_CYP17A1, Ec_CYB5, and Oa_POR ad) For the synthesis of 4AD and TS (testosterone) from 17OHP4: co-expression of Ec_CYP17A1, Oa_CYB5, and Ec_POR ae) For the synthesis of 4AD and TS (testosterone) from 17OHP4: co-expression of Ec_CYP17A1, Ma_CYB5, and Ec_POR af) For the synthesis of 4AD and TS (testosterone) from 17OHP4: co-expression of Ma_CYP17A1, Oa_CYB5, and Ma_POR

[0369] ag) For the synthesis of 4AD and TS (testosterone) by 17OHP4: co-expression of Ma_CYP17A1, Ma_CYB5, Ma_POR

[0370] The recombinant strains and plasmids involved in the present invention are shown in Table 1 and Table 2:

[0371] Table 1: Recombinant strains involved in the present invention

[0372]

[0373]

[0374]

[0375] Table 2: Plasmids involved in the present invention

[0376]

[0377]

[0378]

[0379]

[0380]

[0381] The optimized sequence involved in the present invention: Ss_mCYP11A1 (SEQ NO: 5):

[0382]

[0383]

[0384] Oa_CYP17A1 (SEQ NO: 6):

[0385]

[0386] Ma_CYP17A1 (SEQ NO: 7):

[0387]

[0388]

[0389] Ec_CYP17A1 (SEQ NO: 8):

[0390]

[0391]

[0392] X1_CYP17A1 (SEQ NO: 9):

[0393]

[0394]

[0395] Oa_FOR(SEQ NO:10):

[0396]

[0397]

[0398] No_FOR(SEQ NO:11):

[0399]

[0400]

[0401] Ec_FOR(SEQ NO:12):

[0402]

[0403]

[0404] Xl_FOR(SEQ NO:13):

[0405]

[0406]

[0407] Oa_CYB5(SEQ NO:14):

[0408]

[0409] Ma_CYB5(SEQ NO:15):

[0410]

[0411] Ec_CYB5(SEQ NO:16):

[0412]

[0413] Ss_CYB(SEQ NO:17):

[0414]

[0415]

[0416] Hs_3β-HSD2(L236S)(SEQ NO:18):

[0417]

[0418] Hs_3β-HSD2(SEQ NO:19):

[0419]

[0420]

[0421] Hs_3β-HSD1 (SEQ NO: 20):

[0422]

[0423] Hs_3β-HSD1(L237S)(SEQ NO: 21):

[0424]

[0425]

[0426] Mm_3β-HSD (SEQ NO: 22):

[0427]

[0428] At_3β-HSD (SEQ NO: 23):

[0429]

[0430]

[0431] Bt_3β-HSD (SEQ NO: 24):

[0432]

[0433] Mt_3β-HSD (SEQ NO: 25):

[0434]

[0435]

[0436] Vv_3β-HSD (SEQ NO: 26):

[0437]

[0438] 3β-HSD of Homo sapiens (type I, L237S mutation), the mutation site is underlined AA (SEQ NO: 27):

[0439]

[0440]

[0441] 3β-HSD of Homo sapiens (type II, L236S mutation), the mutation site is underlined AA (SEQ NO: 28):

[0442]

[0443] The raw materials and reagents used in the directional synthesis of the network pathway product provided by the present invention can all be purchased from the market.

[0444] The present invention will be further described below in conjunction with the embodiments:

[0445] Example 1: Characterization of substrate specificity of key components of the 4AD pathway (3β-HSD) and directed synthesis of progesterone

[0446] 1. Obtaining chassis strains

[0447] The wild-type Yarrowia lipolytica strain, ATCC 201249, was provided by Yuan Yingjin's group and is mentioned in the paper Multiplex gene editing of the Yarrowia lipolytica genome using the CRISPR-Cas9 system.

[0448] 2. Acquisition of exogenous functional gene elements

[0449] The sources of the genes CYP17A1 (17-alpha-hydroxylase / 17,20-lyase), POR (NADPH-cytochrome P450 reductase), 3β-HSD (3β-hydroxysteroid dehydrogenase), CYB5 (cytochrome B5), and mCYP11A1 (mature P450scc) involved in the present invention are shown in Table 3.

[0450] Table 3 Sources of genes involved in the present invention

[0451]

[0452] The four component genes used in the present invention were all artificially synthesized after Yarrowia lipolytica codon optimization and appropriate avoidance of common restriction enzyme sites, with the addition of 5' gcggccgcggtctcca (as shown in SEQ NO: 1) and 3' taaaggagaccgcggccgc (as shown in SEQ NO: 2) at both ends of the gene. Figure 1 As shown, the synthesis pathway includes pregnenolone to progesterone ( Figure 2 ), pregnenolone synthesis of dehydroepiandrosterone ( Figure 3 ), pregnenolone synthesis of 17-hydroxyprogesterone ( Figure 4 ), pregnenolone synthesis of 17-hydroxypregnenolone ( Figure 5 ) and other steps.

[0453] 3. Test method:

[0454] Seed culture medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;

[0455] Biotransformation medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder.

[0456] Steroid substrate stock solution: 1.75 g / L (50% EtOH-Tween80) P4 solution, 1.75 g / L (50% EtOH-Tween80) 17OH P4 solution

[0457] 3β-HSD isomerization conversion experiment: Recombinant strains RS3B-1 to RS3B-9 (see the construction of modular integration plasmids below) were inoculated into 5 mL seed culture medium and cultured at 30°C and 220 rpm for 14 to 16 h. The initial bacterial concentration OD 600 =0.2 were inoculated into 5 mL of biotransformation medium, cultured at 28°C and 220 rpm for 24 h, 150 μL of P4 solution and 17OHP4 solution were added, and incubated for another 40 h to obtain fermentation broth, and the steroid products were quantified by the following method.

[0458] Pregnenolone quantification method: Take 1 mL of fermentation broth, centrifuge at 12,000 g for 2 minutes, collect the cells, and wash twice with water. Add 1 mL of 3 mol / L hydrochloric acid to resuspend the cells, boil in 100°C water for 5 minutes, and centrifuge at 12,000 rpm for 1 minute to collect the cell pellet. Wash the cell pellet three times with 1 mL of distilled water. Add 420 μL of 2 mol / L potassium hydroxide-methanol solution to the disrupted cell pellet and incubate in a 37°C incubator for 2 hours. Remove the saponification reaction centrifuge tube, cool to room temperature (25°C ± 5°C), add an equal volume of n-hexane, vortex for 10 minutes, centrifuge at 12,000 rpm for 1 minute, and transfer the upper n-hexane phase to a new centrifuge tube. Repeat the n-hexane extraction of the lower phase, and combine the two n-hexane phases. The n-hexane phase was concentrated using a vacuum centrifugal concentrator (when the sample solvent was n-hexane: 25°C, 30 min, 7000 rpm). The solid remaining in the tube after concentration was the steroid substance. 100 μL of MSTFA was added and reacted at 37°C for 2 h. 100 μL of n-hexane was added, and the mixture was filtered and detected by gas chromatography-mass spectrometry.

[0459] Quantification of progesterone, 17-hydroxypregnenolone, 17-hydroxyprogesterone, DHEA, and androstenedione: 1 mL of fermentation broth was added to glass beads and 700 μL of ethyl acetate, and the mixture was shaken and extracted for 10 minutes. The upper organic phase was collected and the aqueous phase was re-extracted with fresh ethyl acetate. The two organic phases were combined and concentrated using a vacuum centrifugal concentrator (for ethyl acetate samples: 25°C, 1200 minutes, 7000 rpm). The remaining solid in the tube after concentration is the steroid. 100 μL of MSTFA was added and the mixture was reacted at 37°C for 2 hours. 100 μL of n-hexane was added and filtered. P5, P4, DHEA, 4AD, 17OHP4, and 17OHP5 were detected by GC-MS. (The yields of 17OHP4 and 17OHP5 were quantified relative to the P5 standard curve.)

[0460] 4. Construction of modular integration plasmids

[0461] Construction of Module Three: Two types of 3β-HSD with distinct catalytic specificities exist in humans: type I 3β-HSD is highly active and primarily uses DHEA as its substrate, while type II 3β-HSD prefers P5 and 17OHP5 as substrates. In this study, these two human 3β-HSDs were codon-optimized and abbreviated as Hs_3β-HSD1 and Hs_3β-HSD2, respectively. In 1999, Moisan et al. reported that the L236S mutation in Hs_3β-HSD2 increased the protein's maximum reaction rate; this mutant protein is abbreviated as Hs_3β-HSD2mut. After comparison with the original sequence, the present invention also introduced the corresponding mutation, L237S, into Hs_3β-HSD1, designating it as Hs_3β-HSD1mut. This example also selected five species-representative 3β-HSDs from different sources, namely Mm_3β-HSD from mouse Mus musculus, 3β-HSD2 from cattle Bos taurus, 3β-HSD from Vaccinia virus, 3β-HSD from Mycobacterium tuberculosis, and At_3β-HSD from Arabidopsis thaliana. After codon optimization, they are abbreviated as Mm_3β-HSD, Bt_3β-HSD, Vv_3β-HSD, Mt_3β-HSD, and At_3β-HSD, respectively. To facilitate integration into the vector pINA1269-Nat by Gibson assembly (a vector plasmid in which the LEU2 marker between the BglII and ClaI restriction sites of the commercial vector plasmid pINA1269 is replaced with the nourseoindole resistance marker Nat), a 21 bp homology arm sequence gggaacccgaaactaaggatc (as shown in SEQ NO: 3) upstream of the vector BamHI site was introduced at the 5' end of the above gene by PCR reaction, and a 21 bp homology arm sequence gtacctccatggcctgtcccc (as shown in SEQ NO: 4) downstream of the vector KpnI site was introduced at the 3' end of the gene.After assembly with the linearized vector of BamHI and KpnI, 9 corresponding pINA1269-Nat-3β-HSD integration recombinant plasmids pRS3B-1 to pRS3B-9 (i.e., pINA1269-Nat-Mm_3β-HSD, pINA1269-Nat-Bt_3β-HSD, pINA1269-Nat-Vv_3β-HSD, pINA1269-Nat-At_3β-HSD, pINA1269-Nat-Mt_3β-HSD, pINA1269-Nat-Hs_3β-HSD1, pINA1269-Nat-Hs_3β-HSD2, pINA1269-Nat-Hs_3β-HSD1mut, and pINA1269-Nat-Hs_3β-HSD2mut) were obtained, namely module three. The constructed plasmids were transformed into competent E. coli DH5α cells, screened by colony PCR, and extracted for verification by single and double restriction enzyme digestion and sequencing to ensure correct ligation of the target fragments and the absence of base sequence mutations. pINA1269 is the name of the integrative plasmid. After linearization with NotI, this plasmid can be integrated into the yeast genome at the pBR322 site, where pBR322 is the name of the integration site.

[0462] 5. Experimental results

[0463] The conversion efficiency of steroid substrates was characterized by the amount of corresponding isomers synthesized. Figure 6 shown.

[0464] The whole-cell conversion results of the three substrates showed that: (1) In the conversion experiment with pregnenolone (P5) as the substrate, Vv_3β-HSD showed the strongest pregnenolone conversion efficiency, reaching 6.8%. Type I human and mutant 3β-HSD showed the second strongest catalytic efficiency, reaching 4.6-4.8%. (2) In the conversion experiment with 17-hydroxypregnenolone (17OHP5) as the substrate, the four human 3β-HSDs and mutants all showed strong conversion efficiency, among which type I human 3β-HSD had the highest progesterone conversion rate of 3.1%. (3) When using dehydroepiandrosterone (DHEA) as the substrate, type II human, bovine, and mycobacterium-derived 3β-HSD all showed strong catalytic activity, among which type II human 3β-HSD had a conversion efficiency of up to 10.5%.

[0465] By expressing heterologous 3β-HSD in a wild-type yeast chassis, the present invention achieved the synthesis of the 4AD pathway node product, P4, using P5 as a substrate. Furthermore, the whole-cell catalytic efficiency of 3β-HSDs from different sources showed strong differences in substrate preference: (1) 3β-HSDs from humans and Arabidopsis thaliana, with low catalytic activity, all showed strong substrate preference for pregnenolone, while relatively low conversion ability for 17OHP5; (2) Unlike the substrate preference exhibited by 3β-HSD in human cells, human 3β-HSDs in the Yarrowia lipolytica system generally exhibited relatively balanced catalytic activity for the three steroid substrates. In particular, wild-type type II human 3β-HSD exhibited higher DHEA conversion ability than type I human 3β-HSD.

[0466] Example 2: Characterization of substrate specificity of key components of the 4AD pathway (CYP17A1) and directed synthesis of 17-hydroxypregnenolone

[0467] 1. Acquisition of experimental materials

[0468] CYP17 hydroxylase is a key node in the steroid anabolic pathway, catalyzing the 17α-hydroxylation and 17,20-cleavage reactions of C21 steroids as substrates. The participation of cytochrome b5 (CYB5) promotes the 17,20-lyase activity of CYP17. The catalytic activity of CYP17A1 is highly species-specific. Based on the substrate catalytic specificity, CYP17A1 is usually divided into △ 4，5 Type, △ 5 Type and △ 4 The selection of CYP17 in this study was based on the in vitro catalytic activity parameters of CYP17 from multiple sources compiled by Gilep and colleagues. 4 The catalytic activity of type CYP17 is weak. Based on the in vitro enzyme activity parameters and protein evolution relationship, the present invention only selects sheep source (Ovis aries)△ 5 CYP17A1 and golden hamster (Mesocricetus auratus), horse (Equus caballus), African clawed frog (Xenopus laevis) 4，5The four CYP17A1 proteins were codon-optimized and abbreviated as Oa_CYP17A1, Ma_CYP17A1, Ec_CYP17A1, and Xl_CYP17A1, respectively. Similarly, the CYP17A1 proligand, NADPH-cytochrome P450 reductase (POR), was codon-optimized and abbreviated as Oa_POR, Ma_POR, Ec_POR, and Xl_POR, respectively. Considering that the 17,20-lyase activity of CYP17 is affected by CYB5, CYB5 from sheep, golden hamster, horse, and pig (Sus scrofa) were introduced and tested. After codon optimization, the four CYB5 proteins were abbreviated as Oa_CYB5, Ma_CYB5, Ec_CYB5, and Ss_CYB5, respectively.

[0469] The wild-type Yarrowia lipolytica was obtained as described in Example 1.

[0470] Construction of module one: The left arm of the IntD integration site and the Saccharomyces cerevisiae GPM1t terminator were spliced ​​together by the OE-PCR method; the 40bp terminal sequence of the Saccharomyces cerevisiae FBA1t terminator, the leucine nutritional screening tag Leu2 with LoxP sites at both ends, and the right arm of the IntD integration site were spliced ​​together by the OE-PCR method to obtain fragments containing NotI restriction sites at both ends, named IntD-L and IntD-R, respectively; then, the artificially synthesized CYP17A1 and POR from four different sources were connected with the expression modules TEF1inp-LIP2t-GPDt and GPDt-TEF1inp-OCT1t-FBA1t after digestion with BsmBI to obtain integration plasmids, and the CYP17A1 and POR modules from the same species were combined with pUC18H digested with IntD-L, IntD, and HincII by Gibson assembly to obtain integration plasmids, and module one was obtained after digestion with NotI. Construction of Module 2: The left arm of the IntB integration site, the auxotrophic uracil tag Ura3, the right arm of the IntB integration site, the promoter TEF1in, and the terminator ACOt were spliced ​​with CYB5 from four different sources using the Gibson method to generate integration plasmids. Module 2 was obtained after digestion with NotI. Each of these module integration plasmids was transformed into competent E. coli DH5α, screened by colony PCR, and the extracted plasmids were verified by single and double enzyme digestion and sequencing to ensure that the target fragments were correctly connected and that the base sequence had not undergone mutations.

[0471] Construction of module four: The left arm of the IntF integration site, pUC18H after HincII digestion, the leucine nutritional screening tag Leu2 with LoxP sites at both ends, the right arm of the IntF integration site, CYP17A1 from Equus caballus and POR (the method is the same as that of module one) were spliced ​​together by the Gibson method to obtain a fragment containing NotI digestion sites at both ends, and module four was obtained after NotI digestion.

[0472] The 17-hydroxylation conversion experiment verified the construction of the strain, and the modules containing four genes from different sources were integrated into ATCC201249 to obtain strains SyBE_Yl2091001 to SyBE_Yl2091004.

[0473] The 17,20-lysis transformation experiment verified the construction of the strain, and the module 2 containing four genes from different sources was respectively integrated into the above-constructed strains SyBE_Yl2091001 to SyBE_Yl2091004 to obtain strains SyBE_Yl2091005 to SyBE_Yl2091016 and SyBE_Yl2090013 to SyBE_Yl2090016.

[0474] 2. Experimental methods

[0475] Biotransformation medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;

[0476] Seed culture medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;

[0477] YPD fermentation medium: 50 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder.

[0478] Steroid substrate stock solution: 1.75 g / L (50% EtOH-Tween80) P5 solution, 1.75 g / L (50% EtOH-Tween80) P4 solution, 1.75 g / L (50% EtOH-Tween80) 17OHP5 solution, 1.75 g / L (50% EtOH-Tween80) 17OHP4 solution

[0479] 17-Hydroxylation conversion experiment: SyBE_Yl2091001 to SyBE_Yl2091004 were inoculated into 5 mL seed culture medium and cultured at 30°C and 220 rpm for 14 to 16 h. The initial bacterial concentration OD 600=0.2 were inoculated into 5 mL of biotransformation medium, cultured at 28°C and 220 rpm for 24 h, 150 μL of P4 and P5 substrate stock solutions were added, and incubated for another 16 h. 1 mL of sample was taken to detect the 17OHP4 content according to the method in Example 1.

[0480] 17,20-lysis transformation experiment: SyBE_Yl2091005~SyBE_Yl2091016 were inoculated into 5 mL seed culture medium and cultured at 30°C and 220 rpm for 14~16 h. The initial bacterial concentration OD 600 =0.2 were inoculated into 5 mL of biotransformation medium, cultured at 28°C and 220 rpm for 24 h, 150 μL of 17OHP4 and 17OHP5 substrate stock solutions were added, and incubation continued for 144 h. 1 mL of sample was taken to detect DHEA or 4AD content according to the method in Example 1.

[0481] 3. Experimental results

[0482] 17-Hydroxylation conversion experiment: By expressing heterologous 3β-HSD in wild-type yeast chassis, the present invention realizes the synthesis of 4AD pathway node product: 17OHP5 using P5 as substrate. The experimental results show that ( Figure 7 ), the 17α-hydroxylation activity of CYP17A1 from sheep, golden hamster and African clawed frog for progesterone was 1.2 to 14.5 times that of CYP17A1 catalyzed by pregnenolone as substrate. 4，5 Among the CYP17A1 types, although the golden hamster CYP17A1 showed the strongest 17α-hydroxylation activity under the conditions of pregnenolone and progesterone as substrates, only △ 5 The CYP17A1 from horse and African clawed frog showed very weak catalytic activity for both substrates.

[0483] 17,20-cleavage conversion experiment: The experimental results show that ( Figure 8 ), all tested strains showed 17,20-lyase activity on both substrates. (1) For the three tested △ 4，5 Type CYP17A1: The engineered bacteria containing CYP17A1 from African clawed frogs all showed low 17,20-lyase activity, indicating that the CYP17 from this source cannot be effectively functionally expressed under the current system; for CYP17A1 from golden hamster and horse, the participation of CYB5 can significantly improve the 17,20-lyase activity. (2) 5Ovine CYP17A1: This source protein has a stronger substrate preference and biotransformation ability for 17-hydroxypregnenolone than for 17-hydroxyprogesterone; this source protein has a strong CYB5 source dependence on the 17,20-lyase activity of 17α-hydroxyprogesterone. (3) Regarding CYB5: In most cases, CYB5 can promote the 17,20-lyase activity of CYP17A1; porcine and horse CYB5, as efficient ligands, when adapted to multiple sources of CYP17A1, can often promote the latter's conversion efficiency to 17α-hydroxyprogesterone to a greater extent.

[0484] Regarding the selection of enzyme sources for the reconstruction of the heterologous 4AD pathway in Yarrowia lipolytica, the present invention summarizes that: (1) for the isomerization (dehydrogenation) reaction, Vv_3β-HSD is the preferred protein to catalyze the reaction with P5 as the substrate; (wild type) type I and type II Hs_3β-HSD are the preferred proteins to catalyze the reaction with 7OHP5 and DHEA as the substrate; (2) when P5 and P4 are the substrates, Oa_CYP17A1 is the most preferred source to catalyze the 17α-hydroxylation reaction; (3) for the 17,20-cleavage reaction with 17α-hydroxypregnenolone as the substrate, although the sheep-derived protein has high catalytic activity, △ 4，5 Golden hamster-derived CYP17A1 is also a reliable alternative source; for the 17,20-cleavage reaction with 17α-hydroxyprogesterone as the substrate, horse-derived CYP17A1 can achieve efficient catalysis regulated by CYB5; at the same time, pig, golden hamster and horse-derived CYB5 can all be used as efficient ligands for pathway construction.

[0485] Example 3: Synthesis of DHEA using P5 as substrate and synthesis of 4AD using P4 as substrate

[0486] 1. Acquisition of experimental materials

[0487] The strains SyBE_Yl2091005 to SyBE_Yl2091016 were obtained as described in Example 2.

[0488] The acquisition of module 4 is the same as described in Example 2.

[0489] Construction of Module 5: The Leu2 selection marker of SyBE_Y12091004 was deleted using the Cre-loxP system to obtain a Leu2-free SyBE_Y12091004. Module 4, linearized with NotI, and module 2 containing horse-derived Ec_CYB5 were integrated into the genome of the Leu2-free SyBE_Y12091004 via yeast transformation to generate strain SyBE_Y12091030.

[0490] 2. Experimental methods

[0491] Seed culture medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;

[0492] Biotransformation medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder.

[0493] Steroid substrate stock solution: 3.5 g / L (50% EtOH-Tween80) P5 solution, 3.5 g / L (50% EtOH-Tween80) P4 solution

[0494] DHEA synthesis experiment: SyBE_Yl2091030 (experimental group) and SyBE_Yl2091016 (control) were inoculated into 5 mL seed culture medium and cultured at 30°C and 220 rpm for 14-16 h. The initial bacterial concentration OD 600 =0.2 were inoculated into 5 mL of biotransformation medium, cultured at 28°C and 220 rpm for 24 h, 150 μL of P5 substrate mother solution were added and incubated for another 120 h, and 1 mL of sample was taken to detect DHEA content according to the method in Example 1.

[0495] 4AD synthesis experiment: SyBE_Yl2091030 (experimental group) and SyBE_Yl2091016 (control) were inoculated into 5 mL seed culture medium, cultured at 30°C and 220 rpm for 14-16 h, and the initial bacterial concentration OD 600 =0.2 were inoculated into 5 mL of biotransformation medium, cultured at 28°C and 220 rpm for 24 h, 150 μL of P4 substrate mother solution were added and incubated for another 120 h, and 1 mL of sample was taken to detect the 4AD content according to the method in Example 1.

[0496] 3. Experimental results

[0497] In this example, Oa_CYP17A1 (strong 17α-hydroxylation activity), Ec_CYP17A1 (strong 17,20-cleavage activity), and Ec_CYB5 (which has a strong promoting effect on the 17,20-cleavage activity of both Oa_CYP17A1 and Ec_CYP17A1) were combined and characterized in strain SyBE_Yl2091030 to achieve efficient conversion of P5 / P4 to DHEA / 4AD.

[0498] DHEA synthesis experiment: In the biotransformation with P5 as substrate, the DHEA synthesis amount of SyBE_Yl2091030 reached 12.6 mg / L, which was 7.32 times higher than that of the control group SyBE_Yl2091016 ( Figure 9 ).

[0499] 4AD synthesis experiment: In the biotransformation with P4 as substrate, strain SyBE_Yl2091030 achieved a synthesis of 13.9 mg / L of androstenedione, which was 86.2 times higher than that of the control strain SyBE_Yl2091016 ( Figure 10 ).

[0500] In this embodiment, the present invention realizes the directed synthesis of DHEA using P5 as a substrate and the directed synthesis of 4AD using P4 as a substrate, and improves the catalytic efficiency by combining the expression of high-efficiency pathway component proteins.

[0501] Example 4: Synthesis of 17OHP4 using P5 as substrate

[0502] The synthesis of 17OHP4 from P5 involves two reactions: 17α-hydroxylation reactions using P4 or P5 as substrates, and isomerization reactions using P5 or 17OHP5 as substrates. The present invention selected Ma_CYP17A1 to catalyze both 17α-hydroxylation reactions, along with Hs_3β-HSD2, which exhibits strong catalytic specificity for both intermediates (P5 and 17OHP5), and Vv_3β-HSD, which exhibits strong catalytic specificity for P5. These three highly efficient catalytic proteins were then used together to construct the 17OHP4 pathway.

[0503] 1. Acquisition of experimental materials

[0504] The construction of modules 1, 2, 3, and 4 is the same as that described in Examples 1 and 2.

[0505] Construction of Module 6: The left arm of the IntC integration site, the artificial promoter hp8d, Hs_3β-HSD2, the Yarrowia lipolytica terminator OCTt, the leucine nutritional selection tag Leu2 with LoxP sites at both ends, and the right arm of the IntC integration site were spliced ​​together using OE-PCR to generate a fragment containing NotI restriction sites at both ends. This fragment was then ligated with the HindIII-linearized plasmid pUC57-Kan-Simple to generate the integration plasmid, i.e., Module 6. Each of these module integration plasmids was transformed into competent E. coli DH5α cells, screened by colony PCR, and the plasmids were extracted for single and double restriction enzyme digestion and sequencing to ensure that the target fragments were correctly connected and that the base sequence had not undergone mutations.

[0506] Construction of module seven: Module one (pIntD-Ma_CYP17-POR) expressing CYP17A1-POR from golden hamster (Mesocricetus auratus), module six, and module three expressing Vv_3β-HSD were simultaneously integrated into ATCC201249 to obtain the recombinant lipolytic yeast strain SyBE_Yl2090007.

[0507] 2. Experimental methods

[0508] Seed culture medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;

[0509] Biotransformation medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder.

[0510] Steroid substrate stock solution: 3.5 g / L (50% EtOH-Tween80) P5 solution.

[0511] 4AD synthesis experiment: SyBE_Yl2090007 was inoculated into 5 mL seed culture medium and cultured at 30°C and 220 rpm for 14-16 h. The initial bacterial concentration OD 600 =0.2 were inoculated into 5 mL of biotransformation medium and cultured at 28°C and 220 rpm for 24 h. 150 μL of P5 substrate stock solution was added and incubated for a further 120 h. 1 mL of sample was taken and the 17OHP4 content was determined according to the method in Example 1. (17OHP4 was quantified relative to the P5 standard curve)

[0512] 3. Experimental results

[0513] The 17OHP4 synthesis of strain module 7 reached 3.90 mg / L ( Figure 11 In this embodiment, the present invention realizes the directed synthesis of 17OHP4 using P5 as a substrate, and improves the catalytic efficiency by combining the expression of high-efficiency pathway component proteins.

[0514] Example 5: De novo synthesis of progesterone using glucose

[0515] 1. Obtaining chassis strains

[0516] Provided by Yuan Yingjin's research group, the high-yielding Yarrowia lipolytica chassis strain is codenamed SyBE_Y12060077, while the wild-type Yarrowia lipolytica strain is codenamed ATCC 201249. SyBE_Y12060077 is mentioned in the paper "Pregnenolone Overproduction in Yarrowia lipolytica by Integrative Components Pairing of the Cytochrome P450scc System."

[0517] 2. Acquisition of exogenous functional gene elements

[0518] The sources of the genes CYP17A1 (17-alpha-hydroxylase / 17,20-lyase), POR (NADPH-cytochrome P450 reductase), 3β-HSD (3β-hydroxysteroid dehydrogenase), CYB5 (cytochrome B5), and mCYP11A1 (mature P450scc) involved in the present invention are shown in Table 4.

[0519] Table 4 Sources of genes involved in the present invention

[0520]

[0521] The four component genes used in the present invention are all obtained by artificial synthesis after Yarrowia lipolytica codon optimization and appropriate avoidance of common restriction enzyme sites, with the addition of 5' gcggccgcggtctcca (as shown in SEQ NO: 1) and 3' taaaggagaccgcggccgc (as shown in SEQ NO: 2) at both ends of the gene.

[0522] 3. Test method:

[0523] Seed culture medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;

[0524] YPD fermentation medium: 50 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder.

[0525] Pregnenolone (P5) and campesterol quantification method: Take 1 mL of fermentation broth, centrifuge at 12,000 g for 2 minutes, collect the cells, and wash twice with water. Add 1 mL of 3 mol / L hydrochloric acid to resuspend the cells, boil in 100°C water for 5 minutes, and centrifuge at 12,000 rpm for 1 minute to collect the cell pellet. Wash the cell pellet three times with 1 mL of distilled water. Add 420 μL of 2 mol / L potassium hydroxide-methanol solution to the disrupted cell pellet and react in a 37°C incubator for 2 hours. Remove the saponification reaction centrifuge tube, cool to room temperature (25°C ± 5°C), add an equal volume of n-hexane, vortex for 10 minutes, centrifuge at 12,000 rpm for 1 minute, and remove the upper n-hexane phase to a new centrifuge tube. Repeat the n-hexane extraction of the lower phase, and combine the two n-hexane phases. The n-hexane phase was concentrated using a vacuum centrifugal concentrator (when the sample solvent was n-hexane: 25°C, 30 min, 7000 rpm). The solid remaining in the tube after concentration was the steroid substance. 100 μL of MSTFA was added and reacted at 37°C for 2 h. 100 μL of n-hexane was added, and the mixture was filtered and detected by gas chromatography-mass spectrometry.

[0526] Quantification of progesterone, 17-hydroxypregnenolone (17OHP5), 17-hydroxyprogesterone (17OHP4), dehydroepiandrosterone, androstenedione, and testosterone: 1 mL of fermentation broth was added to glass beads and extracted with 700 μL of ethyl acetate for 10 minutes. The upper organic phase was collected and the aqueous phase was re-extracted with fresh ethyl acetate. The two organic phases were combined and concentrated using a vacuum centrifuge (for ethyl acetate: 25°C, 1200 minutes, 7000 rpm). The solids remaining in the tube after concentration were the steroids. For progesterone (P4), dehydroepiandrosterone (DHEA), androstenedione (4AD), and testosterone (TS), 100 μL of MSTFA was added and reacted at 37°C for 2 hours. 100 μL of n-hexane was added, the mixture was filtered, and then analyzed by gas chromatography-mass spectrometry. For 17-hydroxypregnenolone and 17-hydroxyprogesterone, the samples were dissolved in 200 μL of anhydrous ethanol, filtered, and analyzed by ultra-performance liquid chromatography.

[0527] 4. Construction of modular integration plasmids

[0528] For upstream module strain construction, mCYP11A1 was expressed under the TEF1p promoter, and 3β-HSD was expressed under the EXP1p promoter, both of which were integrated into the pBR322 locus. For downstream module strain construction, CYP17A1 and POR were both expressed under the TEF1inp promoter and integrated into the IntD locus of the chassis strain genome.

[0529] Construction of module A: The left arm of the IntD integration site and the Saccharomyces cerevisiae GPM1t terminator were spliced ​​together by the OE-PCR method; the 40bp terminal sequence of the Saccharomyces cerevisiae FBA1t terminator, the leucine nutritional screening tag Leu2 with LoxP sites at both ends, and the right arm of the IntD integration site were spliced ​​together by the OE-PCR method to obtain fragments containing NotI restriction sites at both ends, named IntD-L and IntD-R, respectively; then, the artificially synthesized CYP17A1 and POR from four different sources were connected with the expression modules TEF1inp-LIP2t-GPDt and GPDt-TEF1inp-OCT1t-FBA1t after digestion with BsmBI to obtain integration plasmids, and the CYP17A1 and POR modules from the same species were combined with pUC18H digested with IntD-L, IntD, and HincII by Gibson assembly to obtain integration plasmids, and module A was obtained after digestion with NotI. Construction of module B: The left arm of the IntB integration site, the defective uracil tag Ura3, the right arm of the IntB integration site, the promoter TEF1in, and the terminator ACOt were spliced ​​together with CYB5 from three sources via the Gibson method to obtain an integration plasmid, which was then digested with NotI to obtain module B. Construction of module C: Porcine mCYP11A1 was integrated into expression cassettes with the TEF1p promoter, and 3β-HSDs from six different sources were integrated into expression cassettes with the EXP1p promoter. The mCYP11A1 expression cassette and the six different 3β-HSD expression cassettes were then assembled into the pINA1269 integration plasmid digested with SalI and ClaI via Gibson assembly. Finally, the plasmid was linearized after digestion with NotI to obtain module C. The module A to C integration plasmids constructed above were transformed into competent E. coli DH5α, respectively, and colony PCR was performed to screen the plasmids. The plasmids were extracted for single and double enzyme digestion verification and sequencing verification to ensure that the target fragments were correctly connected and the base sequence had not mutated.

[0530] 5. Experimental results

[0531] Upstream modules: By integrating 6 different modules C into yeast SyBE_Yl2060077, upstream modules SyBE_Yl2090018, SyBE_Yl2090006, SyBE_Yl2091025 to SyBE_Yl2091028 were obtained

[0532] First, the present invention obtains progesterone by single culture of upstream module strain. The upstream module strain is inoculated into 5 mL seed culture medium and cultured at 30°C and 220 rpm for 14 to 16 hours. The initial cell concentration OD 600=0.1 were inoculated into 50 mL YPD fermentation medium, cultured at 28 ° C and 220 rpm, and the cell density (OD 600 ) and progesterone production. The upstream module strains derived from Vaccinia virus, Homo sapiens type II, and Bos taurus were cultured in YPD fermentation medium containing 50 g / L glucose at 28°C and 220 rpm for 8 days, and progesterone production of 9.56 mg / L, 9.12 mg / L, and 5.53 mg / L ( Figure 12 The de novo progesterone synthesis abilities of 3β-HSD from various source species in this example were not completely consistent with the biotransformation results of Example 1, indicating that the catalytic efficiency of 3β-HSD is affected by different reaction conditions and host genotype. Among them, type II human 3β-HSD (Hs_3β-HSD) exhibited catalytic advantages in both de novo and whole-cell progesterone synthesis experiments.

[0533] Example 6: De novo synthesis of 17-hydroxyprogesterone and 17-hydroxypregnenolone using glucose

[0534] 1. Acquisition of strains

[0535] Module A, module B, SyBE_Yl2091025, SyBE_Yl2091006, and SyBE_Yl2091016 are as described in Example 5.

[0536] 2. Experimental methods

[0537] Seed culture medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;

[0538] YPD fermentation medium: 50 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder.

[0539] 3. Experimental results

[0540] The present invention first integrates modules A and B containing genes from the same species into the wild-type Yarrowia lipolytica strain ATCC201249, obtaining strains SyBE_Y12091006 (containing Mesocricetus auratus genes) and SyBE_Y12091016 (containing Ovis aries genes) as downstream module strains. Module C described in Example 5, containing genes from different species, is then integrated into the high-yielding campesterol-producing Yarrowia lipolytica strain SyBE_Y12060077, obtaining strains SyBE_Y12091025 to SyBE_Y12091028, SyBE_Y12090006, and SyBE_Y12090018 as upstream module strains.

[0541] The present invention obtains the target steroid by combined module mixed fermentation. The upstream module strain SyBE_Yl2091025 with Bos taurus origin and two downstream module strains SyBE_Yl2091006 and SyBE_Yl2091016 are inoculated into 5 mL seed culture medium respectively and cultured at 30°C and 220 rpm for 14 to 16 hours. The strain SyBE_Yl2091025 is mixed with SyBE_Yl2091006 and SyBE_Yl2091016 at an OD ratio of 10:1. 600 Ratio, final OD 600 =0.1 were inoculated into 50 mL YPD fermentation medium and cultured at 28 °C and 220 rpm for 8 days. The cell density (OD 600 ) and steroid production.

[0542] In the SyBE_Yl2091025-SyBE_Yl2091006 mixed bacterial system, 0.25 mg / L of 17-hydroxyprogesterone, 0.74 mg / L of 17-hydroxypregnenolone, and 0.88 mg / L of androstenedione were synthesized. In the SyBE_Yl2091025-SyBE_Yl2091016 mixed bacterial system, 0.91 mg / L of 17-hydroxyprogesterone, 0.29 mg / L of 17-hydroxyprogesterone, and 1.03 mg / L of androstenedione were synthesized. Figure 13 ). Thus, the present invention realizes the de novo synthesis of 17-hydroxypregnenol and 17-hydroxyprogesterone using a mixed bacterial system. 4 Steroids (P4, 17OHP4, 4AD) accounted for 56.5% to 83.1% of the total steroid products. The difficult-to-convert intermediate 17OHP5 accounted for only 12.2% to 37.3% of the total steroids, much higher than the 17OHP5 proportion in the single-bacteria system (90.4% to 99.1%). These results indicate that the co-culture system design successfully alleviated the substrate competition between 3β-HSD and CYP17A1 by forcing the substrate P5 to be preferentially utilized by 3β-HSD, allowing more steroid flux to be used for △ 4 -Steroid synthesis.

[0543] Example 7: De novo synthesis of dehydroepiandrosterone using glucose

[0544] 1. Acquisition of strains

[0545] SyBE_Yl2091026 and SyBE_Yl2091006 are as described in Example 5.

[0546] 2. Experimental methods

[0547] Seed culture medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;

[0548] YPD fermentation medium: 50 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder.

[0549] 3. Experimental results

[0550] The upstream module strain SyBE_Yl2091026 and the downstream module strain SyBE_Yl2091006 were inoculated into 5 mL seed culture medium respectively and cultured at 30°C and 220 rpm for 14-16 h. The strains SyBE_Yl2091026 and SyBE_Yl2091006 were mixed at an OD ratio of 10:1. 600 Ratio, final OD 600 =0.1 were inoculated into 50 mL YPD fermentation medium and cultured at 28 °C and 220 rpm for 8 days. The cell density (OD 600 ) and steroid production.

[0551] In the SyBE_Yl2091026-SyBE_Yl2091006 mixed bacteria system, 2.13 mg / L of dehydroepiandrosterone was synthesized ( Figure 14 Compared with the mixed bacterial system in Example 6, which used bovine 3β-HSD-expressing engineered bacteria as the upstream module and tended to synthesize 4AD, the steroid synthesis in the current mixed bacterial system tended to accumulate DHEA, demonstrating that different 3β-HSD-derived strains have a greater impact on the system's steroid synthesis and metabolic flux.

[0552] Example 8: De novo synthesis of androstenedione and testosterone using glucose

[0553] 1. Acquisition of experimental materials

[0554] The acquisition of wild-type Yarrowia lipolytica, the construction of modular integration plasmids (modules A to C), and the acquisition of exogenous functional gene elements were the same as described in Example 5.

[0555] Construction of module D: The left arm of the IntF integration site, pUC18H digested with HincII, the leucine nutritional screening tag Leu2 with LoxP sites at both ends, the right arm of the IntD integration site, and the CYP17A1 and POR modules of Example 5 with the same species source (Ovis aries and Mesocricetus auratus) were spliced ​​together by the Gibson method to obtain a fragment containing NotI cleavage sites at both ends. Module D was obtained after NotI digestion.

[0556] SyBE_Y12091030 was obtained as described in Example 3

[0557] The 17-hydroxylation conversion experiment verified the construction of the strain, and the module A containing four genes from different sources was integrated into ATCC201249 to obtain strains SyBE_Yl2091001 to SyBE_Yl2091004.

[0558] The strain construction was verified by 17,20-lysis transformation experiments. Module B, containing three genes from different sources, was integrated into the previously constructed strains SyBE_Yl2091001 to SyBE_Yl2091004, respectively, to obtain strains SyBE_Yl2091005 to SyBE_Yl2091016.

[0559] 2. Experimental methods

[0560] Biotransformation medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;

[0561] Seed culture medium: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder;

[0562] YPD fermentation medium: 50 g / L glucose, 20 g / L peptone, 10 g / L yeast extract powder.

[0563] Steroid substrate stock solution: 1.75 g / L (50% EtOH-Tween80) progesterone, 1.75 g / L (50% EtOH-Tween80) 17-hydroxyprogesterone solution

[0564] 17-Hydroxylation conversion experiment: SyBE_Yl2091001-SyBE_Yl2091004 were inoculated into 5 mL seed culture medium and cultured at 30°C and 220 rpm for 14-16 h. The initial bacterial concentration OD 600 = 0.1 were inoculated into 5 mL of biotransformation medium, cultured at 28 ° C, 220 rpm for 24 h, 150 μL of progesterone substrate mother solution was added and incubated for 16 h, and 1 mL of sample was taken to detect 17OHP4 content according to the method in Example 1.

[0565] 17,20-lysis transformation experiment: SyBE_Yl2091005-SyBE_Yl2091016 were inoculated into 5 mL seed culture medium and cultured at 30°C and 220 rpm for 14-16 h. The initial bacterial concentration OD 600 =0.1 were inoculated into 5 mL of biotransformation medium, cultured at 28°C and 220 rpm for 24 h, 150 μL of 17-hydroxyprogesterone substrate mother solution was added and incubated for a further 120 h, and 1 mL of sample was taken to detect androstenedione content according to the method in Example 1.

[0566] Mixed bacteria synthesis of androstenedione experiment: The upstream module strain SyBE_Yl2091025 and the two downstream module strains SyBE_Yl2091016 and SyBE_Yl2091030 were inoculated into 5 mL seed culture medium respectively and cultured at 30°C and 220 rpm for 14-16 h. The upstream module strain and the two downstream module strains were inoculated at an OD ratio of 10:1. 600 Ratio, final OD 600 =0.1 were inoculated into 50 mL YPD fermentation medium, cultured at 28°C and 220 rpm for 8 days, and the steroid production was determined.

[0567] 3. Experimental results

[0568] In the biotransformation experiment, the strain containing CYP17A1 from Ovis aries showed the strongest 17-hydroxylation ability for progesterone.

[0569] Depend on Figure 15 (Left) It can be seen that Ec_CYP17A1 and Xl_CYP17A1 have weak catalytic activity for the 17α-hydroxylation of P4. Ma_CYP17A1 and Oa_CYP17A1 have strong catalytic activity for the 17α-hydroxylation of P4. 4，5 Among the CYP17A1 types, Ma_CYP17A1 has the strongest activity for 17α-hydroxylation of P4, but it is only 5 The activity of the CYP17A1 from sheep was 13.8%.

[0570] Depend on Figure 15 (Right) As can be seen, Ma_CYP17A1 and Ec_CYP17A1 exhibit the strongest 17,20-cleavage activity against 17OHP4. However, the 17,20-cleavage activity of Oa_CYP17A1 against 17OHP4 depends on the CYB5 source. Oa_CYB5 and Ec_CYB5, when paired with the three CYP17A1 sources mentioned above, enhance CYP17A1's 17,20-cleavage activity.

[0571] Depend on Figure 16As shown in the 17,20-cleavage conversion experiment, the Equus caballus-derived CYP17A1 and CYB5 in the current CYP17A1-CYB5 combination exhibited universal 17,20-cleavage ability. Therefore, in the downstream strain reconstruction, the Leu2 tag of SyBE_Y12091004 was removed using the Cre-loxp method, and modules two and four containing genes from Equus caballus were introduced, resulting in strain SyBE_Y12091030. In a mixed fermentation experiment with SyBE_Y12091025 and SyBE_Y12091030, androstenedione was the primary product, yielding 5.02 mg / L of androstenedione and 1.09 mg / L of testosterone. In this SyBE_Y12091025-SyBE_Y12091030 mixed fermentation experiment, androstenedione levels increased 3.9-fold compared to the pre-optimized co-culture system. The above results show that by introducing Ec_CYP17A1 from Equus caballus with strong 17,20-cleavage ability, Oa_CYP17A1 from sheep with strong 17α-hydroxylation ability, and Ec_CYB5 from horse that can simultaneously promote the 17,20-cleavage ability of Ec_CYP17A1 and Oa_CYP17A1, the substrate conversion efficiency of the downstream pathway can be effectively improved, effectively driving the conversion of steroid intermediates to 4AD.

[0572] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of 3β-HSD expressed from Mus musculus, Bos taurus, Vaccinia virus, Arabidopsis thaliana, Mycobacterium tuberculosis, Homosapiens (type I), Homo sapiens (type II), Homo sapiens (type I, L237S mutation), or Homosapiens (type II, L236S mutation) in the synthesis of steroid compounds and / or steroid hormone drugs.

2. The use according to claim 1, characterized in that Also included are proteins expressing CYP17A1 and POR derived from Equus caballus, Ovisaries, Mesocricetus auratus, or Xenopus laevis.

3. The use according to claim 1 or 2, characterized in that Also included are proteins expressing CYB5 derived from Equus caballus, Ovisaries, Mesocricetus auratus, or Susscrofa.

4. The use according to any one of claims 1 to 3, characterized in that Also included is expression of mCYP11A1 derived from Susscrofa.

5. Module, characterized in that, These include expressing a 3β-HSD derived from Mus musculus, Bos taurus, Vaccinia virus, Arabidopsis thaliana, Mycobacterium tuberculosis, Homo sapiens (type I), Homo sapiens (type II), Homo sapiens (type I, L237S mutation), or Homo sapiens (type II, L236S mutation).

6. The module according to claim 5, characterized in that Also included are CYP17A1 and PORs from Equus caballus, Ovis aries, Mesocricetus auratus, or Xenopus laevis.

7. The module according to claim 5 or 6, characterized in that Also included are CYB5s derived from Equus caballus, Ovisaries, or Mesocricetus auratus or Susscrofa.

8. The module according to any one of claims 5 to 7, characterized in that Also included is mCYP11A1 from Susscrofa.

9. A plasmid, characterized in that Comprising a module according to any one of claims 5 to 8.

10. A host, characterized in that Comprising the plasmid according to claim 9.

11. The host according to claim 10, wherein It includes Module Three; The module three includes 3β-HSD derived from Mus musculus, Bos taurus, Vaccinia virus, Arabidopsisthaliana, Mycobacterium tuberculosis, Homosapiens (type I), Homo sapiens (type II), Homosapiens (type I, L237S mutation) or Homosapiens (type II, L236S mutation); the vector connected to the module three includes pINA1269-Nat.

12. The host according to claim 11, wherein Also includes one or more of Module 1, Module 2, Module 4, Module 5, Module 6, Module 7, Module A, Module B, Module C or Module D: The module one comprises CYP17A1 and POR derived from Equus caballus, Ovis aries, Mesocricetus auratus or Xenopus laevis; the module one comprises an IntD integration site and / or a Leu2 tag with LoxP sites at both ends; and / or The second module comprises CYB5 derived from Equus caballus, Ovis aries, Mesocricetus auratus or Susscrofa; the second module comprises an IntB integration site and / or a Ura3 tag; and / or The module four comprises CYP17A1 and POR from Equus caballus; the module four comprises an IntF integration site and / or a Leu2 tag with LoxP sites at both ends; and / or The module five comprises: CYP17A1 and POR derived from Ovis aries; the module five knocks out the Leu2 tag; and / or The module six comprises: 3β-HSD derived from Homo sapiens (type II); the module six comprises an IntC integration site and / or a Leu2 tag with LoxP sites at both ends; and / or The module seven comprises: CYP17A1 and POR derived from Mesocricetus auratus, 3β-HSD derived from Homo sapiens (type II) and 3β-HSD derived from Vaccinia virus; the CYP17A1 and POR comprise an IntD integration site and / or a Leu2 tag with LoxP sites at both ends; the vector to which the 3β-HSD derived from Vaccinia virus is connected comprises pINA1269-Nat; the vector to which the 3β-HSD derived from Homo sapiens (type II) is connected comprises pUC57-Kan-Simple; and / or The module A comprises: CYP17A1 and POR derived from Equus caballus, Ovis aries, Mesocricetus auratus or Xenopus laevis; the module A comprises an IntD integration site and / or a Leu2 tag with LoxP sites at both ends; and / or The module B comprises: CYB5 derived from Equus caballus, Ovis aries or Mesocricetus auratus; the module B comprises an IntB integration site and / or a Ura3 tag; and / or The module C comprises: 3β-HSD derived from Mus musculus, Bos taurus, Vaccinia virus, Arabidopsisthaliana, Mycobacterium tuberculosis or Homo sapiens (type II) and mCYP11A1 derived from Sus scrofa; the vector connected to the module C comprises pINA1269; and / or The module D includes: CYP17A1 and POR derived from Ovis aries and Mesocricetus auratus; the module D includes an IntF integration site and / or a Leu2 tag with LoxP sites at both ends.

13. Use of any of the following in the synthesis of steroid compounds and / or steroid hormone drugs: (I) a module as described in any one of claims 5 to 8; and / or (II), the plasmid according to claim 9; and / or (III) The host according to claim 10 or 11.

14. A drug, characterized in that Including any of the following items and pharmaceutically acceptable excipients or adjuvants: (I) a module as described in any one of claims 5 to 8; and / or (II), the plasmid according to claim 9; and / or (III) The host according to claim 10 or 11.

15. A pharmaceutical combination, characterized in that The method comprises the drug according to claim 14 and any other active ingredients.

16. A method for synthesizing steroid compounds and / or steroid hormone drugs, characterized in that: The method comprises taking the host according to claim 10 or 11, culturing, and collecting the culture.

17. The method according to claim 16, wherein include: (I) de novo synthesis of progesterone in a microbial chassis using a carbon source and / or 3β-HSD; and / or (II) de novo synthesis of 17-hydroxyprogesterone in a microbial chassis using a carbon source, 3β-HSD, CYP17A1 and POR; and / or (V) de novo synthesis of androstenedione and testosterone in a microbial chassis using carbon sources, CYP17A1, POR, CYB5 and 3β-HSD; and / or (VI) Directed synthesis of androstenedione: co-culturing an upstream module expressing 3β-HSD with a downstream module expressing CYP17A1, POR and / or CYB5; and / or (VII) Synthesis of 17-hydroxyprogesterone: co-culture of upstream modules that co-express the pregnenolone pathway and / or 3β-HSD with downstream modules that only express CYP17A1, CYB5, and POR; and / or (VIII) synthesizing one or more of P4, 17OHP5, 17OHP4 or DHEA using P5 as a substrate; and / or (IX) synthesizing 17OHP4 using 17OHP5 as a substrate; and / or (X) synthesizing DHEA using 17OHP5 as a substrate; and / or (ⅩⅠ), synthesizing 4AD and TS using DHEA as a substrate; and / or (XII) Synthesis of 4AD and TS using 17OHP4.

Images