A wheat-like receptor cytoplasmic kinase TaRIPK8 and its application in improvement of a stripe disease resistant variety of cereal crops

Abstract

The application provides a wheat-like receptor cytoplasmic kinase TaRIPK8 and application thereof in improvement of a cereal crop stripe rust resistant variety, and belongs to the technical field of biological agriculture. The application provides application of a wheat-like receptor cytoplasmic kinase TaRIPK8 in regulation of a cereal crop stripe rust resistance trait and / or improvement or cultivation of a cereal crop stripe rust resistant variety, wherein the wheat-like receptor cytoplasmic kinase TaRIPK8 comprises a protein with an amino acid sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2. The wheat-like receptor cytoplasmic kinase TaRIPK8 of the application is involved in negative regulation of wheat on Puccinia striiformis, and based on this, a high-stripe rust resistant variety can be created, and a good wheat material for cultivation of a stripe rust resistant variety is provided.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological agriculture, and particularly relates to a wheat-like receptor cytoplasmic kinase TaRIPK8 and application thereof in improvement of a stripe rust resistant variety of a cereal crop. BACKGROUND

[0002] Wheat stripe rust is a kind of fungal disease caused by (Puccinia striiformis f. sp. tritici) Puccinia striiformis f. sp. Tritici , Pst ) (Puccinia striiformis f. sp. tritici) 。 Using a disease-resistant variety is the most economical, effective and environmentally friendly measure for disease control. However, due to frequent pathogenic variation of the wheat stripe rust fungus and continuous emergence of new pathogenic races, the wheat disease-resistant variety often loses the stripe rust resistance trait, and how to obtain a new wheat stripe rust resistant resource is a problem to be solved. SUMMARY

[0003] The application aims to provide a wheat-like receptor cytoplasmic kinase TaRIPK8 and application thereof in improvement of a stripe rust resistant variety of a cereal crop, and the wheat-like receptor cytoplasmic kinase TaRIPK8 can be used for improvement of a wheat stripe rust resistant variety.

[0004] The application provides application of a wheat-like receptor cytoplasmic kinase TaRIPK8 in regulation of a stripe rust resistant trait of a cereal crop and / or improvement or cultivation of a stripe rust resistant variety of a cereal crop, wherein the wheat-like receptor cytoplasmic kinase TaRIPK8 comprises a protein having an amino acid sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2.

[0005] The application also provides application of an ORF sequence encoding a wheat-like receptor cytoplasmic kinase TaRIPK8 in regulation of a stripe rust resistant trait of a cereal crop and / or improvement or cultivation of a stripe rust resistant variety of a cereal crop, wherein the ORF sequence encoding the wheat-like receptor cytoplasmic kinase TaRIPK8 comprises a gene having a nucleotide sequence shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0006] The application also provides application of a CRISPR / CAS9 vector of an ORF sequence encoding a wheat-like receptor cytoplasmic kinase TaRIPK8 in regulation of a stripe rust resistant trait of a cereal crop and / or improvement or cultivation of a stripe rust resistant variety of a cereal crop, wherein the ORF sequence encoding the wheat-like receptor cytoplasmic kinase TaRIPK8 comprises a gene having a nucleotide sequence shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0007] The application further provides a recombinant bacterium in the regulation of the resistance to stripe rust of a cereal crop and / or the improvement or cultivation of a stripe rust resistant variety of the cereal crop, wherein the recombinant bacterium contains a CRISPR / CAS9 vector of an ORF sequence encoding a wheat-like receptor cytoplasmic kinase TaRIPK8; and the ORF sequence encoding includes a gene with a nucleotide sequence as shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0008] The application further provides an application of a knockout or knockdown of an ORF sequence encoding a wheat-like receptor cytoplasmic kinase TaRIPK8 in improving the resistance to stripe rust of a cereal crop, wherein the ORF sequence encoding includes a gene with a nucleotide sequence as shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0009] The application further provides an application of overexpression of an ORF sequence encoding a wheat-like receptor cytoplasmic kinase TaRIPK8 in constructing a model of a cereal crop susceptible to stripe rust, wherein the ORF sequence encoding includes a gene with a nucleotide sequence as shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0010] Preferably, the cereal crop includes wheat.

[0011] The application further provides a cultivation method of a stripe rust resistant variety of a cereal crop, including the following steps: knocking out an ORF sequence encoding a wheat-like receptor cytoplasmic kinase TaRIPK8 by using a CRISPR-Cas9 technology; and the ORF sequence encoding includes a gene with a nucleotide sequence as shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0012] Preferably, the cereal crop includes wheat.

[0013] The application further provides a construction method of a model of a cereal crop susceptible to stripe rust, including the following steps: constructing an overexpression vector of an ORF sequence encoding a wheat-like receptor cytoplasmic kinase TaRIPK8, transforming a cereal crop cell, and obtaining a model of a cereal crop susceptible to stripe rust; and the ORF sequence encoding includes a gene with a nucleotide sequence as shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0014] The application provides an application of a wheat-like receptor cytoplasmic kinase TaRIPK8 in the regulation of the resistance to stripe rust of a cereal crop and / or the improvement or cultivation of a stripe rust resistant variety of the cereal crop, wherein the wheat-like receptor cytoplasmic kinase TaRIPK8 includes a protein with an amino acid sequence as shown in SEQ ID NO. 1 or SEQ ID NO. 2. The wheat-like receptor cytoplasmic kinase TaRIPK8 of the application is involved in the negative regulation of wheat to Puccinia striiformis, and based on this, a high-stripe rust resistant variety can be created, and a good wheat material is provided for the cultivation of a stripe rust resistant variety. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0016] Figure 1 Schematic diagram of expression profile analysis of the receptor-like cytoplasmic kinase TaRIPK8 gene provided in an embodiment of the present invention;

[0017] Figure 2 The embodiment of the present invention provides TaRIPK8 Schematic diagram of gene-edited plants;

[0018] Figure 3 The embodiment of the present invention provides TaRIPK8 Schematic diagram of the phenotypic results of gene-edited plants. DETAILED DESCRIPTION

[0019] The present invention provides an application of a wheat receptor cytoplasmic kinase TaRIPK8 in regulating the stripe rust resistance traits of cereal crops and / or improving or breeding stripe rust resistant varieties of cereal crops. The wheat receptor cytoplasmic kinase TaRIPK8 includes a protein having an amino acid sequence shown in SEQ ID NO.1 or SEQ ID NO.2.

[0020] The receptor-like cytoplasmic kinase TaRIPK8 of the present invention is involved in the negative regulation of wheat on stripe rust fungi. Based on this, a strain with high resistance to stripe rust can be created, which is of great significance for breeding wheat varieties with long-lasting resistance to stripe rust.

[0021] In the present application, the amino acid sequence TaRIPK8-7B shown in SEQ ID NO. 1 is specifically: MPRASKKKQRSAWGSLLGSCLGGGGGKTGKQVRPGPGPRKRESSAAAGAGQRLSFTDVMSAASEQELSVSLVGSNLHVFTVAELKAATQGFLDDNFLGEGGFGPVYKGAVDDKVKPGLKAQPIAVKLWDPQGAQGHKEWLSEVIFLGQLRHTNLVKLIGYCCEDENRLLVYEYMAKGSLENHLFKKFPPVLSWSTRLNIAVGAAKGLAFLHDAEKPVIYRDFKASNILLDPDYKAKLSDFGLAKDGPEGDETHVSTRVMGTHGYAAPEYILTGHLTAKSDVYSFGVVLLEILTGRRAVDKTRPSREHHLVQHMRSWLKDPEKLGKIMDPALEGKYATTAAHKAALVAYQCLSGSPKSRPDMSKVVEDLELLLNLVDDVPGEPVMHVASQDDTRKERTRRRNGERESSNEGHRNKAKPPKKTVRGRGNQSEELWEWNTPREGKI.

[0022] In the present application, the amino acid sequence TaRIPK8-7D shown in SEQ ID NO. 2 is specifically: MPRASKKKQRSAWGSLLGSCLGGGGGKTGKQVRPGPGPRKRESSAAAVGGGVGQRLSFTDVMSMSAASEQELSVSLVGSNLHVFTVAELKAATQGFLDDNFLGEGGFGPVYKGAVDDKVKPGLKAQPIAVKLWDPQGAQGHKEWLSEVIFLGQLRHTNLVKLIGYCCEDENRLLVYEYMAKGSLENHLFKKFPPVLSWSTRLNIAVGAAKGLAFLHDAEKPVIYRDFKASNILLDPDYKAKLSDFGLAKDGPEGDETHVSTRVMGTHGYAAPEYILTGHLTAKSDVYSFGVVLLEILTGRRAVDKTRPSREHHLVQHMRSWLKDPEKLGKIMDPALEGKYATMAAHKAALVAYQCLSGSPKSRPDMSKVVENLELLLNLVDDVPGKPVMHVASQDDTRKEKTTRRNGERESNNGGHRNKARPPKKTVRGRGNQSEELWEWNTPGEGKI.

[0023] The application also provides application of an encoding ORF sequence of a wheat receptor cytoplasmic kinase TaRIPK8 in regulation of a stripe rust resistance trait of a cereal crop and / or improvement or cultivation of a stripe rust resistant variety of the cereal crop, wherein the encoding ORF sequence comprises a gene of a nucleotide sequence shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0024] The application uses a reverse genetics method to study a wheat receptor cytoplasmic kinase TaRIPK8 gene, TaRIPK8 The gene is up-regulated by an inducible expression of a compatible race of stripe rust fungus and down-regulated by an inducible expression of a non-compatible race of stripe rust fungus, and the gene is silenced by using a CRISPR / CAS9 technology, and a gene edited wheat plant obtained by the method exhibits resistance to a stripe rust fungus CYR32. TaRIPK8 The gene plays a negative regulation role in wheat resistance to stripe rust.Therefore, the gene can be used to improve a disease resistance trait of wheat, so that a new disease resistant material resistant to wheat stripe rust is cultivated. TaRIPK8 TaRIPK8

[0025] ​

[0026]

[0027] The application also provides application of a CRISPR / CAS9 vector of an encoding ORF sequence of a wheat receptor cytoplasmic kinase TaRIPK8 in regulation of a stripe rust resistance trait of a cereal crop and / or improvement or cultivation of a stripe rust resistance variety of the cereal crop, wherein the encoding ORF sequence comprises a gene of a nucleotide sequence shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0028] The application does not have special limitations on the construction method of the CRISPR / CAS9 vector, and a conventional method in the field can be used.

[0029] The application also provides application of a recombinant bacterium in regulation of a stripe rust resistance trait of a cereal crop and / or improvement or cultivation of a stripe rust resistance variety of the cereal crop, wherein the recombinant bacterium contains a CRISPR / CAS9 vector of an encoding ORF sequence of a wheat receptor cytoplasmic kinase TaRIPK8; and the encoding ORF sequence comprises a gene of a nucleotide sequence shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0030] The application does not have special limitations on the construction method of the recombinant bacterium, and a conventional method in the field can be used.

[0031] The application also provides application of a knockout or knockdown of an encoding ORF sequence of a wheat receptor cytoplasmic kinase TaRIPK8 in improvement of stripe rust resistance of a cereal crop, wherein the encoding ORF sequence comprises a gene of a nucleotide sequence shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0032] The application also provides application of overexpression of an encoding ORF sequence of a wheat receptor cytoplasmic kinase TaRIPK8 in construction of a stripe rust susceptible cereal crop model, wherein the encoding ORF sequence comprises a gene of a nucleotide sequence shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0033] As an implementation form, the cereal crop is a cereal crop that can be successfully infected by a wheat stripe rust fungus, and further includes wheat.

[0034] The application also provides a cultivation method of a stripe rust resistant cereal crop variety, comprising the following steps: knocking out an encoding ORF sequence of a wheat receptor cytoplasmic kinase TaRIPK8 by using a CRISPR-Cas9 technology; and the encoding ORF sequence comprises a gene of a nucleotide sequence shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0035] As an implementation form, the cereal crop is a cereal crop that can be successfully infected by a wheat stripe rust fungus, and further includes wheat.

[0036] As an embodiment, the coding ORF sequence of the key gene in the interaction between wheat and Puccinia striiformis Westend. f. sp. tritici is knocked out by using CRISPR-Cas9 technology, including: constructing the CRISPR / CAS9 vector described in the above scheme, transforming the immature embryo of the cereal crop by using the method of agrobacterium-mediated genetic transformation, and obtaining the gene editing silencing plant of TaRIPK8.

[0037] The present application discloses a key gene in the interaction between wheat and Puccinia striiformis Westend. f. sp. tritici TaRIPK8 The gene editing plant of TaRIPK8 is obtained by using CRISPR / CAS9 vector and agrobacterium-mediated genetic transformation, and the gene editing silencing plant shows resistance to the main epidemic race of Puccinia striiformis Westend. f. sp. tritici.

[0038] The present application also provides a construction method of a cereal crop model susceptible to stripe rust, including the following steps: constructing an overexpression vector of a coding ORF sequence of a wheat-like receptor cytoplasmic kinase TaRIPK8, transforming the cereal crop cell, and obtaining the cereal crop model susceptible to stripe rust; the coding ORF sequence includes a gene with the nucleotide sequence shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0039] As an embodiment, the cereal crop is a cereal crop that can be successfully infected by Puccinia striiformis Westend. f. sp. tritici, and further includes wheat.

[0040] In order to further illustrate the present application, the wheat-like receptor cytoplasmic kinase TaRIPK8 and its application in the improvement of the stripe rust resistant variety of the cereal crop provided by the present application are described in detail below in combination with the drawings and examples, but they cannot be understood as the limitation of the protection scope of the present application.

[0041] Example 1

[0042] The primers used are as follows:

[0043] The quantitative primer: forward primer: TaRIPK87D-qRT-F: GGAAAGGGAGAGCAATAATGG (SEQ ID NO. 5), reverse primer: TaRIPK87D-qRT-R: CCACCCAAAGAAAGTGTCCTAC (SEQ ID NO. 6).

[0044] The internal reference primer: forward primer: TaEF1-F: TGGTGTCATCAAGCCTGGTATGGT (SEQ ID NO. 7), reverse primer: TaEF1-R: ACTCATGGTGCATCTCAACGGACT (SEQ ID NO. 8).

[0045] Firstly, a CRISPR / CAS9 vector of TaRIPK8 is constructed, and a method of agrobacterium-mediated genetic transformation is used to transform wheat young embryos, so that a gene editing knockout plant of TaRIPK8 is obtained;

[0046] Secondly, the obtained gene plant is subjected to molecular detection, the T1 generation of the gene editing plant is inoculated with a prevailing race of stripe rust, the resistance of the gene editing plant to the prevailing race of stripe rust is identified, and finally the role of the TaRIPK8 gene editing silencing plant in the improvement of the wheat resistance to stripe rust is determined.

[0047] The application of the wheat receptor cytoplasmic kinase TaRIPK8 in the improvement of the wheat resistance to rust provided by the embodiment of the application is used first, in order to determine the preliminary analysis of the function of TaRIPK8 in the interaction between wheat and stripe rust, the expression profile analysis of TaRIPK8 in different stages of the compatible and incompatible systems of the wheat infected by stripe rust is performed, and the result shows that the expression amount of TaRIPK8 reaches the highest in the compatible system infected by stripe rust for 48 h, and the expression of TaRIPK8 is down-regulated in the incompatible system. It is illustrated that TaRIPK8 may play a function in the process of the wheat susceptible to stripe rust.

[0048] Embodiment 2

[0049] Gene editing target fragment sequence:

[0050] Target1: AGGGAGGGGGAACCAAAGCG (SEQ ID NO. 9);

[0051] Target2: TGGCAGCCCAAAGAGCAGGC (SEQ ID NO. 10);

[0052] Gene editing sequencing primer:

[0053] Target 1 - forward primer: TaRIPK8-target1-F: GTGATGCATGTAGCTTCACAAGA TG (SEQ ID NO. 11), reverse primer: TaRIPK8-target1-R: TGCAACCATCAACATGTACATCCAC (SEQ ID NO. 12).

[0054] Target 2 - forward primer: TaRIPK8-target2-F: AAAGCTAGGAAAAATCATGGAC (SEQ ID NO. 13), reverse primer: TaRIPK8-target2-R: GTCATCTTGTGAAGCTACATGCATC (SEQ ID NO. 14).

[0055] First step: using qRT-PCR technology, using the elongation factor gene TaEF1-alpha as the internal reference; using the specific primers of the receptor-like cytoplasmic kinase gene TaRIPK8 to carry out real-time fluorescent quantitative PCR, so as to determine the expression amount of the TaRIPK8 gene in different infection times of the wheat infected by the stripe rust fungus. TaRIPK8 ).

[0056] Second step: when the TaRIPK8 gene editing plant grows to the 'one leaf one heart' period, the 'one leaf' of the wheat plant is taken and the DNA is extracted for molecular detection, the TaRIPK8 gene editing plant is continued to be cultured, when it grows to the 'two leaves one heart' period, the 'two leaves' of the wheat TaRIPK8-7B, 7D two copy full editing plant L37, L40 two strains are inoculated with fresh urediniospores of the stripe rust fungus CYR32, and the phenotype of the gene editing wheat leaf and the control Fielder leaf is observed on the 14th day after inoculation.

[0057] The application of the wheat receptor-like cytoplasmic kinase TaRIPK8 in the improvement of the wheat rust-resistant variety provided by the embodiment of the application is edited by using the CRISPR / CAS9 wheat genetic transformation technology, and two specific fragments of TaRIPK8 are edited respectively. Figure 1 When the gene editing plant grows to the 'one leaf one heart' period, the 'one leaf' of the wheat plant is taken and the DNA is extracted for molecular detection, the TaRIPK8 gene editing plant is continued to be cultured, when it grows to the 'two leaves one heart' period, the 'two leaves' of the wheat TaRIPK8-7B, 7D two copy full editing plant L37, L40 two strains are inoculated with fresh urediniospores of the stripe rust fungus CYR32, and the phenotype of the gene editing wheat leaf and the control Fielder leaf is observed on the 14th day after inoculation. TaRIPK8 ) 'two leaves' are inoculated with fresh urediniospores of the stripe rust fungus CYR32, and the phenotype of the gene editing wheat leaf Figure 2 and TaRIPK8 KO#L37 The necrosis of the gene editing wheat leaf is significantly increased compared with the control Fielder leaf, and no urediniospores are produced. TaRIPK8 KO#L40 Figure 3 It is proved that the TaRIPK8 editing material can significantly increase the resistance of the wheat to the stripe rust fungus.

[0058] Although the above embodiment describes the application in detail, it is only a part of the embodiments of the application, not all the embodiments, and other embodiments can be obtained according to the embodiment without creativity, and these embodiments all belong to the protection scope of the application.

Claims

1. Application of knocking out the coding ORF sequence of wheat receptor cytoplasmic kinase TaRIPK8 in improving wheat stripe rust resistance, characterized in that: The coding ORF sequence is a gene with a nucleotide sequence shown as SEQ ID NO.3 or SEQ ID NO.

4.

2. A method for breeding a stripe rust-resistant wheat variety, characterized in that: The following steps are involved: The CRISPR-Cas9 technology is used to knock out the coding ORF sequence of wheat receptor cytoplasmic kinase TaRIPK8; the coding ORF sequence is a gene with a nucleotide sequence shown in SEQ ID NO.3 or SEQ ID NO.4.

Images