Broad-spectrum aptamer for simultaneously recognizing multiple protozoan polyphosphate and application thereof

Abstract

The application belongs to the technical field of molecular biology, and particularly relates to a broad-spectrum aptamer for simultaneously recognizing multiple protoxinic acids and an application thereof. The aptamer comprises a nucleotide sequence shown in AZAs-apt1, or a nucleotide sequence shown in AZAs-apt2, or a nucleotide sequence shown in AZAs-apt2t, or a nucleotide sequence complementary to the above sequences, a nucleotide sequence that can simultaneously recognize multiple protoxinic acids and maintain affinity, a nucleotide sequence having at least 90% homology with the above sequences and being capable of simultaneously and specifically binding protoxinic acid-1, protoxinic acid-2 and protoxinic acid-3, or a chemically modified nucleotide sequence having at least 90% homology with the above sequences and being capable of recognizing multiple protoxinic acids. The broad-spectrum aptamer can detect the total amount of AZA1, AZA2 and AZA3.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular biology, and particularly relates to a broad-spectrum aptamer for simultaneously recognizing multiple azaspiracids and application thereof. BACKGROUND

[0002] Aptamer is an oligonucleotide sequence with high specificity and affinity to a target obtained by screening from a random oligonucleotide library through an exponential enrichment ligand system evolution technology. Compared with antibodies, aptamer has the characteristics of stable property, easy modification and low immunogenicity. In recent years, it is an important research hotspot to construct an aptamer sensing analysis method by screening aptamer, so as to realize high selectivity and high affinity determination of a target molecule.

[0003] Azaspiracids (AZAs) are a kind of common polyether marine shellfish toxins. AZAs are stable in structure and have high toxicity, and cannot be removed by conventional cooking and processing. After eating marine products contaminated by AZAs, people will suffer from nausea, vomiting, severe diarrhea, gastrointestinal cramps and other discomforts. Screening of AZA aptamer and detection of AZAs are of great significance for improving the safety of aquatic products and protecting the health of consumers.

[0004] Up to now, more than 70 AZA isomers have been found, among which azaspiracids-1 (AZA1), azaspiracids-2 (AZA2) and azaspiracids-3 (AZA3) have the highest content and toxicity. From the molecular structure, AZA1, AZA2 and AZA3 only differ in-CH3. Considering that they may exist in the same sea area or biological sample at the same time, it is necessary to screen a broad-spectrum aptamer for simultaneously recognizing AZA1, AZA2 and AZA3, so as to realize simultaneous detection of the total amount of the three azaspiracids and provide technical support for early warning detection of the content of marine algal toxins.

[0005] In the previous study, we used MRGO-SELEX technology based on magnetic reduced graphene oxide (MRGO-SELEX) to screen the aptamer of AZA1 (invention patent CN202410479989.2) by taking AZA1 as the target molecule. However, the aptamer only has good specificity for AZA1 and cannot realize simultaneous recognition of AZA1, AZA2 and AZA3. At present, there is no related report on a broad-spectrum aptamer for simultaneously recognizing AZA1, AZA2 and AZA3. SUMMARY

[0006] The present application aims to provide a broad-spectrum aptamer for simultaneously recognizing multiple protoxinic acids and an application thereof.

[0007] To achieve the above-mentioned purpose, the technical solution adopted by the present application is as follows:

[0008] A broad-spectrum aptamer for simultaneously recognizing multiple protoxinic acids, the nucleic acid aptamer comprising the following selection

[0009] (1) the nucleotide sequence shown in AZAs-apt1; or

[0010] (2) the nucleotide sequence shown in AZAs-apt2; or

[0011] (3) the nucleotide sequence shown in AZAs-apt2t; or

[0012] (4) a nucleotide sequence having complementarity with the sequence of (1) or (2) or (3) and simultaneously recognizing multiple protoxinic acids and maintaining affinity; or

[0013] (5) a nucleotide sequence having at least 90% homology with the sequence of (1) or (2) or (3) or (4) and being capable of simultaneously and specifically binding protoxinic acid-1, protoxinic acid-2 and protoxinic acid-3; or

[0014] (6) a chemically modified nucleotide sequence having at least 90% homology with the sequence of (1) or (2) or (3) or (4) or (5) and being capable of recognizing multiple protoxinic acids.

[0015] The chemical modification is at least one base being thiolated, phosphorylated, aminated, methylated or isotopically labeled.

[0016] As an improvement to the above technical solution, a certain position on the nucleotide sequence of the above-mentioned nucleic acid aptamer can be modified, for example, thiolation, phosphorylation, amination, methylation or isotopic labeling, provided that the nucleic acid aptamer sequence obtained after modification has desirable properties, for example, it can have equal or higher affinity for protoxinic acid-1, protoxinic acid-2 or protoxinic acid-3 than the parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.

[0017] The aptamer or modified aptamer is further connected to a label.

[0018] The label comprises at least one of biotin, a luminescent substance and an enzyme.

[0019] As an improvement of the above technical solution, at least one of biotin, a luminescent substance and an enzyme can be connected to the nucleotide sequence of the above aptamer, provided that the sequence of the modified aptamer has desirable properties, for example, it can have equal or higher affinity to the simultaneous binding of protoxin-1, protoxin-2 and protoxin-3 as compared with the parent aptamer sequence before modification, or it has higher stability although the affinity is not significantly improved.

[0020] The broad-spectrum aptamer is

[0021] AZAs-apt1: ATAGGCTCACCTCGCTATGGGCAGACCTAATCTGTCCCATAGCATAGAGGGGAGGACTCACCATAGCGAGCATCCGAGTT; (Sequence 1)

[0022] AZAs-apt2: ATAGGCTCACCTCGCTATGGGAGCAGCAGTCTGGAGTATACTTCCACGGCTGAGAGGGGCCCATAGCGAGCATCCGAGTT; (Sequence 2)

[0023] AZAs-apt2t: CGGGAGCAGATTCCACGGCTGAGTGGTACCCG. (Sequence 3)

[0024] The plurality of protoxins are one or more of protoxin-1 (AZA1), protoxin-2 (AZA2) and protoxin-3 (AZA3).

[0025] The structural formula of AZA1 is: ;

[0026] The structural formula of AZA2 is: ;

[0027] The structural formula of AZA3 is: .

[0028] The application of the broad-spectrum aptamer, the application of the aptamer in any one of the following,

[0029] (1) the application of separating and purifying any one or more of the plurality of protoxins;

[0030] (2) the application of labeling any one or more of the plurality of protoxins;

[0031] (3) The application of the quantitative or qualitative detection of any one or several of the multiple protoxanthines.

[0032] The advantages and positive effects of the present application are:

[0033] (1) Compared with the aptamer which can only recognize a single protoxanthine-1, the present application uses the Capture-SELEX technology to obtain a broad-spectrum aptamer with high affinity and high specificity to AZA1, AZA2 and AZA3;

[0034] (2) The present application expands the types of molecular probes for detecting protoxanthines;

[0035] (3) The broad-spectrum aptamer proposed in the present application can detect the total amount of AZA1, AZA2 and AZA3, providing technical support for early warning detection of the content of marine algal toxins. BRIEF DESCRIPTION OF DRAWINGS

[0036] Figure 1 The schematic diagram for the screening process of the aptamer of the present application.

[0037] Figure 2 The electrophoresis map of the PCR amplification product in the screening process provided by the embodiment of the present application; wherein, lane: 1. 50bp DNA Ladder, 2-3. PCR amplification product, 4. PCR amplification blank control, 50bp DNA Ladder bands from bottom to top are: 50bp, 100bp, 150bp, 200bp, 250bp, 300bp, 400bp, 500bp.

[0038] Figure 3 The electrophoresis map of the preparation of single-stranded provided by the screening process of the embodiment of the present application; wherein, lane: 1. 50bp DNA Ladder, 2. 80nt-ssDNA, 3. PCR recovery ssDNA, 50bp DNA Ladder bands from bottom to top are: 50bp, 100bp, 150bp, 200bp, 250bp, 300bp, 400bp, 500bp.

[0039] Figure 4 The retention rate in the screening process of 15 rounds provided by the embodiment of the present application, wherein, A is the retention rate of the mixture of AZA1, AZA2 and AZA3 as the target in the first-12 rounds of screening process, B is the retention rate of AZA2 as the target in the 13-15 rounds of screening process, C is the retention rate of AZA3 as the target in the 13-15 rounds of screening process.

[0040] Figure 5The affinity results of the preselected aptamer identified by using the magnetic graphene oxide provided by the embodiment of the present application, wherein A is the affinity determination result of the broad-spectrum nucleic acid aptamer AZAs-apt1 to AZA1 toxin, B is the affinity determination result of the broad-spectrum nucleic acid aptamer AZAs-apt1 to AZA2 toxin, C is the affinity determination result of the broad-spectrum nucleic acid aptamer AZAs-apt1 to AZA3 toxin, D is the affinity determination result of the broad-spectrum nucleic acid aptamer AZAs-apt2 to AZA1 toxin, E is the affinity determination result of the broad-spectrum nucleic acid aptamer AZAs-apt2 to AZA2 toxin, and F is the affinity determination result of the broad-spectrum nucleic acid aptamer AZAs-apt2 to AZA3 toxin.

[0041] Figure 6 The affinity results of the truncated and optimized aptamer provided by the embodiment of the present application, wherein A is the affinity determination result of the broad-spectrum nucleic acid aptamer AZAs-apt2t to AZA1 toxin, B is the affinity determination result of the broad-spectrum nucleic acid aptamer AZAs-apt2t to AZA2 toxin, and C is the affinity determination result of the broad-spectrum nucleic acid aptamer AZAs-apt2t to AZA3 toxin.

[0042] Figure 7 The specificity results of the truncated and optimized aptamer provided by the embodiment of the present application.

[0043] Figure 8 The linear range of sample detection in the embodiment of the present application, wherein A is the detection linear range of the graphene aptamer sensor to AZA1 toxin, B is the detection linear range of the graphene aptamer sensor to AZA2 toxin, and C is the detection linear range of the graphene aptamer sensor to AZA3 toxin.

[0044] Figure 9 The selectivity of sample detection in the embodiment of the present application. DETAILED DESCRIPTION

[0045] The technical solutions of the present application will be described clearly and completely in combination with the embodiments. Obviously, the described embodiments are only a part of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the present application.

[0046] The present application is based on the Capture-SELEX technology, and a broad-spectrum nucleic acid aptamer for protoxin-1, protoxin-2 and protoxin-3 is screened by taking protoxin-1, protoxin-2 and protoxin-3 as targets. Further, the binding sites of the broad-spectrum nucleic acid aptamer to protoxin-1, protoxin-2 and protoxin-3 are obtained through sequence analysis and molecular docking simulation. Based on the analysis results and the secondary structure of the broad-spectrum nucleic acid aptamer, the sequence of the screened aptamer is optimized to obtain an aptamer with high affinity and specific recognition to protoxin-1, protoxin-2 and protoxin-3. Example 1

[0047] The specific binding of the broad-spectrum nucleic acid aptamer to protoxin-1, protoxin-2 and protoxin-3 is screened, as shown in the following specific steps: Figure 1

[0048] (1). The random nucleic acid library and primer information used in the screening of the broad-spectrum nucleic acid aptamer are shown in Table 1, which are synthesized by Shengong Bioengineering (Shanghai) Co., Ltd. In the random library, "N40" represents a sequence of 40 arbitrary nucleotide bases. The library and primers are prepared into 100 μM storage solution with a screening buffer (50 mM Tris, 150 mM NaCl, 2 mM MgCl2, pH 7.4) and stored at -20℃ for standby.

[0049] (2). The Capture-SELEX technology is used for aptamer screening. The screening conditions used in each round, including the ssDNA concentration, the concentration of the target protoxin-1, protoxin-2 and protoxin-3, the type and concentration of the counter-screening target, and the incubation time, are shown in Table 2. The specific screening steps are as follows:

[0050] The capture nucleic acid is combined with the nucleic acid library. The incubation conditions are as follows: 94℃, 10 min, -0.1℃ / s cooling to 60℃, 60℃, 1 min, -0.1℃ / s cooling to 25℃, 60℃, 30 min. The concentration of the capture nucleic acid in the complex is 2.0 μM, and the concentration of the nucleic acid library is 1.0 μM. The nucleic acid library is fixed to the surface of the magnetic beads. The streptavidin-modified magnetic beads (10 mg / mL) are washed with ddH2O for three times, washed with the screening buffer (50 mM Tris, 150 mM NaCl, 2 mM MgCl2, pH 7.4) for three times, the supernatant is removed, the incubated mixture of the capture nucleic acid and the nucleic acid library is added, and the mixture is incubated at 25℃ with 1500 rpm shaking for 20 min to obtain the magnetic beads modified with the random library.

[0051] ​Adaptor screening was performed. A certain amount of target was vacuum dried at 40°C, 10 μL of methanol was added; the modified magnetic beads of random library were washed 10 times, the supernatant was removed, 200 μL of buffer was added, the target was added, and incubation was performed at 25°C with 1500 rpm shaking, magnetic separation was performed, and the supernatant was used as a PCR template for preparing the nucleic acid library required for the next round of screening.

[0052] In the 10th to 15th rounds of screening, counter screening was introduced. The specific experimental steps were as follows: a certain amount of counter screening target was added to the modified magnetic beads of random library in a certain proportion, including okadaic acid (OA), scallop toxin (PTX), domoic acid (DA), saxitoxin (STX), and gonyatoxin (GTX1 / 4, GTX2 / 3), and incubation was performed for a period of time. Then, the obtained solution was subjected to magnetic separation, the supernatant was discarded, the magnetic beads were washed 10 times with screening buffer to remove the non-specifically adsorbed counter screening target and the counter screening target-nucleic acid complex. Finally, the magnetic beads were dispersed into screening buffer containing a certain concentration of target, and the incubation and magnetic separation operation steps were performed again. The supernatant was taken, purified, subjected to PCR amplification, and single-stranded secondary library preparation.

[0053] Table 1 DNA sequences used in SELEX

[0054]

[0055] Table 2 Experimental conditions in each round of SELEX

[0056]

[0057] Incubation time: T 正筛孵育时间 / T 反筛孵育时间 .

[0058] The PCR amplification and single-stranded secondary library preparation had the following specific steps:

[0059] (1). PCR reaction was performed using a 50 μL reaction system, and the amounts of various reagents were as follows: 10.0 μL of upstream primer (1.0 μM), 10.0 μL of downstream primer (1.0 μM), 1.0 μL of dNTP Mixture (25 μM each), 1.0 μL of Taq plus DNA polymerase (5 U / μL), 5.0 μL of template (supernatant obtained by screening or diluted supernatant obtained by screening), and 15.5 μL of sterilized water. The PCR reaction program was as follows: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 60°C annealing for 15 s, 72°C extension for 15 s, 20 cycles, 72°C extension for 5 min at last, and temporary storage at 4°C.

[0060] (2). PCR product was identified by 12% PAGE gel electrophoresis. The PCR product was electrophoresed at 100 V for 45 min, and then the gel was stained with GelRed nucleic acid dye for 20 min. The gel was imaged in a gel imaging system to observe the band position and purity of the PCR amplification product. The electrophoresis picture is as follows Figure 2 From the above picture, it can be seen that the PCR amplification product band is clear and has no impurity band, and the band position is correct, indicating that PCR does not occur non-specific amplification, and the amplification product meets the experimental requirements. Figure 2

[0061] (3). Single-stranded was prepared by magnetic bead method. 200 μL of streptavidin-modified magnetic beads (10 mg / mL) was washed with ddH2O for three times, and then washed with Wash Buffer (10 mM Tris-HCI, 2 M NaCI, 1 mM EDTA, pH 7.5) for three times, and the supernatant was removed by magnetic separation. 1000 μL of PCR amplification product was added to the washed magnetic beads. NaCI was added to the system to a final concentration of 2.0 M. The mixture was incubated at room temperature for 30 min, and the supernatant was removed by magnetic separation. The magnetic beads were washed with Wash Buffer for five times to remove as much as possible the nucleic acids not bound to the surface of the magnetic beads, and the supernatant was removed by magnetic separation. 200 μL of NaOH solution with a concentration of 200 mM was added, and the mixture was mixed by blowing for 2 min. The magnetic beads were removed by magnetic separation, and 0.1 times the total volume of 3 M NaAc solution and 2 times the total volume of anhydrous ethanol were added. After mixing the solution, it was placed in a -80°C refrigerator for 2 h to precipitate and recover the single-stranded nucleic acids. The electrophoresis picture is as follows Figure 3 The band position of the obtained single-stranded nucleic acids is the same as that of the original single-stranded nucleic acid library, and there is no impurity band, indicating that the single-stranded nucleic acids are successfully prepared, and the single-stranded nucleic acids prepared in the experiment can be used for later experiments.

[0062] (4) The amount of nucleic acids in the supernatant obtained in each screening was quantified by qPCR. The amount of each reagent used in the reaction was as follows: 2.0 μL of upstream primer (1.0 μM), 2.0 μL of downstream primer (1.0 μM), 5.0 μL of template (supernatant obtained by screening or diluted supernatant obtained by screening), 1.0 μL of sterile water, and 10 μL of SGExcel FastSYBR qPCR premix. The PCR reaction program was as follows: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 60°C annealing for 15 s, 72°C extension for 15 s, 30 cycles, and finally 72°C extension for 5 min.

[0063] (5). qPCR result analysis. The amount of nucleic acids in the supernatant obtained in each screening was calculated according to the amplification curve of qPCR, and the retention rate (D) of each eluent was calculated. The retention rate formula is as follows

[0064] ​D = N1 / N2 x 100%, wherein N1 is the amount of ssDNA in the supernatant after each round of screening, and N2 is the input amount of ssDNA. The input amount of ssDNA is calculated as N2 = N total –N supernate , wherein N total is the total amount of nucleic acid library input into the experiment, and N supernate is the remaining amount of ssDNA library in the supernatant after incubation of the mixture of the capture nucleic acid and the nucleic acid library with the SA-MB magnetic beads. The retention rate is used to determine the progress of the screening. The retention rate of each round of screening is shown in Table 1. Figure 4 .

[0065] The sequences of the broad-spectrum nucleic acid aptamers of Prorocentrum donghaiense-1, Prorocentrum donghaiense-2 and Prorocentrum donghaiense-3 obtained by the above screening were analyzed and affinity determination was performed, and the specific steps are as follows.

[0066] (1). After 15 rounds of screening, nucleic acid sequences with good affinity and specificity to Prorocentrum donghaiense-1, Prorocentrum donghaiense-2 and Prorocentrum donghaiense-3 were enriched. The PCR products of the 12th round of aptamer screening (S12 library, target is Prorocentrum donghaiense-1, Prorocentrum donghaiense-2 and Prorocentrum donghaiense-3), the 15th round of aptamer screening against Prorocentrum donghaiense-2 (S15-AZA2 library, target is Prorocentrum donghaiense-2) and the 15th round of aptamer screening against Prorocentrum donghaiense-3 (S15-AZA3 library, target is Prorocentrum donghaiense-2) were purified after PAGE gel electrophoresis detection, and finally high-throughput sequencing was performed.

[0067] (2). Comparative analysis of high-throughput sequencing results, sequences with high content in the mixed library (S12 library) but with decreased content in the other two libraries may have good affinity to Prorocentrum donghaiense-1, and no or poor affinity to Prorocentrum donghaiense-2 and Prorocentrum donghaiense-3; sequences with high content in the S15-AZA2 library but with decreased content in the other two libraries may have good affinity to Prorocentrum donghaiense-2, and no or poor affinity to Prorocentrum donghaiense-1 and Prorocentrum donghaiense-3; sequences with high content in the S15-AZA3 library but with decreased content in the other two libraries may have good affinity to Prorocentrum donghaiense-3, and no or poor affinity to Prorocentrum donghaiense-1 and Prorocentrum donghaiense-2. Sequences with high content in all three libraries may have good affinity to all three toxins and are candidate sequences for broad-spectrum aptamers. These sequences were selected for further analysis.

[0068] (3). UNAfold was used to calculate the melting temperature (Tm) of the sequences at 37℃, 150mM Na + , 2mM Mg 2+Under these conditions, the secondary structure and free energy of the preselected sequences were further analyzed. Based on the above analysis results, two of the most representative sequences from each family were selected as preselected sequences for the broad-spectrum aptamers of proto-alginate-1, proto-alginate-2, and proto-alginate-3, and affinity analysis was performed.

[0069] (4) Affinity analysis of preselected aptamers. The affinity of the selected preselected aptamers for proto-alginate-1, proto-alginate-2, or proto-alginate-3 was determined by MRGO-fluorescence competition assay. FAM-labeled candidate aptamers were denatured at 95°C for 5 min and then rapidly cooled to 4°C. Different concentrations of preselected aptamers were mixed with MRGO and incubated for 30 min. After magnetic separation, the fluorescence intensity of the collected supernatant was measured using a fluorescence spectrophotometer (excitation wavelength 490 nm, emission wavelength 520 nm). The dissociation constant (K0) of each sequence was calculated by nonlinear fitting of the binding saturation curve plotted using fluorescence intensity. d The results of the dissociation constant determination for two lines with good affinity are as follows: Figure 5 As shown, the corresponding sequence is as follows:

[0070] AZAs-apt1:ATAGGCTCACCTCGCTATGGGCAGACCTAATCTGTCCCATAGCATAGAGGGGAGGACTCACCATAGCGAGCATCCGAGTT

[0071] AZAs-apt2:ATAGGCTCACCTCGCTATGGGAGCAGCAGTCTGGAGTATACTTCCACGGCTGAGAGGGGCCCATAGCGAGCATCCGAGTT

[0072] Depend on Figure 5 It is evident that the broad-spectrum aptamer AZAs-apt1 has an affinity of 162.5 ± 12.4 nM for AZA1 toxin, 182.5 ± 26.9 nM for AZA2 toxin, and 144.7 ± 16.0 nM for AZA3 toxin; the broad-spectrum aptamer AZAs-apt2 has an affinity of 185.3 ± 19.0 nM for AZA1 toxin, 164.3 ± 19.7 nM for AZA2 toxin, and 193.2 ± 26.2 nM for AZA3 toxin. Both broad-spectrum aptamers AZAs-apt1 and AZAs-apt2 exhibit high affinity for all three toxins. Example 2

[0073] The binding sites and sequence optimization of the broad-spectrum nucleic acid aptamers AZAs-apt2 obtained from the above screening for proto-alginate-1, proto-alginate-2, and proto-alginate-3 were analyzed, and the steps are as follows:

[0074] (1). The secondary structure of aptamer was obtained by Mfold software, and the tertiary structure of aptamer was obtained by RNA Composer software. The 3D structures of protoxanthate-1, protoxanthate-2 and protoxanthate-3 were obtained by ChemSpider database. Then, the molecular docking simulation was performed by AutoDock4.2 software. According to the results of molecular docking, the binding site of aptamer and AZA1 was analyzed.

[0075] (2). According to the results of binding site analysis and the secondary structure of broad-spectrum aptamer, the truncation experiment of aptamer AZAs-apt2 was performed. The sequences of AZAs-apt2 and AZAs-apt2t obtained by truncation are shown in Table 3, and the affinity determination results are shown in Figure 6 After removing the redundant bases, the affinity of broad-spectrum aptamer to protoxanthate-1, protoxanthate-2 and protoxanthate-3 was significantly improved.

[0076] Table 3 Truncated sequences of AZAs-apt2

[0077] Example 3

[0078] The specificity of the truncated aptamer AZAs-apt2t was analyzed by MRGO-fluorescence competition method.

[0079] (1). The final concentration of MRGO was 1.5 μg / μL, and the final concentration of carboxyfluorescein (FAM) labeled aptamer AZAs-apt2t was 5 nM, 25 nM, 50 nM, 75 nM, 100 nM, 125 nM, 150 nM, 175 nM, 200 nM, respectively. The mixture was incubated at room temperature for 30 min in a homogenizer at a speed of 1500 rpm in the dark. After washing 3 times with selection buffer (50 mM Tris, 150 mM NaCl, 2 mM MgCl2, pH 7.4), magnetic separation was performed. The precipitate was mixed with protoxanthate-1, protoxanthate-2 and protoxanthate-3, and other several toxins, respectively. The other several toxins were okadaic acid (OA), pectenotoxin (PTXs), domoic acid (DA), saxitoxin (STX), and gymnodinium catenatum toxin (GTX1 / 4, GTX2 / 3), respectively. The mixture was incubated at room temperature for 30 min in a homogenizer at a speed of 1500 rpm in the dark. After magnetic separation, the fluorescence intensity of the supernatant was measured (light excitation wavelength 490 nm, emission wavelength 520 nm). By comparing the relative fluorescence ratio of protoxanthate-1, protoxanthate-2 and protoxanthate-3 with other different marine toxins, the specificity of the aptamer was estimated.

[0080] (2). The relative fluorescence ratio was calculated by ΔF toxin / ΔF AZA1-3 Given, where ΔF AZA1-3 and ΔF toxin are the ΔF values of protoxins-1, -2 and -3 and other toxins, respectively. ΔF = F - F0, where F and F0are the fluorescence intensities of the experimental group and the negative control, respectively. The specificity analysis of the truncated aptamer AZAs-apt2t is shown in Figure 7 , and it was found that the obtained aptamer had no affinity for a variety of marine toxins other than protoxins-1, -2 and -3, indicating that the obtained broad-spectrum aptamer had good specificity. Example 4

[0081] A magnetic reduced graphene oxide aptamer sensor was constructed using the obtained broad-spectrum aptamer as a recognition element, and performance analysis was then performed. Taking the AZAs-apt2t nucleic acid aptamer as an example, the specific steps are as follows.

[0082] (1). 100 nM fluorescein (FAM)-labeled broad-spectrum aptamer AZAs-apt2t was heated at 95°C for 5 min and then rapidly cooled to 4°C, mixed with MRGO at a final concentration of 1.5 μg / μL, and incubated at room temperature in a homogenizer at a rotation speed of 1500 rpm for 30 min in the dark. The precipitate was washed 3 times with screening buffer, magnetically separated, and free nucleic acid was removed.

[0083] (2). The linear range of the sensor was analyzed. The precipitate was redissolved, and 1000 μL of protoxins-1, -2 and -3 or a mixture of the three toxins (molar ratio 1:1:1) at concentrations of 1 nM, 5 nM, 10 nM, 25 nM, 50 nM, 75 nM and 100 nM, respectively, was added. The mixture was incubated at room temperature in a homogenizer at a rotation speed of 1500 rpm for 30 min in the dark, magnetically separated, and the fluorescence intensity of the supernatant was determined (see Figure 8 ).

[0084] As shown in Figure 8 , the linear regression equation of the fluorescence signal of the sensor for protoxin-1 was y = 21.6x + 37.9 (R 2 = 0.999), the detection range was 5-50 nM, and the detection limit was 2.6 nM; the linear regression equation of the fluorescence signal for protoxin-2 was y = 20.8x + 37.6 (R 2 = 0.988); the detection range was 5-50 nM, and the detection limit was 1.7 nM; and the linear regression equation of the fluorescence signal for protoxin-3 was y = 21.5x + 47.6 (R 2=0.999), the detection range was 5-50 nM, and the detection limit was 4.2 nM; the linear regression equation of the fluorescence signal of the mixture of the three toxins of protoxantin-1, protoxantin-2 and protoxantin-3 was y = 21.4x + 33.5 (R 2 =0.999); the detection limit was 2.4 nM. The sensor had the same detection range, close linearity and detection limit for protoxantin-1, protoxantin-2, protoxantin-3 and the mixture of the three toxins, indicating that the broad-spectrum aptamer screened can be used for simultaneous detection of various protoxantins.

[0085] (3). The specificity of the sensor was analyzed. The precipitate obtained in step (1) above was redissolved with a screening buffer (50 mM Tris, 150 mM NaCl, 2 mM MgCl2, pH 7.4), and after dissolution, 1000 μL of protoxantin-1, protoxantin-2, protoxantin-3, a mixture of the three toxins (molar ratio 1:1:1) above, and scallop toxin (PTXs), stone clam toxin (STX), donax acid (DA), okadaic acid (OA) or knee furrow algae toxin (GTX1 / 4, GTX2 / 3) with a concentration of 50 nM were added, and incubated at room temperature for 30 min in a homogenizer at a speed of 1500 rpm in the dark, magnetically separated, and the fluorescence intensity of the supernatant was determined. The concentration of protoxantin-1, protoxantin-2, protoxantin-3, a mixture of the three toxins or other competitive toxins was 50 nM, and the determination results were as follows: Figure 9 Protoxantin-1, protoxantin-2, protoxantin-3 or a mixture of the three toxins can cause a significant change in the fluorescence signal, while the other toxins did not cause a significant change in the fluorescence signal compared with the control group. It is indicated that the electrochemical sensor based on the broad-spectrum aptamer can realize specific detection of protoxantin.

Claims

1. A broad-spectrum aptamer that simultaneously recognizes multiple Prorocentrum micans polyphosphate, characterized in that: The nucleic acid aptamer is a nucleotide sequence selected from the following (1) AZAs-apt1; or (2) AZAs-apt2; or (3) AZAs-apt2t; or (4) a nucleotide sequence complementary to the sequence of (1) or (2) or (3) and capable of recognizing and maintaining affinity to multiple protoxanthines simultaneously; AZAs-apt1: ATAGGCTCACCTCGCTATGGGCAGACCTAATCTGTCCCATAGCATAGAGGGGAGGACTCACCATAGCGAGCATCCGAGTT; AZAs-apt2: ATAGGCTCACCTCGCTATGGGAGCAGCAGTCTGGAGTATACTTCCACGGCTGAGAGGGGCCCATAGCGAGCATCCGAGTT; AZAs-apt2t: CGGGAGCAGATTCCACGGCTGAGTGGTACCCG; The multiple protoxanthines are one or more of protoxanthine-1, protoxanthine-2 and protoxanthine-3.

2. The broad spectrum aptamer of claim 1 for simultaneous detection of multiple Prorocentrum spp., characterized in that: The aptamer or modified aptamer is further linked to a label.

3. The broad spectrum aptamer of claim 2, wherein the aptamer is capable of simultaneously recognizing multiple Prorocentrum micans acid. The label comprises at least one of biotin, a luminescent substance and an enzyme.

4. Use of the broad spectrum aptamer of claim 1, characterized in that, The nucleic acid aptamer is used for any of the following purposes: (1) application in isolating and purifying any one or more of the multiple protoxanthines; (2) application in labeling any one or more of the multiple protoxanthines; (3) application in quantitatively or qualitatively detecting any one or more of the multiple protoxanthines for non-disease diagnosis purposes; The multiple protoxanthines are one or more of protoxanthine-1, protoxanthine-2 and protoxanthine-3.

Images