Expression cassette, expression vector and expression method for efficiently expressing target gene or target protein

Abstract

The invention relates to an expression cassette, an expression vector and an expression method for efficiently expressing a target gene or target protein, and belongs to the technical field of biology. The method comprises the following steps: firstly, constructing an expression box for efficiently expressing a target gene or target protein, wherein the expression box comprises a 5 'UTR sequence, a 3' UTR sequence, a 35ST terminator and a Niben96 terminator; on the basis, an expression vector and an expression method for efficiently expressing the target gene or the target protein are constructed; the target protein disclosed by the invention comprises EGFP fluorescent protein and polypeptide ligase; according to the expression cassette, the expression vector and the expression method provided by the invention, the yield of the target protein can be remarkably improved, the technical purpose of efficiently expressing the polypeptide ligase from the nicotiana benthamiana is further realized by the method, and the obtained polypeptide ligase further realizes more efficient peptide cyclization and coupling effects; the invention provides an innovative method for efficient production of target protein and production of functional peptide and protein conjugates, and has wide biotechnology and treatment potential.

Description

Technical Field

[0001] The present invention relates to an expression cassette, an expression vector and an expression method for efficiently expressing a target gene or a target protein, and belongs to the field of biotechnology. Background of the Invention

[0002] Protein ligation and regulation are two fundamental processes in protein engineering and drug development, and enzymes with ligase capabilities are important biotechnological tools for protein conjugation, live cell labeling, and peptide cyclization. Plant-derived ligases, such as vacuolar processing enzymes and asparagine endopeptidases (AEPs), play important roles in the active areas of protein synthesis and modification. Vacuolar processing enzymes belong to the C13 family of cysteine ​​proteases. Asparagine endopeptidases are commonly found in leguminous plants and are involved in the processing and modification of several vacuolar proteins. They are initially synthesized as inactive precursors that undergo acidic autoactivation in mammalian vacuoles or lysosomes. These enzymes can selectively cleave the carboxyl-terminal side of asparagine (Asn) and aspartic acid (Asp).

[0003] Currently, various isomers of asparagine endopeptidases have been identified and characterized in several plants. These endopeptidases show higher transpeptidase activity in many key cellular processes, including splicing, proteolysis and ligation processes. Among them, Butelase-1 isolated from butterfly pea flower (Clitoria ternatea) has been shown to be the most efficient ligase and has various applications in food processing and biopharmaceuticals. Butelase-1 recognizes the Asx-His-Val tripeptide at the C-terminus of the protein and breaks the Asx-His peptide bond at a pH of 4 to 6.5, producing a residue that binds to the amino-terminal residue of another protein to form Asx-Xaa and complete the protein connection. In addition, Butelase-1 exhibits excellent catalytic efficiency, reaching 1340,000 M -1S-1 , its catalytic efficiency and hydrolysis capacity far exceed those of other ligases. Due to its high activity, Butelase-1 can open up new possibilities in protein generation, peptide macrocyclization, antibody-drug conjugation, cyclic oligomer formation and various other fields. However, its low yield seriously limits the practical value of Butelase-1. For example, 1 kg of fresh butterfly pea (Clitoria ternatea) pods only produces 5 mg of natural Butelase-1, and the extraction process is complicated and time-consuming. To date, AEPs have been achieved in a variety of expression systems, such as Escherichia coli, insect cells and yeast, with yields of 2, 15 and 12 mg / L, respectively. However, these expression systems are labor-intensive, complex, time-consuming, and costly, and require solubilization and renaturation to obtain functional proteins, resulting in low protein recovery rates.

[0004] Plants have proven to be viable systems for producing biopharmaceutical proteins. Agrobacterium-mediated DNA infection of plants offers a simple method for transient protein expression, simultaneous testing of protein biochemical activity, and a cost-effective, safe, and scalable approach. Plant-based expression systems have gained widespread adoption and have significantly improved the production of therapeutic drugs and monoclonal antibodies. These strategies include the use of viral expression systems, Agrobacterium strains, subcellular targeting, promoters, expression hosts, 5' untranslated regions (UTRs), and terminators. However, the economic viability of plant-based expression systems is largely dependent on crop yield. Therefore, the development of methods to enhance transgenic expression is crucial to ensure the successful use of plants as a platform for the recombinant production of ligase-type enzymes with higher yields. Summary of the Invention

[0005] The present invention aims to address some of the shortcomings of the prior art by providing an expression cassette, expression vector, and expression method for efficiently expressing a target gene or protein. The expression cassette and expression vector containing the cassette provided by the present invention can effectively enhance the expression level of the target gene or protein. Furthermore, the present invention introduces a novel method for effectively expressing a recombinant ligase, resulting in a ligase with higher enzyme yield and activity similar to that of the native enzyme. The present invention overcomes previous limitations and provides a reliable method for producing highly active polypeptide ligases in Nicotiana benthamiana for use in various biotechnology applications.

[0006] In order to achieve the above technical objectives, the present invention provides the following technical solutions:

[0007] The present invention first provides an expression cassette capable of efficiently expressing a target gene or target protein. The expression cassette comprises a promoter, a 5'UTR, a 3'UTR fragment and multiple terminators connected in sequence. The multiple terminators are a cauliflower mosaic virus 35ST terminator and a Nicotiana benthamiana actin terminator Niben96 connected in sequence. A linker fragment is provided between the 5'UTR and the 3'UTR, and the linker fragment contains a restriction enzyme cutting site.

[0008] Furthermore, the restriction enzyme cutting sites include AgeI, KpnI, XbaI and XhoI, and the linker fragment sequence is shown in SEQ ID No: 2.

[0009] Furthermore, a strong Kozak sequence is contained between the 5'UTR and the Linker fragment, and the strong Kozak sequence is UUAAA.

[0010] Preferably, the nucleotide sequence of the 5'UTR to 3'UTR is shown in SEQ ID No: 1.

[0011] The nucleotide sequence of the cauliflower mosaic virus 35S terminator is shown in SEQ ID No: 17, and the nucleotide sequence of the Nicotiana benthamiana actin terminator Niben96 is shown in SEQ ID No: 18.

[0012] The nucleotide sequence of the expression cassette (without the target gene or target protein coding sequence) is shown in SEQ ID No: 3.

[0013] Furthermore, the coding sequence of the target gene or target protein is inserted into any of the restriction enzyme sites. Preferably, the coding sequence of the target gene or target protein is inserted into the AgeI / XhoI site.

[0014] According to an embodiment of the present invention, preferably, the target gene or target protein includes a polypeptide ligase and an EGFP fluorescent protein; the coding sequence of the polypeptide ligase is shown in SEQ ID No: 20, and the coding sequence of the EGFP fluorescent protein is shown in SEQ ID No: 4.

[0015] Furthermore, the nucleotide sequence of the expression cassette is shown in SEQ ID No: 27 or 28, and the expression cassette is an expression cassette for efficiently expressing EGFP fluorescent protein or polypeptide ligase.

[0016] The present invention also provides an expression vector for efficiently expressing a target gene or target protein, wherein the expression vector comprises a vector skeleton and the expression cassette.

[0017] The expression vector includes an expression vector for efficiently expressing polypeptide ligase.

[0018] The present invention also provides a recombinant engineered bacterium for efficiently expressing a target gene or target protein, wherein the recombinant engineered bacterium comprises the expression vector.

[0019] The present invention also provides the use of the expression cassette, the expression vector, or the recombinant engineered bacteria in efficiently expressing a target gene or target protein. The target gene or target protein includes a polypeptide ligase and an EGFP fluorescent protein.

[0020] The present invention also provides a method for efficiently expressing a polypeptide ligase, characterized in that it comprises the following steps:

[0021] Step S1, constructing an expression vector containing the expression cassette;

[0022] Step S2, transferring the expression vector into Agrobacterium, and culturing to obtain Agrobacterium infection fluid;

[0023] Step S3: infecting plant tissues or plant cells with the Agrobacterium infection solution, and extracting the polypeptide ligase from the plant tissues.

[0024] The Agrobacterium is LBA4404, GV3101 and EHA105, preferably, the Agrobacterium is LBA4404. The plant is tobacco, preferably, Nicotiana benthamiana; and the plant tissue is plant leaves.

[0025] The present invention also provides a target protein expressed by the method, wherein the target protein comprises a polypeptide ligase.

[0026] The present invention also provides the use of the polypeptide ligase in the cyclization and / or connection of linear peptide substrates and proteins, and the connection of antibodies.

[0027] The antibody includes the Herceptin antibody, the peptide includes the fluorescent peptide GIGGIRK, and the linear peptide substrate includes the substrate kB1-NHV (GLPVCGETCVGGTCNTPGCTCSWPVCTRNHVIA), the N-terminal substrate KALVINHV and the C-terminal substrate GIGGIRK; the N-terminal substrate is labeled with the fluorescent group EDANS, and the C-terminal substrate is labeled with the quencher DABSYL, which are hereinafter referred to as the N-terminal substrate KAL(EDANS)VINHV and the C-terminal substrate GIGG(DABSYL)IRK.

[0028] Compared with the prior art, the technical advantages of the present invention are:

[0029] (1) The present invention first designs an expression cassette and expression vector with double terminators and multiple cloning sites, wherein the expression vector comprises a 5'UTR sequence, a 3'UTR sequence, a 35ST terminator, and a Niben96 terminator; the UTR sequence in the expression vector acts as a translation enhancer, and combined with the design of the double terminator, effectively improves the expression level of the protein.

[0030] (2) The method for efficiently expressing a target gene or target protein provided by the present invention further achieves efficient expression of polypeptide ligase in Nicotiana benthamiana, successfully utilizes a plant expression system to produce polypeptide ligase in Nicotiana benthamiana, and significantly improves the production efficiency of recombinant proteins. The polypeptide ligase produced by the method of the present invention exceeds 438 mg / kg fresh weight, providing a valuable platform for the scalable and economical and efficient production of polypeptide ligase. The method of the present invention solves the technical problems of defects in existing recombinant expression methods, especially the defects that lead to low yield and poor activity of ligase, and overcomes the technical problem that the expression system is difficult to produce functional proteins with high activity and purity due to the generation and misfolding of inclusion bodies. The method of the present invention produces an enzyme with higher yield, and the produced enzyme has an enzyme activity similar to that of the natural enzyme. The method of the present invention provides a reliable method for producing highly active polypeptide ligase in Nicotiana benthamiana, which can be used in various biotechnology applications.

[0031] (3) Peptide ligase is an enzyme with promising applications in various biotechnology fields. The transformants generated after introduction of the pMEAHex-PPL expression vector can serve as an important experimental resource for studying the functional properties and mechanisms of action of the enzyme. This approach not only provides a solid foundation for future studies on the functional characterization of peptide ligases but also opens up new possibilities for the large-scale production of therapeutic proteins and industrial enzymes in plants, contributing to the advancement of agricultural biotechnology and sustainable protein production strategies. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Schematic diagram of the structure of the UTR fragment in the present invention (a) and its GC content (b), and a schematic diagram of the structure of the vector pUC-UTR (c).

[0033] Figure 2 Schematic diagram of the structural region of the UTR fragment sequence (SEQ ID No: 1) constructed in the present invention (left figure) and a schematic diagram of the structural structure of the expression cassette (without the target gene or target protein coding sequence) constructed in the present invention (right figure).

[0034] Figure 3 Schematic diagram of the structure of the constructed recombinant expression vector pUCSP-UTR-EGFP (a) and the position of the EGFP encoding gene fragment inserted into the UTR (b).

[0035] Figure 4 This is a schematic diagram of the structures of the 35ST terminator, Niben96 terminator, and NOS terminator elements involved in the construction of the recombinant expression vector pMEAHex-EGFP in Example 1 (a), as well as a schematic diagram of the percentage frequency of polyadenylation sequences (b). The figure describes the number of polyadenylation sites and AU-rich (U-rich region) motifs in each terminator sequence, with larger numbers being better.

[0036] Figure 5 Schematic diagram of the structure of the vector pEAQ-HT in Example 1 and the schematic diagram of the structure of the linearized vector pEAQ-HT.

[0037] Figure 6 Schematic diagram of the structure of the recombinant expression vector pMEAHex-EGFP (a), schematic diagram of the expression cassette structure of the linearized recombinant expression vectors pMEAex-EGFP and pMEAHex-EGFP (c), and gel image verification results of the recombinant expression vectors pMEAHex-EGFP and pMEAex-EGFP constructed by the present invention (b).

[0038] Figure 7These are pictures taken under UV light of Nicotiana benthamiana leaves 3, 5, and 10 days after the original strain LBA4404 (NT) without the vector, the Agrobacterium infection solution containing the vector pMEAHex-EGFP, and the Agrobacterium infection solution containing the vector pMEAex-EGFP in Example 2 were respectively infected. "NT" indicates the result of the infection of Nicotiana benthamiana leaves by the Agrobacterium tumefaciens strain LBA4404 without the vector.

[0039] Figure 8 Figure 2 shows the fluorescence spectrophotometric analysis results of EGFP expressed in Nicotiana benthamiana leaves infected with the Agrobacterium infection solution containing the vectors pMEAHex-EGFP and pMEAex-EGFP in Example 2 (a) and the relative fluorescence intensity (right panel in Figure a), the Coomassie-stained 12% SDS-PAGE results (b), and the corresponding quantitative analysis results of EGFP expression levels (right panel in Figure b). In the figure, "NT" indicates the result of infection of Nicotiana benthamiana leaves with the Agrobacterium tumefaciens strain LBA4404 without the vector.

[0040] Figure 9 Figure 2 is a schematic diagram of the structure-function relationship of polypeptide ligase; Figure 9 a is the key region in the domain of polypeptide ligase, including the core domain (Core-domain), linker domain (Linker) and cap domain (Cap-domain), as well as the catalytic triad residues (N59, H165 and C207) that may be involved in its enzymatic activity; Figure 9 b HydropathyIndex reveals the distribution of hydrophobic and hydrophilic regions along the amino acid sequence; Figure 9 c is the combined substrate binding sequence logo and substrate binding model to illustrate the conserved motifs and positions that are critical for efficient ligation; Figure 9 d is a schematic diagram of the ligation reaction.

[0041] Figure 10 This is a schematic diagram of the position of NbmiRNA99 targeting the polypeptide ligase gene in Example 3 (i.e., the NbmiRNA99 target site in the peptide ligase Butelase-1). In the figure, Not-optimized is the unoptimized sequence encoding the polypeptide ligase Butelase-1, and Optimized is the optimized sequence encoding the polypeptide ligase Butelase-1.

[0042] Figure 11 Schematic diagram of the pMEAHex-PPL plasmid map and the linearized expression cassette map.

[0043] Figure 12 The results of RT-PCR analysis of the polypeptide ligase expressed after the Agrobacterium infection solution containing pMEAHex-PPL in Example 3 infected Nicotiana benthamiana were shown. Figure 12 a is an agarose gel image of peptide ligase in plants 5 days after infection (dpi), Figure 12 b shows the relative expression levels of polypeptide ligase (PPL) enzyme expressed on days 3, 5, and 10 of infection (b). In the figure, "NT" indicates the result of infection of Nicotiana benthamiana leaves by Agrobacterium tumefaciens strain LBA4404 without the vector.

[0044] Figure 13 The molecular weight (left) and domain structure diagram (right) of the polypeptide ligase Butelase-1.

[0045] Figure 14 The results of Coomassie-stained 12% SDS-PAGE analysis (upper left) and Western detection (upper right) of the protein Butelase-1 extracted from leaves of Nicotiana benthamiana infected with Agrobacterium containing pMEAHex-PPL are shown. The figure below shows the results of the internal control actin.

[0046] Figure 15 Relative (left) and absolute (right) quantitative analysis results of the protein Butelase-1 extracted from leaves; "NT" in the figure indicates the result of the infection of Nicotiana benthamiana leaves by the Agrobacterium tumefaciens strain LBA4404 without the vector.

[0047] Figure 16 The results of Coomassie-stained SDS-PAGE analysis (left panel in Figure a) and Western Blot analysis (right panel in Figure a) after purification of Butelase-1 expressed in Nicotiana benthamiana, as well as the concentration of recombinant polypeptide ligase Butelase-1 in the elution fraction determined by BCA protein assay (b); in the figure, FT is the flow-through, Wash 2 is the wash fraction, and Elute is the elution fraction.

[0048] Figure 17 Schematic diagram of the recombinant polypeptide ligase Butelase-1 produced by Nicotiana benthamiana during the cyclization / ligation process of linear peptide or protein substrates; in the figure, Figure a is a schematic diagram of the process of forming a ring structure from a linear peptide or protein substrate, and Figure b is a schematic diagram of the connection between two peptides, two proteins, or a protein and a non-protein compound; in the figure, S1-S3 represent the active site binding region of PPL, and P1-P3 and P1'-P3' are the binding regions of the substrate.

[0049] Figure 18Figure 2 is the cyclization analysis result of the recombinant peptide ligase Butelase-1; Figure a is a schematic diagram of the kB1-NHV cyclization mediated by the peptide ligase Butelase-1; Figure b shows the chromatogram of the uncyclized kB1-NHV, in which the peak corresponds to the uncyclized peptide; Figure c shows the chromatogram of the cyclized kB1-NHV, in which the shift indicates the successful peptide cyclization.

[0050] Figure 19 This is the MALDI-TOF / MS peak of the kB1-NHV cyclization product.

[0051] Figure 20 These are the results of the analysis of the kinetic characteristics of the polypeptide ligase during the ligation process in Example 6; wherein, Figure a is a schematic diagram of the interaction between two substrates (Substrate-1 and Substrate-2), in which a peptide bond is formed to generate a ligation product by the recombinant polypeptide ligase; and Figure b is the result of analyzing the ligase activity using the Forster resonance energy transfer assay (FRET).

[0052] Figure 21 Vmax and Km values ​​were derived using Michaelis-Menten kinetics of the enzyme reaction and a plot of the initial reaction rate (Vo) versus substrate concentration ([S]); the inset shows a Lineweaver-Burk plot containing the linear relationship used to calculate the kinetic parameters.

[0053] Figure 22 Schematic diagram of the Herceptin antibody structure (a) and SDS-PAGE analysis results of the Herceptin antibody under non-reducing conditions (without reducing agent, Non-Reducing) and reducing conditions (with reducing agent, Reducing) (b).

[0054] Figure 23 It is the result of peptide ligase catalyzing the connection between FITC and Herceptin antibody under non-reducing conditions; wherein, Figure 23 a is a schematic diagram of the ligation reaction promoted by polypeptide ligase; Figure 23 b is the SDS-PAGE analysis results and fluorescence signal results of Herceptin and FITC peptide bands and ligation products under non-reducing conditions; the left figure is the SDS-PAGE analysis results and fluorescence signal results, and the right figure is the fluorescence intensity diagram of the ligation reaction at 30, 60 and 120 minutes.

[0055] Figure 24 Figure 3 is the SDS-PAGE analysis results and fluorescence signal results of Herceptin and FITC peptide bands under reducing conditions. DETAILED DESCRIPTION

[0056] In order to enable those skilled in the art to better understand the technical solutions of the present invention, preferred embodiments of the present invention are described in detail below. However, the following embodiments do not limit the scope of protection of the present invention.

[0057] In the embodiments of the present invention, those that are not described in detail are all completed using conventional experimental methods. Those processes involved in the embodiments that are not described in detail are all understandable and easily implemented by those skilled in the art based on the product instructions or basic knowledge in the field, and therefore are not described in detail.

[0058] The pEAQ-HT expression vectors involved in the examples are commercially available.

[0059] Example 1: Construction of a plant expression vector with a modified enhancer and double terminator

[0060] In this example, a plant expression vector for high expression of foreign proteins was constructed by utilizing the replication cassette present in the pEAQ-HT expression vector (Sainsbury, F., Thuenemann, EC, & Lomonossoff, GP (2009). pEAQ: versatile expression vectors for easy and quick transient expression of heterologous proteins in plants. Plant biotechnology journal, 7(7), 682-693.). The pEAQ-HT vector carries oriV and colE1 replication origins, as well as the P19 protein (the P19 protein is derived from the tomato bushy stunt virus and can inhibit the RNA silencing effect of the host on foreign genes, improve the stability of heterologous gene transcripts, and thus promote the expression of heterologous proteins. It is widely used in transient expression systems in transgenic plants and tobacco leaves, Arabidopsis leaves, tomato leaves, or protoplasts).

[0061] The pEAQ-HT expression vector includes the CaMV 35S promoter for strong constitutive expression, the CPMV RNA2 5' and 3' UTRs for translational regulation, the NOS terminator, and the neomycin phosphotransferase (NPTII) gene for antibiotic selection.

[0062] In order to express the activity of the tobacco mosaic virus enhancer fragment with double terminators, the modified 5'UTR enhancer fragment of tobacco mosaic virus and the 3'UTR of the expression cassette were introduced into the pEAQ-HT expression vector, and double terminators were introduced. The constructed vector included the terminator cauliflower mosaic virus 35ST and the Nicotiana benthamiana actin terminator Niben96.

[0063] S1. Construction of expression cassette and synthesis of fragments

[0064] The expression cassette constructed in the present invention, which can efficiently express a target gene or target protein, includes a promoter, a 5'UTR, a 3'UTR, and multiple terminators connected in sequence, wherein the multiple terminators are a cauliflower mosaic virus 35ST terminator and a Nicotiana benthamiana actin terminator Niben96 connected in sequence; a linker segment is provided between the 5'UTR and the 3'UTR, wherein the linker segment contains multiple restriction enzyme sites connected in sequence, wherein the restriction enzyme sites include AgeI, KpnI, XbaI, and XhoI; further preferably, a strong Kozak sequence is provided between the 5'UTR and the linker segment, wherein the Kozak sequence is UUAAA; the coding sequence of the target gene or target protein is inserted into the restriction enzyme sites. In an embodiment of the present invention, the coding sequence of the target gene or target protein can be inserted between the AgeI / XhoI sites. In the present invention, the target gene or target protein includes a polypeptide ligase and an EGFP fluorescent protein, and these two proteins are used as examples for further description.

[0065] Specifically, in the present invention, the 5'UTR to 3'UTR fragment in the pEAQ-HT expression vector was first modified and optimized to obtain a fragment as shown in SEQ ID No: 1, which is denoted as UTR. The schematic diagram of the UTR fragment structure is shown in Figure 1 As shown, it was synthesized by Sangon Biotech (Shanghai) Co.; this fragment has high expression characteristics and is used as a translation enhancer in transient expression systems. It has a low GC base content and contains a linker fragment between the 5'UTR and the 3'UTR. The linker fragment contains restriction enzyme cloning sites connected in sequence: AgeI (ACCGGT), KpnI (GGTACC), XbaI (TCTAGA) and XhoI (CTCGAG); further preferably, there is a strong Kozak sequence (UUAAA) between the 5'UTR and the linker fragment, wherein the strong Kozak sequence is shown as TTAAA in the sequence listing.

[0066] The linker fragment sequence is shown in SEQ ID No: 2.

[0067] The coding sequence of the target gene to be expressed or the protein or enzyme to be expressed can be inserted between the AgeI / XhoI sites of the Linker segment between the 5'UTR and the 3'UTR in the UTR segment.

[0068] The expression cassette (not including target gene or target protein coding sequence) constructed by the present invention is shown in FIG. Figure 2As shown, the sequence of the expression cassette (promoter to Niben96 terminator, but not including the target gene or target protein coding sequence) is shown in SEQ ID No: 3.

[0069] The UTR fragment sequence SEQ ID No: 1 is shown below:

[0070] gaagattacaaacgtgagagacgggacaattaccaacaacaacaaacaacagacaacattacaattactatttacaattacttaaaatcaaccggttaagcaggtac cgaaagcgggcagtgagcgcaacgcaattaattctagatgcttactcgaggaacgcatagtgtttttccctccactttcgatcctttaactctggtttcattaaatt ttctttagtttgaatttactgttattcggtgtgcatttctatgtttggtgagcggttttctgtgctcagagtgtgtttattttatgtaatttaatttctttgtgagc tcctgtttagcaggtcgtcccttcagcaaggacacaaaaagattttaattttattaaaaaaaaaaaaaaaaagaccgggaattcgatatcaagctttatcgacctgca

[0071] The linker fragment sequence is shown in SEQ ID No: 2:

[0072] accggttaagcaggtaccgaaagcgggcagtgagcgcaacgcaattaattctagatgcttactcgaggaacgcatagtgtttttccctcc actt

[0073] The expression cassette sequence SEQ ID No: 3 is shown below:

[0074]

[0075] S2. Construction of pUCSP-UTR-EGFP vector

[0076] The EGFP gene was cloned by PCR based on the restriction sites present in the UTR fragment (SEQ ID NO. 1).

[0077] Using the enhanced green fluorescent protein (EGFP) gene fragment (sequence shown in SEQ ID No: 4) as a template, the EGFP gene fragment was amplified using the primer pair pK7-EGFP-F / R (shown in SEQ ID No: 5-6) and the high-fidelity enzyme 2×Phanta MAX Master Mix (purchased from Nanjing Vazyme Biotech Co., Ltd.). The PCR reaction system is shown in Table 1.

[0078] Table 1. PCR amplification reaction system using high-fidelity enzymes

[0079] PCR system Dosage (μL) <![CDATA[ddH2O]]> Up to 20μL 2×Phanta Max Master Mix 25 μL Upstream primer (10 μM) 2μL Downstream primer (10μM) 2μL Template (50-200ng) 1 μL

[0080] Green fluorescent protein (EGFP) nucleotide sequence (SEQ ID No: 4):

[0081] atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa

[0082] Primer pK7-EGFP-F (SEQ ID No:5): tcaaccggttaagcaggtaccatggtgagcaagggcgagga

[0083] Primer pK7-EGFP-R (SEQ ID No:6): gacctcgagtaagcatctagattacttgtacagctcgtccat

[0084] The PCR procedure was as follows: pre-denaturation at 95°C for 3 minutes; 35 cycles of denaturation at 95°C for 15 seconds, annealing at 55°C for 15 seconds, and extension at 72°C for 15 seconds; and a final extension at 72°C for 5 minutes to obtain the PCR product. The PCR product was then electrophoresed on a 1% agarose gel at 120 V for 30 minutes and imaged using an ultraviolet (UV) gel imager. The results showed that the target fragment, the EGFP gene fragment, was successfully amplified, with a size of approximately 720 bp.

[0085] The PCR amplification product was recovered from the agarose gel by referring to the operating instructions of the UNIQ-10 column gel DNA recovery kit (purchased from Sangon Biotech (Shanghai) Co., Ltd.).

[0086] The vector pUC-UTR (when the UTR sequence is synthesized by Bio-Tech, it is connected to the pUC vector, which is the pUC-UTR vector, and the connection method is conventional) was then digested with restriction endonucleases AgeI and XhoI (purchased from New England Biolabs Co., Ltd.) to obtain the linearized vector pUC-UTR. The restriction endonuclease double digestion reaction system is shown in Table 2.

[0087] Table 2. Restriction enzyme double digestion reaction system

[0088] system Dosage (μL) <![CDATA[ddH2O]]> Up to 50μL 10×rCutSmart Buffer 25 μL AgeI-HF(20units) 1 μL XhoI(20units) 1 μL template 1 μg

[0089] After the enzyme digestion reaction system was incubated at 37°C for 3 hours, the resulting product was electrophoresed in a 1% agarose gel at 120V for 30 minutes, then imaged using an ultraviolet (UV) gel imager, and the results were recorded; the results showed that the fragment size obtained after double enzyme digestion of pUC-UTR was 2729bp.

[0090] The EGFP gene fragment and the double-enzyme-digested pUC-UTR fragment were recovered from the agarose gel, and the linearized vector pUC-UTR and the EGFP gene fragment were connected to obtain the recombinant expression vector pUCSP-UTR-EGFP, the structure of which is shown in the figure. Figure 3 The ligation system included 4.5 μL of gel-recovered product (including the linearized vector pUC-UTR and the EGFP gene fragment) and 5 μL of solution I containing T4 DNA ligase (purchased from Takara Biotechnology (Dalian) Co., Ltd.), and ligated overnight at 16°C to obtain a ligation product.

[0091] 10 μL of the ligation product was added to 30 μL of Escherichia coli (E. coli) competent cells (purchased from Nanjing Vazyme Biotech Co., Ltd.), and then transformed into E. coli by heat shock. Positive colonies were then screened using LB medium containing Amp (purchased from Takara Biotechnology (Dalian) Co., Ltd.) with a final Amp concentration of 30 mg / mL. Ten single colonies were picked and cultured with shaking for 12 to 16 hours. 2 μL of the bacterial solution was collected and used as a template for PCR amplification and identification. The primers for PCR amplification and identification are as follows:

[0092] pUCSPM13-F(SEQ ID No:7):cccgtcagggcgcgtcagcgg

[0093] pUCSPM13-R (SEQ ID No:8):cacacaggaaacagctatgac.

[0094] The PCR amplification reaction system is shown in Table 3; the PCR program is as follows: pre-denaturation at 94°C for 3 minutes; denaturation at 94°C for 15 seconds, annealing at 53°C for 30 seconds, and extension at 72°C for 30 seconds, for a total of 30 cycles; and final extension at 72°C for 5 minutes.

[0095] Table 3. Colony PCR reaction system

[0096] PCR system Dosage (μL) <![CDATA[ddH2O]]> Up to 20μL rTaq-master mix 10 μL Upstream primer (10 μM) 1 μL Downstream primer (10μM) 1 μL template 2μL

[0097] PCR amplification products were tested on a 1% agarose gel, confirming successful transformation of the recombinant vector. Ten replicates of the successfully transformed bacterial culture were selected, and 200 μL of each replicate was aspirated and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Sequencing analysis revealed that pUCSP-UTR-EGFP contained the nucleotide sequences shown in SEQ ID Nos. 1 and 4, indicating successful construction of the recombinant expression vector.

[0098] Construction of S3.pMEAHex-EGFP

[0099] Using the pUCSP-UTR-EGFP vector obtained in step S2 as a template, primers pUCSP-UTR-F (nucleotide sequence shown in SEQ ID No: 9) and primers pUCSP-UTR-R (nucleotide sequence shown in SEQ ID No: 10) were used to perform PCR amplification on the UTR and EGFP gene fragments in the vector to obtain a PCR product. The obtained product contained the UTR and EGFP gene fragments.

[0100] The pEAQ-HT vector was then linearized by PCR using primers pEAQ-Vector1-F (nucleotide sequence shown in SEQ ID No: 11) and primer pEAQ-Vector1-R (nucleotide sequence shown in SEQ ID No: 12), and the amplified product containing the UTR and EGFP gene fragment was ligated with the linearized pEAQ-HT vector to obtain the recombinant expression vector pMEAex-EGFP.

[0101] In order to verify the activity of 35ST terminator and Niben96 terminator, the cauliflower mosaic virus 35ST terminator and Nicotiana benthamiana actin terminator Niben96 ( Figure 4 The Niben96 terminator has multiple polyadenylation sites distributed along its length, as well as a U-rich region, which facilitates efficient termination and improves mRNA stability. The Niben96 terminator sequence SEQ ID No. 18, spanning 1 to 893 nucleotides, was amplified by PCR from Nicotiana benthamiana genomic DNA (a publicly available material maintained in our laboratory). The sequence was then fused to the synthetic 35ST terminator sequence SEQ ID No. 17 using overlap extension PCR, and the overlap extension PCR reaction was performed using KOD plusMix (purchased from Takara Biotechnology (Dalian) Co., Ltd.).

[0102] The Niben96 terminator sequence SEQ ID No: 18 and the 35ST terminator sequence SEQ ID No: 17 were fused by overlap extension PCR. The PCR program was as follows: initial denaturation at 94°C for 3 minutes; 15 cycles of denaturation at 94°C for 30 seconds, annealing at 63°C for 30 seconds, and extension at 68°C for 30 seconds; and a final extension at 68°C for 5 minutes. Subsequently, primers pEA-35S-F (base sequence shown in SEQ ID No: 13) and primer NOS-Niben96-R (base sequence shown in SEQ ID No: 14) were added to the reaction system for a second round of PCR. The PCR program was as follows: initial denaturation at 94°C for 3 minutes; 30 cycles of denaturation at 94°C for 30 seconds, annealing at 56°C for 30 seconds, and extension at 68°C for 1 minute and 30 seconds; and a final extension at 68°C for 5 minutes.

[0103] The PCR product obtained from the second round of PCR was run on a 1% agarose gel at 120 V for 30 minutes, then imaged using an ultraviolet (UV) gel imager and the results recorded. The results showed that the amplified product, i.e., the overlapping extension fragment, contained a 35ST terminator and a Niben96 terminator fragment, and was approximately 1104 bp in size. Its sequence is shown in SEQ ID No: 19.

[0104] Table 4. Overlap extension PCR reaction

[0105] PCR system Dosage (μL) <![CDATA[ddH2O]]> Up to 25μL KOD plus Mix 5μL dNTPs 5μL <![CDATA[MgS04]]> 3μL 35St fragment 25ng Niben96fragment 25ng

[0106] Then, the vector pMEAex-EGFP was linearized using primers pEAQ-Vector2-F (base sequence shown in SEQ ID No: 15) and primers pEAQ-Vector2-R (base sequence shown in SEQ ID No: 16) (to amplify the vector backbone sequence that does not contain the Agrobacterium nopaline synthase NOS terminator) to obtain the linearized vector pMEAex-EGFP. The resulting overlapping extension fragment was then cloned (ligated) into the linearized vector pMEAex-EGFP to obtain a recombinant expression vector named pMEAHex-EGFP. The schematic diagram of the structure of the vector pEAQ-HT is shown in FIG. Figure 5 The schematic diagram of the constructed recombinant expression vectors pMEAHex-EGFP and pMEAex-EGFP is shown in Figure 6 As shown in the figure, the gel image verification results of the constructed recombinant expression vectors pMEAHex-EGFP and pMEAex-EGFP are shown in the figure. Figure 6 As shown in the figure, it can be seen and verified that the recombinant expression vector pMEAHex-EGFP was successfully constructed. The obtained vector contains the same basic elements as the vector pEAQ-HT, and also contains an enhanced green fluorescent protein (EGFP) coding sequence, and an additional Niben96 terminator gene sequence at the 3' end; the recombinant expression vector pMEAHex-EGFP also contains a CaMV35S promoter, UTR sequence (modified 5' and 3'UTR) and a 35ST terminator for expression regulation. A Kozak sequence was added to the vector to achieve efficient translation initiation. The vector contains a multiple cloning site, which includes AgeI and XhoI restriction enzyme cutting sites for cloning and insertion.

[0107] The recombinant expression vector pMEAHex-EGFP constructed in this example comprises a double terminator 35ST terminator and a Niben96 terminator, and the recombinant expression vector pMEAex-EGFP comprises the Agrobacterium nopaline synthase NOS terminator.

[0108] The sequence of the expression cassette from the promoter to the Niben96 terminator contained in the recombinant expression vector pMEAHex-EGFP constructed in this example is shown in SEQ ID No: 27.

[0109] Primer pUCSP-UTR-F (SEQ ID No: 9): ctctcttgtctttcttgcgtgagcgagaagattacaaacgtgagagacggagg Primer pUCSP-UTR-R (SEQ ID No: 10): gaaaatttaatgaaaccagagaagtggagggaaaaacactatgcg

[0110] Primer pEAQ-Vector1-F (SEQ ID No: 11): tcgctcacgcaagaaagacaag

[0111] Primer pEAQ-Vector1-R (such as SEQ ID No: 12): ctctggtttcattaaattttct

[0112] Primer pEA-35S-F (SEQ ID No: 13): atcaagcttatcgacctgcagtccgcaaaaatcaccagtctct

[0113] Primer NOS-Niben96-R (SEQ ID No: 14): tgccaaatgtttgaacgatcgattggttttgatttaggtttc

[0114] Primer pEAQ-Vector2-F (SEQ ID No: 15): gatcgttcaaacatttggcaataaagtttcttaaga

[0115] Primer pEAQ-Vector2-R (SEQ ID No: 16): tgcaggtcgataagcttgatatcgaa

[0116] 35ST terminator sequence (SEQ ID No: 17):

[0117] gtccgcaaaaatcaccagtctctctctacaaatctatctctctctatttttctccagaataatgtgtgagtagttcccagataagggaattagggttcttatagg gtttcgctcatgtgttgagcatataagaaacccttagtatgtatttgtatttgtaaaatacttctatcaataaaatttctaattcctaaaaccaaaatccagtgac

[0118] Niben96 terminator sequence (SEQ ID No: 18):

[0119] cttctaaatacagcattcccagaaagagaaacagaagaaatatacaaactttcattttgagagcagcacctcgtctattgattgcagataatatgcttctcatttgtatttccttttgattatttttgtttctatccctttgtttgagtcaatctcaaatattcggtcattgttggtatgaaaaatcaagcagttcatgttaagagtcaatttaaaattaatatttttatatagagttgtatgtgaaatgatgttgtgatttggtatatatggataaagagcttgtcagttcattttggtctcatttttttggtatccaaataagaaacacaaaagggatatgtccctctactatcaaatattagttataagtattcatgttatactattcgatattttctaccccaatcgttacctatttaaaagtatttacccctccatctatcaaacccctggacccagctttcctattacatgtggcttcatcttaagcccccaaacctttttcttatttttgatttttaaaggctcatcttaaaatttattactcaaattaatacctcttaataacccacctcaaggacccagtaattaaatatccaattagctccagtaattggggttcatattagctccagtcttaaattttaaaggcgatgatcgtattcctccacttggttcatttatactcaaagaatactcaatgtctttagtgtttagataactttttgtaaatcatatagattgttttaacaaaaaacaattcaatagtagattttcacatgaaagttacataaaaattctttaaaattactttctcaaaaaattgttccaaacatattatcccacaattaaactcaatctgtttttcgaaacctaaatcaaaaccaatc

[0120] The fragment sequence containing the 35ST terminator and the Niben96 terminator (SEQ ID No: 19):

[0121]

[0122] Expression cassette sequence for high-efficiency expression of EGFP (SEQ ID No: 27):

[0123]

[0124] Example 2: Plant expression vectors with modified enhancer 5'UTR sequences and double terminator sequences can increase the yield of recombinant proteins in Nicotiana benthamiana

[0125] The recombinant expression vector pMEAHex-EGFP obtained in Example 1 was transferred into Agrobacterium tumefaciens strain LBA4404 (purchased from Weidi Bio Co., Ltd.) by heat shock. Single colonies were then inoculated into LB medium containing 100 μg / mL kanamycin and 50 μg / mL rifamycin. Positive colonies were screened and cultured at 28°C. Colony PCR amplification was performed using primers pUCSPM13-F (SEQ ID No: 7) and pUCSPM13-R (SEQ ID No: 8), following the reaction system described in Table 3 of Example 1, to identify positive colonies that effectively expressed recombinant EGFP.

[0126] The positive colonies were then inoculated into 100 mL of LB liquid medium containing 100 μg / mL kanamycin and 50 μg / mL rifamycin and cultured at 28 °C and 230 rpm until the OD 600 Reach 0.8. The cultured cells were then centrifuged at 6,000 × g for 10 minutes, and the cell pellet was resuspended in an infection solution with a pH of 5.6 (containing 10mM MES, 10mM MgCl2, and 150μM acetosyringone). After incubation for 3-4 hours, a suspension mixture was obtained, i.e., Agrobacterium infection solution was obtained. The Agrobacterium infection solution was used to infect Nicotiana benthamiana leaves using a syringe to express EGFP. The infected leaves were harvested at three different time points after infection (3rd, 5th, and 10th days after infection) and photographed using ultraviolet light to detect the EGFP expression level. Soluble protein was then extracted from the leaf area expressing the EGFP protein. The specific operations included:

[0127] 1 g of leaves were placed in a mortar, liquid nitrogen was added, and lysis was performed using RIPA extraction buffer (purchased from Beyotime Biotechnology Co., Ltd.). Total protein content was measured using a BCA protein concentration kit (purchased from Beyotime Biotechnology Co., Ltd.) and subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE), with detection by Coomassie Brilliant Blue staining. In addition, fluorescence monitoring of the extracted soluble proteins was performed using a microplate reader with an excitation wavelength of 488 nm and an emission wavelength of 507 nm.

[0128] At the same time, pMEAex-EGFP without double terminators was used to transform Agrobacterium tumefaciens strain LBA4404 and prepare infection solution to infect Nicotiana benthamiana as a control.

[0129] Figure 7 The results show the comparison of expression phenotypes at three different time points after the leaves of Nicotiana benthamiana were infected with Agrobacterium carrying vectors pMEAHex-EGFP and pMEAex-EGFP, respectively. Figure 7 It can be seen that the vector pMEAHex-EGFP of the present invention is successfully constructed, EGFP can be expressed normally, and the effect of Agrobacterium infection fluid after 5 days of infection is better than that after 10 days of infection, and the Agrobacterium infection fluid carrying the vector pMEAHex-EGFP has a better infection effect than the Agrobacterium infection fluid carrying the vector pMEAex-EGFP.

[0130] Figure 8 a shows the fluorescence intensity analysis results of EGFP expressed in Nicotiana benthamiana leaves 5 days after infection with the original strain LBA4404 (NT) without vector, Agrobacterium infection solution containing vector pMEAHex-EGFP, and Agrobacterium infection solution containing vector pMEAex-EGFP (8a) and the SDS-PAGE detection results of the extracted EGFP protein (8b). NT represents the result of infection of Nicotiana benthamiana leaves with the original Agrobacterium tumefaciens strain LBA4404 without vector. Figure 8 a The right figure shows the relative fluorescence intensity. Figure 8 In b, the band near 27 kDa indicated by the arrow in the left figure is the band of EGFP protein. Figure 8 b The right figure shows the Figure 8 a and SDS-PAGE quantification results of EGFP protein expression levels.

[0131] The results showed that compared with the vector pMEAex-GFP, the vector pMEAHex-GFP containing the UTR fragment, the 35ST terminator, and the Niben96 terminator exhibited higher EGFP protein expression in infected Nicotiana benthamiana plants. This suggests that the vector constructed in the present invention, containing the UTR fragment, the 35ST terminator, and the Niben96 terminator, can increase the expression of the target protein.

[0132] Example 3: High-level production of ligase-type polypeptide ligase in Nicotiana benthamiana using a plant expression vector

[0133] Peptide ligase is a novel enzyme that exhibits high selectivity and efficiency in protein or peptide cyclization and ligation. The full-length codding sequence of peptide ligase consists of 1467 bp and a 60 bp signal peptide at the N-terminus. The disclosed peptide ligase consists of 462 amino acids with a predicted molecular weight of 55 kDa and is hydrophilic with a hydropathic index of -0.415 ( Figure 9b). Peptide ligase consists of a highly conserved N-terminal cystine-dependent domain (Core-domain) and a C-terminal pro-legumain-C domain (Cap-domain). The N-terminus of the core domain contains a core conserved domain ( Figure 9 a), namely LAD1 (S1) and LAD2 (S2) (ligase activity determinants), which affect the substrate access to the peptide ligase for cyclization ( Figure 9 c). In order to carry out the ligation reaction, the peptide ligase requires a tripeptide substrate motif Asx-His-Val (P1-P1'-P2') to bind to the S1 active site. The substrate requirement at the P1 position is not strict, but at the P2' position, the peptide ligation reaction requires a bulky residue ( Figure 9 d), the active site region S1-S4 interacts specifically with the substrate P1-P4, while S1'-S4' interacts with P1'-P2' to form an acyl enzyme intermediate ( Figure 9 d).

[0134] In order to utilize the high-yield mechanism of pMEAHex-EGFP, the EGFP in the pMEAHex-EGFP vector was removed using the double enzyme cutting sites AgeI / XhoI, and then the nucleotide sequence encoding the polypeptide ligase (base sequence shown in SEQ ID No: 20) was inserted into the AgeI / XhoI sites of the UTR expression cassette (shown in SEQ ID No: 1) to replace EGFP, thereby obtaining the recombinant expression vector pMEAHex-PPL. The sequence of the expression cassette from the promoter to the Niben96 terminator contained in the recombinant expression vector pMEAHex-PPL constructed in this example is shown in SEQ ID No: 28. Specifically:

[0135] GenScript Biopharmaceuticals was commissioned to synthesize a gene fragment encoding the polypeptide ligase Butelase-1 (denoted as PPL, with an amino acid sequence as shown in SEQ ID No: 21) (base sequence as shown in SEQ ID No: 20). This gene fragment encoding the polypeptide ligase was codon-optimized for Nicotiana benthamiana to increase protein expression and prevent the effects of Nicotiana benthamiana microbial RNA (NbmiRNA99) without changing the protein sequence. Figure 10 ),like Figure 10 As shown in FIG, the unoptimized sequence and the optimized sequence are compared, showing the binding ability of NbmiRNA99 to the target site of the polypeptide ligase; As can be seen from the sequences shown in SEQ ID No: 20 and 21, the 6×His tag is connected to the C-terminus of the enzyme gene fragment, and the endoplasmic retention signal KDEL (SEQ ID No: 22) is also connected to the C-terminus of the enzyme gene fragment ( Figure 11 ) are connected.

[0136] Then, the gene fragment of polypeptide ligase was amplified by PCR using primers But-1-F (SEQ ID No: 23) and But-1-KDEL-R (SEQ ID No: 24), and the gene fragment of polypeptide ligase was introduced into the pMEAHex-EGFP vector to obtain the recombinant vector pMEAHex-PPL ( Figure 11 ), as can be seen in the figure, the pMEAHex-PPL vector includes a CaMV 35S promoter, a gene encoding a polypeptide ligase, modified 5' and 3' UTRs, and a Niben96 terminator for expression regulation, and a Kozak sequence is added.

[0137] The recombinant vector pMEAHex-PPL was then transformed into Agrobacterium tumefaciens strain LBA4404 (purchased from Weidi bioCo., Ltd.). A single positive colony was picked and inoculated into LB liquid medium (containing 100 μg / mL kanamycin and 50 μg / mL rifamycin) and cultured at 28°C until OD 600 After reaching 0.8, the cultured cells were centrifuged at 6,000 × g for 10 minutes, and the cell pellet was resuspended in infection solution (containing 10 mM MES, 10 mM MgCl2, and 150 μM acetosyringone) at a pH of 5.6. After incubation at room temperature for 3-4 hours, the suspension mixture was obtained, i.e., the Agrobacterium infection solution. The Agrobacterium infection solution was injected using a syringe to infect Nicotiana benthamiana leaves, thereby expressing the highly active ligase Butelase-1. The infected leaves were harvested at three different time points after infection, 3, 5, and 10 days, and the expression level of the polypeptide ligase was quantified using qRT-PCR.

[0138] First, RNA was extracted from Nicotiana benthamiana leaves using TRIzol reagent. 0.5g tissue samples from three different time points were ground into a powder using liquid nitrogen. 0.1g of sample was weighed and added to 1mL of Trizol (purchased from Thermo Fisher Scientific Co., Ltd.), pre-chilled on ice, thoroughly mixed, and allowed to stand for 10 minutes. 400μL of chloroform was added to a 1.5mL EP tube, shaken, and allowed to stand on ice for 10 minutes before centrifugation at 12,000g for 10 minutes at 4°C. Approximately 600μL of the supernatant was placed in a new 1.5mL EP tube free of RNAse, 300μL of isopropanol was added, and the tube was gently shaken to precipitate the RNA. The tube was allowed to stand at -20°C for 5 minutes, followed by centrifugation at 12,000g for 10 minutes at 4°C. The supernatant was decanted, and 1mL of 75% ethanol prepared with DEPC water was added for thorough washing, followed by centrifugation at 7,500g for 10 minutes at 4°C. The supernatant was decanted, excess ethanol was removed by pipetting, and 50 μL of DEPC water was added to dissolve the precipitate. Finally, the integrity of the total RNA was checked using a 1% agarose gel, and the RNA concentration was determined using an OD1000-One-Drop instrument.

[0139] After pure RNA was extracted, the reaction was carried out using the EasyScript All in one First stand cDNA synthesis kit (purchased from Transgen biotech Co., Ltd.) using the system shown in Table 5.

[0140] Table 5. cDNA synthesis reaction system

[0141] PCR system Dosage (μL) Pure RNA 1 μg 5×EasyScript super mix 5μL gDNA remover 1 μL RNase-free water Up to 20μL

[0142] The reaction system was incubated at 42°C for 15 minutes and then at 85°C for 5 seconds to obtain cDNA.

[0143] With reference to the instructions of the PerfectStart Green qPCR SuperMix kit (purchased from Transgen biotech Co., Ltd), gene expression levels were monitored by running qPCR using primers qPCR-But-1-F (base sequence shown in SEQ ID No: 25) and primers qPCR-But-1-R (base sequence shown in SEQ ID No: 26).

[0144] The results showed that when the Agrobacterium infection solution containing pMEAHex-PPL was used to infect Nicotiana benthamiana, the expression of peptide ligase was significantly higher in the Agrobacterium infection solution containing pMEAHex-PPL than in the control group, which was statistically significant (P<0.01). Furthermore, it was found that the expression level of recombinant peptide ligase was higher on the 5th day after infection than on the 3rd and 10th days ( Figure 12 a and 12b), indicating that the polypeptide ligase reaches its peak transcriptional activity on the 5th day, suggesting that this time point may be the optimal period for the highest expression of the recombinant polypeptide ligase protein in Nicotiana benthamiana. The decreased expression observed at the 10th day may be attributed to post-transcriptional regulatory mechanisms or plant stress responses associated with prolonged gene expression ( Figure 12 b).

[0145] The nucleotide sequence encoding polypeptide ligase Butelase-1 (denoted as PPL) (shown in SEQ ID No: 20):

[0146]

[0147] Amino acid sequence of polypeptide ligase Butelase-1 (denoted as PPL) (SEQ ID No: 21):

[0148] MKNPLAILFLIATVVAVVSGIRDDFLRLPSQASKFFQADDNVEGTRWAVLVAGSKGYVNYRHQADVCHAYQILKKGGLKDENIILFMYDDIAYNESNPHPGVIINHPYGSDVYKGVPKDYVGEDINPPNFYAVLLANKSALTGTGSGKVLDSGPNDHLFIYYTDHGGAGVLGMPSKPYIAASDLNDLLKKKHASGTYKSIVFYVESCESGSMFDGLLPEDHNIYVMGASDTGESSWLTYCPLQHPSPPPEYDVCVGDLFSVAWLEDCDVHNLQTETFQQQYEVVKNKTIVALIEDGTHVVQYGDVGLSKQTLFVYMGTDPANDNNTFTDKNSLGTPRKAVSQRDADLIHYWEKYRRAPEGSSRKAEAKKQLREVMAHRMHIDNSVKHIGKLLFGIEKGHKMLNNVRPAGLPVVDDWDCFKTLIRTFETHCGSLSEYGMKHMRSFANLCNAGIRKEQMAEASAQACVSIPDNPWSSLHAGFSVHHHHHH KDEL

[0149] Retention signal KDEL (SEQ ID No: 22): aaggacgaactc

[0150] Primer But-1-F (SEQ ID No: 23): gtgaccggtatgaagaatccacttgcaatcc

[0151] Primer But-1-KDEL-R (SEQ ID No: 24): actctcgagtcagagttcgtccttatgatgatg

[0152] Primer qPCR-But-1-F (SEQ ID No: 25): gccttctaagccatacat

[0153] Primer qPCR-But-1-R (SEQ ID No: 26): gattcacaagactcaacataa

[0154] Expression cassette sequence for high-efficiency expression of polypeptide ligase (SEQ ID No: 28):

[0155]

[0156] Example 4: Identification and purification of recombinant highly active ligase polypeptide ligase

[0157] Butelase-1 was extracted from infected areas of Nicotiana benthamiana leaves expressing the peptide ligase protein: 1 g of Nicotiana benthamiana leaves infected for 5 days were ground into a fine powder using liquid nitrogen and homogenized with 250 μL of NBE buffer-1 (containing 20 mM sodium phosphate, 1 mM PMSF, 1 mM EDTA, and 5 mM DTT) at 4°C for 15 minutes to obtain a mixture. The mixture was centrifuged at 9,000 g for 10 minutes at 4°C to obtain a plant extract. The obtained plant extract was transferred to a clean test tube, and solid ammonium sulfate was added to the plant extract to reach 85% saturation. After incubation for 20 minutes, the mixture was centrifuged at 9,000 g for 30 minutes at 4°C. The precipitated protein was removed and resuspended in 200 μL of NBE buffer-1. The precipitated protein was then dialyzed overnight with 100 mL of NBE buffer-2 (containing 20 mM sodium phosphate, 1 mM EDTA, and 5 mM DTT) using 10 kDa molecular weight cutoff dialysis tubing (purchased from Beyotime Biotechnology Co., Ltd.). After overnight dialysis, the extract was centrifuged at 9,000 g for 10 minutes at 4°C, and the supernatant was collected; the supernatant was further purified using a His-tagged purification kit (purchased from Beyotime Biotechnology Co., Ltd.) according to the kit instructions to obtain soluble protein Butelase-1.

[0158] The total protein content was measured using a BCA protein concentration assay kit (purchased from Beyotime Biotechnology Co., Ltd.), and the resulting soluble protein was subjected to SDS-PAGE and transferred to a PVDF membrane. The polypeptide ligase protein was detected by Western blotting with a His antibody (purchased from Beyotime Biotechnology Co., Ltd.), and the positive samples were further purified by Nickel-NTA agarose gel affinity chromatography. The His tag is connected to the C-terminus of the polypeptide ligase protein. This method uses a His tag to promote the specific binding of the polypeptide ligase to the affinity gel, thereby achieving efficient purification. The purity of the protein was verified by Coomassie-stained SDS-PAGE and western blot analysis, in which anti-6×His antibody was used to detect the target protein. The concentration of recombinant polypeptide ligase in different graded elution groups was measured using a BCA protein concentration assay kit (purchased from Beyotime Biotechnology Co., Ltd.).

[0159] Figure 13This is a schematic diagram of the molecular weight and domain structure of the polypeptide ligase Butelase-1. Figure 14 The results of SDS-PAGE and Western blotting experiments on Butelase-1 protein extracted from leaves of Nicotiana benthamiana were obtained 5 days after the infection of Agrobacterium containing pMEAHex-PPL. Figure 14 In the figure, "NT" indicates the result of infection of Nicotiana benthamiana leaves by Agrobacterium tumefaciens strain LBA4404 without vector. In addition, the protein added in each lane represents 25 μL protein extract obtained from 1 g of infected tissue. The band indicated by the arrow represents the band of polypeptide ligase protein. Figure 15 Shows the Figure 14 Quantify the relative and absolute expression levels of peptide ligase proteins in Figure 15 In the table, “FW” stands for leaf fresh weight. Figure 16 Figure 1 shows the results of Coomassie-stained SDS-PAGE analysis (left panel in Figure a) and Western Blot analysis (right panel in Figure a) of purified Butelase-1 expressed in Nicotiana benthamiana, as well as the concentration of recombinant polypeptide ligase Butelase-1 in elution fractions determined by BCA protein assay (b). In the figure, FT represents the flow-through, Wash 2 represents the wash fraction, and Elute represents the elution fraction. In this example, Western blot analysis was performed using an anti-6×His antibody to identify His-tagged proteins; M represents the molecular weight marker (in kilodaltons). The figure shows that the concentration of polypeptide ligase decreases in the elution fractions (1, 2, and 3), with Elute-1 having the highest concentration.

[0160] The results of this example demonstrate that infection of Nicotiana benthamiana with Agrobacterium containing pMEAHex-PPL produces a peptide ligase protein identical in size to 55 kDa. The method of the present invention achieves efficient expression of the peptide ligase. Furthermore, the peptide ligase expressed in Nicotiana benthamiana exceeds 438 mg / kg fresh weight leaf tissue, demonstrating high expression levels. Furthermore, the peptide ligase expressed in Nicotiana benthamiana specifically binds to affinity media, enabling efficient purification.

[0161] Example 5: Analysis of cyclization activity of recombinant polypeptide ligase

[0162] When peptide ligases cyclize peptides or proteins, the C-terminus of the substrate contains an Asx-His-Val (NHV) or Asp-His-Val (DHV) sequence. The first amino acid at the N-terminus is any common amino acid other than proline, preferably Gly or Met. The second amino acid at the N-terminus must be Ile, which is the amino acid of other peptides or proteins. Linear peptides or proteins with aliphatic amino acid residues are preferred.

[0163] Cyclic peptides are formed by breaking the peptide bond between Asx-His(NH), separating the His-Val(HV) sequence at the C-terminus of the peptide or protein, and connecting the N-terminus and C-terminus via an amide bond. To connect peptides or proteins, at least one must have an Asx-His-Val(NHV) sequence at the C-terminus and the other must have an N-terminal first amino acid sequence containing any common amino acid except proline and an aliphatic amino acid residue as the second amino acid.

[0164] The ligation product is formed by breaking the peptide bond between Asx-His (NH), separating the His-Val (HV) sequence at the C-terminus of the peptide or protein, and connecting it to the N-terminus of another peptide or protein through an amide bond.

[0165] The preferred conditions for ligation and circularization are a temperature between 30-50°C and a pH between 4 and 6.5. The contents of the circularization buffer include: 20 mM sodium phosphate and 1 mM EDTA).

[0166] The following is an explanation with specific examples:

[0167] Peptide ligase cyclization activity assays were performed in 100 μL of activity / cyclization buffer (20 mM sodium phosphate and 1 mM EDTA, pH 5).

[0168] The recombinant polypeptide ligase Butelase-1 obtained in Example 4 was added to the reaction system to a final concentration of 10 μM, and 500 μM of the peptide substrate kB1-NHV (GLPVCGETCVGGTCNTPGCTCSWPVCTRNHVIA) was added to the reaction system to carry out a cyclization reaction, and the reaction was incubated at 37° C. for 1 hour. The reaction was quenched by adding 50 mM HCl. The reaction product was filtered through a 0.22 μm microporous membrane and analyzed using an RP-HPLC column (SHIMADZU shim-pack GIST C18 (4.6*250MM*5UM) for identification of circulating products, and the identification results of each peak were analyzed by MALDI-TOF MS.

[0169] Figure 17 A schematic diagram showing the cyclization process of the recombinant peptide ligase Butelase-1 produced by Nicotiana benthamiana and linear peptide or protein substrates; Figure 17 a is a schematic diagram of the process of forming a ring structure from a linear peptide or protein substrate. Figure 17 b is a schematic diagram of the connection between two peptides, two proteins, or a protein and a non-protein compound. In the figure, S1-S3 represent the active site binding region of PPL, P1-P3 and P1'-P3' are the substrate binding regions, and the active region and substrate binding region of PPL are also shown in Figure 9 c and 9d.

[0170] Figure 18 This is the RP-HPLC analysis result of the recombinant polypeptide ligase Butelase-1 produced by Nicotiana benthamiana. Figure 18 a is a schematic diagram of the cyclization of kB1-NHV mediated by peptide ligase Butelase-1, showing the amino acid sequence of uncyclized kB1-NHV and the process of cyclization using peptide ligase in cyclization buffer at 37°C for 1 hour. Figure 18 b shows the chromatogram of uncyclized kB1-NHV, where the peak corresponds to the uncyclized peptide, and the peak in the figure is a single peak of the kB1-NHV chromatogram at a retention time of 9 min; Figure 18 c shows the chromatogram of cyclized kB1-NHV. In the figure, a single peak of kB1-NHV appears at 9 min, and a peak of cyclized KB1 also appears at 12 min. The shift indicates that the peptide cyclization is successful.

[0171] The results showed that when kB1-NHV was treated with Butelase-1, a peptide ligase recombinantly expressed from Nicotiana benthamiana, a new peak with a retention time of 12 minutes was generated, indicating that a cyclization reaction was completed ( Figure 18 c) In addition, Figure 19 The mass spectrum of the peak produced by the cyclization reaction was consistent with the theoretical molecular weight of the cyclic kB1 (2947.02 Da) product, which further confirmed the completion of the cyclization reaction.

[0172] Example 6: Kinetic parameters of recombinant polypeptide ligase

[0173] The kinetic parameters of the recombinant polypeptide ligase were measured using the Forster resonance energy transfer (FRET) assay. To this end, two substrates were synthesized, consisting of the N-terminal substrate KAL (EDANS) VINHV and the C-terminal substrate GIGG (DABSYL) IRK. The ligation assay was performed according to the system of the cyclization activity test provided in Example 5, and the final concentrations of the substrates were 5, 10, 15, 20, 25 and 35 μM. 20 μM recombinant polypeptide ligase Butelase-1 was added to the cyclization reaction system. The reaction was run at 37°C for 10 minutes and measured at intervals of 30 seconds to calculate the initial rate of the ligation reaction. Fluorescence ( Figure 20 ), the reaction absorbance (RFU) data of different substrate concentrations (5, 10, 15, 20, 25 and 35 μM) over time were compared to analyze the reaction rate.

[0174] The obtained kinetic curve is as follows Figure 21As shown in the results, the kinetic parameters of the recombinant polypeptide ligase calculated from the Michaelis-Menten plot, kcat ( s-1 ) was 2.67, Km was 2.7 μM, and the catalytic efficiency (kcat / Km) was 9,889 M -1 s -1 ( Figure 21 ), which is almost consistent with other ligases isolated from plant species that produce cyclic peptides. The present invention successfully obtains a polypeptide ligase with ligation function, and the obtained polypeptide ligase has a high ligation efficiency.

[0175] Example 7: Molecular Function of Recombinant Peptide Ligase in C-Terminal Labeling of Fluorophore-Labeled Antibodies

[0176] To evaluate the coupling activity of peptide ligase for C-terminal ligation, 160,000 DaMW Herceptin antibody (purchased from Nanjing GenScript Biotechnology Co., Ltd.) was incubated with the fluorescent peptide GIGGIRK (FITC) supplemented with 100 nM peptide ligase PPL.

[0177] The Herceptin antibody is composed of two heavy chains (H) and two light chains (L). The heavy and light chains correspond to 50 and 24 kDa, respectively. The molecular weight of the Herceptin complete antibody is 148 kDa. It is modified at its C-terminus with an additional peptide ligase recognition motif sequence NHV ( Figure 22 a). Herceptin was analyzed by SDS-PAGE under non-reducing and reducing conditions (reducing conditions mean that the loading buffer was supplemented with 5mM dithiothreitol (DTT), while non-reducing conditions did not add DTT). The results were then examined using Coomassie staining. Figure 22 As shown in Figure b, the single band around 150 kDa corresponds to the intact antibody (HHLL), confirming that the disulfide bonds are intact in a non-reducing environment. Adding a reducing agent, such as dithiothreitol (DTT), disrupts the disulfide bonds, resulting in the separation of the heavy and light chains. The gel shows several bands, with the 50 kDa band (H) representing the heavy chain, the 24 kDa band (L) representing the light chain, the 100 kDa band (HH) corresponding to two heavy chains, and the 70 kDa band (HLL) representing one heavy chain and two light chains. This indicates that different subunit forms exist due to the disruption of disulfide bonds. As can be seen from the figure, there are more bands under reducing conditions (Reducing) than under non-reducing conditions (Non-Reducing), indicating the presence of disulfide bonds, which are broken down into multiple bands by DTT.

[0178] To ensure effective binding, Herceptin antibodies were incubated with 50 μM of the short fluorescent peptide GIGGIRK (FITC) and 100 nM of peptide ligase at 37°C for 1 hour. To evaluate the coupling effect, 25 μL of the reaction volume was mixed with 5× SDS loading dye (purchased from Beyotime Biotechnology Co., Ltd.). The mixture was subjected to SDS-PAGE and analyzed under UV light to estimate the FITC signal. Under reducing conditions (reducing), 5 mM dithiothreitol (DTT) was added to the loading dye, while under non-reducing conditions (non-reducing), no DTT was added.

[0179] Figure 23 It is the result of peptide ligase catalyzing the connection between FITC and Herceptin antibody under non-reducing conditions; wherein, Figure 23 Figure a is a schematic diagram of a peptide ligase-facilitated ligation reaction; as shown, the peptide ligase recognizes the amino acid sequence of the substrate (P1, P2, P3) and catalyzes the connection of a FITC-labeled peptide to the target protein Herceptin (mAb). The diagram illustrates how the enzyme stabilizes the transition state, inhibits hydrolysis, and forms a ligation product with the fluorophore (FITC), which can be detected using fluorescence. The diagram also shows how the ligation results in the attachment of the FITC molecule to the antibody, indicating successful conjugation. Figure 23 b shows the results of SDS-PAGE analysis of Herceptin and FITC peptide bands under non-reducing conditions. The figure shows proteins treated with peptide ligase, FITC-labeled peptide, and Herceptin under non-reducing conditions. In the presence of FITC and Herceptin, a ligation product (indicated by the HHLL band) appears, corresponding to the intact antibody linked to the FITC-labeled peptide. The corresponding fluorescent signal below the gel image confirms the presence of the ligation product, which is green. When peptide ligase is not added, no ligation product is produced, indicating that the enzyme is essential for the ligation process. Fluorescence imaging confirms that ligation is also successful under non-reducing conditions. Fluorescence intensity increases over time, as shown in the bar graph on the right. Plotting fluorescence intensity at 30, 60, and 120 minutes shows that ligation efficiency increases over time, supporting the catalytic activity of peptide ligase in the ligation reaction.

[0180] Figure 24Figure 2 shows the SDS-PAGE analysis and fluorescence signal results of Herceptin and FITC peptide bands under reducing conditions. As can be seen from the figure, SDS-PAGE under reducing conditions shows distinct bands corresponding to the heavy (H) and light (L) chains of Herceptin. The right side of the figure annotates the combination bands HH (heavy-heavy), HHL (heavy-light-light), and HHLL (partially reduced whole antibody complex). In the lane containing both Herceptin and FITC peptide but without PPL, only the expected antibody chain bands are visible, indicating that no linkage occurs in the absence of enzyme activity. In contrast, the lane containing PPL shows successful linkage of the FITC-labeled peptide to the antibody, while the lane without PPL shows no fluorescence, confirming that the coupling is enzyme-dependent and not due to nonspecific adsorption or interaction.

[0181] Depend on Figure 23 and Figure 24 The peptide ligase efficiently linked Herceptin to the GIGGIRK (FITC) peptide, demonstrating that the recombinant peptide ligase expressed in Nicotiana benthamiana exhibited significant conjugation activity. The time-dependent increase in fluorescence intensity further confirmed its enzymatic activity and provided a quantitative measure of ligation efficiency.

[0182] The above embodiments illustrate the basic principles, main features, and advantages of the present invention. The present invention is not limited to the details of the above embodiments, and the present invention can be implemented in other specific forms without departing from the spirit or essential features of the present invention. The embodiments described are exemplary and non-restrictive.

Claims

1. An expression cassette for efficiently expressing a target gene or target protein, characterized in that: The expression cassette includes a promoter, a 5'UTR, a 3'UTR fragment and multiple terminators connected in sequence. The multiple terminators are a cauliflower mosaic virus 35ST terminator and a Nicotiana benthamiana actin terminator Niben96 connected in sequence. There is a linker fragment between the 5'UTR and the 3'UTR, and the linker fragment contains a restriction enzyme cutting site.

2. The expression cassette according to claim 1, characterized in that The restriction enzyme cutting sites include AgeI, KpnI, XbaI and XhoI, and the linker fragment sequence is shown in SEQ ID No:

2.

3. The expression cassette according to claim 1, characterized in that A strong Kozak sequence is also contained between the 5'UTR and the Linker fragment, and the strong Kozak sequence is UUAAA.

4. The expression cassette according to claim 1, characterized in that The nucleotide sequence of the 5'UTR to 3'UTR is shown in SEQ ID No:

1.

5. The expression cassette according to claim 1, characterized in that The nucleotide sequence of the cauliflower mosaic virus 35S terminator is shown in SEQ ID No: 17, and the nucleotide sequence of the Nicotiana benthamiana actin terminator Niben96 is shown in SEQ ID No:

18.

6. The expression cassette according to claim 1, characterized in that The nucleotide sequence of the expression cassette is shown in SEQ ID No:

3.

7. The expression cassette according to claim 1, wherein The coding sequence of the target gene or target protein is inserted into any of the restriction enzyme sites. Preferably, the coding sequence of the target gene or target protein is inserted into the AgeI / XhoI site.

8. The expression cassette according to claim 1, wherein The target gene or target protein includes polypeptide ligase and EGFP fluorescent protein.

9. The expression cassette according to claim 8, characterized in that The nucleotide sequence of the polypeptide ligase coding sequence is shown in SEQ ID No: 20, and the coding sequence of the EGFP fluorescent protein is shown in SEQ ID No:

4.

10. The expression cassette according to claim 8 or 9, characterized in that The nucleotide sequence of the expression cassette is shown in SEQ ID No: 27 or 28.

11. An expression vector for efficiently expressing a target gene or target protein, characterized in that: The expression vector comprises a vector skeleton and the expression cassette according to any one of claims 1 to 10.

12. The expression vector according to claim 11, characterized in that The expression vector includes an expression vector for efficiently expressing polypeptide ligase.

13. A recombinant engineered bacterium that efficiently expresses a target gene or target protein, characterized in that: The recombinant engineered bacteria comprises the expression vector according to claim 12 or 13.

14. Use of the expression cassette according to any one of claims 1 to 10, the expression vector according to any one of claims 11 to 12, or the recombinant engineered bacterium according to claim 13 in efficiently expressing a target gene or target protein.

15. A method for efficiently expressing a polypeptide ligase, characterized in that: The following steps are included: Step S1, constructing an expression vector containing the expression cassette according to any one of claims 1 to 10; Step S2, transferring the expression vector into Agrobacterium, and culturing to obtain Agrobacterium infection fluid; Step S3: infecting plant tissues or plant cells with the Agrobacterium infection solution, and extracting the polypeptide ligase from the plant tissues.

16. The method according to claim 15, characterized in that The Agrobacterium is LBA4404, GV3101 and EHA105. Preferably, the Agrobacterium is LBA4404.

17. The method according to claim 15, characterized in that The plant is tobacco, preferably, the plant is Nicotiana benthamiana; the plant tissue is plant leaves.

18. A polypeptide ligase expressed by the method according to any one of claims 15 to 17.

19. Use of the polypeptide ligase according to claim 18 in the cyclization and / or ligation of linear peptide substrates, proteins, and antibody ligation.

20. The use according to claim 19, characterized in that The antibodies include Herceptin antibodies, the peptides include fluorescent peptide GIGGIRK, and the linear peptide substrates include substrate kB1-NHV, N-terminal substrate KAL(EDANS)VINHV and C-terminal substrate GIGG(DABSYL)IRK.

Images