KASP molecular marker for identifying soybean hundred-grain weight and application thereof

By identifying the 100-seed weight of soybeans using KASP molecular markers and screening soybeans with high or low 100-seed weights using C20T SNP sites, the problem of slow breeding process in existing technologies has been solved, and rapid screening and efficient breeding have been achieved.

CN120555640BActive Publication Date: 2026-01-02INST OF CEREAL & OIL CROPS HEBEI ACAD OF AGRI & FORESTRY SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510700180.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-28
Publication Date
2026-01-02
Estimated Expiration
2045-05-28

AI Technical Summary

Technical Problem

The lack of effective molecular markers in existing technologies for screening and assisting in screening soybean 100-seed weight has led to slow soybean breeding progress and difficulty in cultivating high-yielding and high-quality new soybean varieties.

Method used

Using KASP molecular markers and with the soybean Wm82.a2.v1 genome sequence as a reference, the C20T SNP site (SNP 16321243 on soybean chromosome 11) was detected to identify the genotype CC or TT, and soybeans with high or low 100-seed weight were screened out. The genotype was determined by PCR amplification and fluorescence signal detection or sequencing.

Benefits of technology

This allows for the rapid and efficient screening of soybean varieties with high 100-seed weight, shortening the breeding process and improving the breeding efficiency and quality of new soybean varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120555640B_ABST
    Figure CN120555640B_ABST
Patent Text Reader

Abstract

The application discloses a KASP molecular marker for identifying soybean hundred-grain weight and application, relates to the field of biotechnology, and use of SNP sites. The SNP site takes a soybean Wm82.a2.v1 genome sequence as a reference genome. The SNP is the 16321243th SNP on a soybean 11th chromosome, corresponds to the 20th base from the 5' end of the sequence shown in SEQ ID NO:1, and when the site is CC homozygous, the corresponding genotype is A; when the site is TT homozygous, the corresponding genotype is B. The use is as follows: screening or auxiliary screening of soybeans with different hundred-grain weights, and the high and low of the soybean hundred-grain weight is as follows: the soybean with genotype A homozygous is higher than or higher than the soybean with genotype B homozygous. The application has important theoretical significance and economic value for using molecular marker assisted selection to obtain soybean germplasm or breeding offspring materials with high hundred-grain weight.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, and particularly relates to a KASP molecular marker for identifying the hundred-seed weight of soybean and application thereof. BACKGROUND

[0002] Soybean (Glycine max (Linn.) Merr.) is an important food and oil crop in China. With the development of social economy and the continuous improvement of people's living standards, the consumption of soybean in China is becoming larger and larger, which leads to a serious contradiction between supply and demand of soybean in China. China is the largest soybean consumer in the world. In the face of huge domestic demand, China cannot meet the demand by self-production and has to rely on a large amount of imports. Since 2000, China has become the largest soybean importer in the world, and the amount of soybean imports has been increasing year by year. In 2024, the amount of soybean imports in China reached 10503 million tons. The huge amount of soybean imports has led to a huge crisis in the domestic soybean industry chain, which seriously threatens the food security of China. Therefore, improving the yield of soybean has always been a serious problem faced by breeders in China.

[0003] The hundred-seed weight of soybean is one of the important factors affecting the yield of soybean. According to statistics, the hundred-seed weight of cultivated soybean is generally 3.0g-77.5g, and the hundred-seed weight of wild soybean is generally 0.5g-10.0g. When the hundred-seed weight of soybean is generally 19.2g, the highest yield can be expected. Both too large and too small are not conducive to the increase of soybean yield. Therefore, breeding soybean varieties with reasonable hundred-seed weight is helpful to the increase of soybean yield. Some genetic loci and candidate genes related to the hundred-seed weight of soybean have also been reported, but molecular markers for soybean molecular assisted breeding still need to be further developed. Cultivated soybean has a much lower genetic diversity than wild soybean through selection. By mining and developing molecular markers related to the hundred-seed weight of soybean in wild soybean and applying them in modern breeding process, it has important scientific significance to fully utilize the excellent genetic information of wild soybean and breed new soybean varieties with high yield and high quality. SUMMARY

[0004] The technical problem to be solved by the present application is to provide a KASP molecular marker for identifying the hundred-seed weight of soybean and application thereof.

[0005] To solve the above technical problems, the technical solutions adopted by the present application are as follows.

[0006] The use of the SNP site, the SNP site is based on the soybean Wm82.a2.v1 genome sequence as the reference genome, the SNP is the 16321243th SNP on the 11th chromosome of soybean, corresponding to the 20th base from the 5' end of the sequence shown in SEQ ID NO: 1, when the site is CC homozygous, the corresponding genotype is A; when the site is TT homozygous, the corresponding genotype is B;

[0007] The use is: screening or assisting in screening different hundred-grain weight of soybean, different hundred-grain weight of soybean is: genotype A homozygous soybean is higher than or candidate is higher than genotype B homozygous soybean.

[0008] A method for screening or assisting in screening different hundred-grain weight of soybean, comprising the following steps: detecting the genotype of the soybean to be tested is genotype CC or genotype TT, the hundred-grain weight of the soybean with genotype CC is greater than the hundred-grain weight of the soybean with genotype TT.

[0009] The soybean with genotype CC is a soybean with genotype CC homozygous based on C20T SNP site;

[0010] The soybean with genotype TT is a soybean with genotype TT homozygous based on C20T SNP site;

[0011] The C20T SNP site is the 16321243th SNP on chromosome 11 of soybean based on the Wm82.a2.v1 genome sequence of soybean as the reference genome, corresponding to the 20th nucleotide from the 5' end of SEQ ID NO: 1.

[0012] Further preferably, the step of detecting the genotype of the soybean to be tested is genotype CC or genotype TT is as follows:

[0013] (a1) using the genomic DNA of the soybean to be tested as a template, performing PCR amplification with a primer combination to obtain a PCR amplification product;

[0014] The primer combination consists of the upstream primer 11PC-1-FAM shown in SEQ ID NO: 2, the upstream primer 11PC-1-VIC shown in SEQ ID NO: 3, and the downstream primer 11PC-1-R shown in SEQ ID NO: 4;

[0015] (a2) after step (a1) is completed, detecting the fluorescence signal of the PCR amplification product with an instrument, obtaining the genotype of the soybean to be tested according to the color of the fluorescence signal, if the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 11PC-1-FAM, showing blue fluorescence, then the soybean sample to be tested is CC genotype; if the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 11PC-1-VIC, showing red fluorescence, then the soybean sample to be tested is TT genotype.

[0016] Further preferably, the step of detecting the genotype of the soybean to be tested is genotype CC or genotype TT is as follows:

[0017] (b1) taking the genomic DNA of the soybean to be tested as a template, performing PCR amplification by using a primer combination to obtain a PCR amplification product;

[0018] The primer combination consists of the upstream primer 11PC-1-FAM shown in SEQ ID NO: 2, the upstream primer 11PC-1-VIC shown in SEQ ID NO: 3, and the downstream primer 11PC-1-R shown in SEQ ID NO: 4;

[0019] (b2) sequencing the PCR amplification product obtained in step (b1);

[0020] (b3) obtaining the genotype of the soybean to be tested according to the sequencing result obtained in step (b2).

[0021] A kit for identifying or assisting in identifying the hundred-seed weight of soybean, comprising a primer combination for detecting whether the genotype of the soybean to be tested is genotype CC or genotype TT;

[0022] The primer combination consists of the upstream primer 11PC-1-FAM shown in SEQ ID NO: 2, the upstream primer 11PC-1-VIC shown in SEQ ID NO: 3, and the downstream primer 11PC-1-R shown in SEQ ID NO: 4;

[0023] The genotype CC is a genotype CC homozygote based on the C20T SNP site;

[0024] The genotype TT is a genotype TT homozygote based on the C20T SNP site;

[0025] The C20T SNP site is the 16321243th SNP on chromosome 11 of soybean with the Wm82.a2.v1 genome of soybean as the reference genome, corresponding to the 20th nucleotide from the 5' end of SEQ ID NO: 1.

[0026] The molecular marker shown in SEQ ID NO: 1.

[0027] The kit or the molecular marker described above in the identification or assisted identification of the hundred-seed weight of soybean.

[0028] The kit or the molecular marker described above in the screening or assisted screening of soybeans with different hundred-seed weights.

[0029] The kit or the molecular marker described above in the application of soybean breeding.

[0030] The application of the primer combination consisting of the upstream primer 11PC-1-FAM shown in SEQ ID NO: 2, the upstream primer 11PC-1-VIC shown in SEQ ID NO: 3 and the downstream primer 11PC-1-R shown in SEQ ID NO: 4 in directional breeding or assisted directional breeding of soybean lines with high hundred-seed weight.

[0031] The KASP marker for identifying the genotype CC and TT allelic variation and the correlation between the KASP marker and the hundred-seed weight of soybeans are provided in the application, and the KASP marker in the application is applied to molecular marker assisted selection of the hundred-seed weight of soybeans, so that soybean varieties (germplasm) with high hundred-seed weight can be quickly and efficiently screened out, thereby accelerating the breeding process of high-quality soybean new varieties. The application has important theoretical significance and economic value for utilizing molecular marker assisted selection of soybean germplasm or breeding progeny materials with high hundred-seed weight. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 Figure is a QTL positioning analysis result diagram of the hundred-seed weight trait of the 14019 population numbered in Example 1 of the application;

[0033] Figure 2 Figure is a normal distribution marker selection efficiency diagram of the hundred-seed weight of the 14019 population numbered in Example 1 of the application in 2019 and 2021;

[0034] Figure 3 Figure is a KASP marker genotyping and hundred-seed weight variance analysis result diagram of the hundred-seed weight of the secondary population in Example 2 of the application in 2024. DETAILED DESCRIPTION

[0035] The following examples illustrate the application in detail. The various raw materials and equipment used in the application are conventional commercially available products and can be directly obtained by market purchase. Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0036] It should be understood that when used in the specification and the appended claims of the present application, the term "comprising" indicates the presence of the described features, integers, steps, operations, elements, and / or components, but does not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof.

[0037] It should also be understood that the term "and / or" as used in the specification and the appended claims of the present application means any combination of one or more of the associated listed items and all possible combinations, and includes these combinations.

[0038] Reference in the specification to "one embodiment" or "some embodiments" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the application. The appearances of the phrase "in one embodiment" or "in some embodiments" in various places in the specification are not necessarily all referring to the same embodiment, however, but can refer to one or more but less than all of the embodiments. The terms "including," "comprising," "having" and variations thereof herein are meant to encompass the items listed thereafter, but do not exclude other items from also being present. The term "consisting of" is meant to exclude any item not specified, but "consisting essentially of" or "consisting substantially of" does not exclude other items being present in minor amounts.

[0039] In addition, in the description of the specification and the appended claims, the terms "first", "second", "third", etc. are used only to distinguish descriptions, and cannot be understood as indicating or implying relative importance.

[0040] The technical solutions of the present application will be described below in connection with specific embodiments of the present application, which are clear and complete. Obviously, the described embodiments are only some of the embodiments of the present application, not all. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor are within the scope of protection of the present application.

[0041] Example 1: Discovery of soybean hundred-seed weight specific SNP site

[0042] The soybean material in this embodiment is derived from: in 2006, using cultivated soybean Jidou 12 as the female parent and wild soybean ZYD02738 as the male parent, a RIL population was established by hybridization. In 2012, Jidou 12 was used as the female parent and the RIL population was used as the male parent to perform backcrossing, and the BC1F1 population was obtained in 2013. In 2014, Jidou 12 was used as the female parent and the BC1F2 of Jidou 12 and ZYD02738 combination was used as the male parent to perform backcrossing; the BC2F1 population was obtained in 2015. After selfing for 4 times, the BC2F4:5 population, i.e. population 14019, was obtained. In December 2018, Sanya, leaves were taken from the rows of BC2F4:5, DNA was extracted by BMAIKE company, and each strain was genotyped to construct a genetic map.

[0043] The phenotypic detection method of soybean hundred-seed weight is as follows: the number of single plant seeds and the weight of single plant seeds of each strain of wild soybean substitution line population 14019 are counted, and the calculation formula of hundred-seed weight is: hundred-seed weight = (weight of single plant seeds / number of single plant seeds) x 100.

[0044] QTL mapping of soybean hundred-seed weight is performed in combination with the phenotypic data, such as Figure 1The QTLs associated with the soybean 100-seed weight trait were located on chromosome 11 of soybean, and the SNP marker associated with the QTLs was Chrll_16321243_C_T. The SNP was located at the 16321243th SNP on chromosome 11 of soybean, and the nucleotide type was C or T, which was the 20th nucleotide of SEQ ID NO: 1, with the soybean Williams 82 (Wm82.a2.vl) genome sequence as the reference genome.

[0045] Table 1 QTL positioning analysis results of the 100-seed weight trait of the 2019 population

[0046]

[0047] The genotypes of each family in the population corresponding to the soybean SNP marker Chrll_16321243_C_T were divided into three types, CC, TT and C / T. The genotype CC was a homozygous type of C, the genotype TT was a homozygous type of T, and the genotype CT was a heterozygous type of C and T. The 100-seed weight phenotype values of the 53 soybean materials in the strain and the genotype identification results of Chrll_16321243_C_T in this embodiment are shown in Table 2 and Table 3. Figure 2 As shown in Table 2 and Table 3, in 2019, the average 100-seed weight of the CC genotype and the TT genotype family was 14.44 g and 11.92 g, respectively, which was significantly higher than that of the TT genotype family by 21.14% (P<0.001); in 2021, the average 100-seed weight of the CC genotype and the TT genotype family was 10.85 g and 9.11 g, respectively, which was significantly higher than that of the TT genotype family by 19.09% (P<0.001).

[0048] Table 2 100-seed weight detection results of the 2019 population in 2019 and 2021

[0049]

[0050]

[0051]

[0052] Example 2, secondary population soybean KASP marker gene identification

[0053] A KASP marker was designed for the specific CHR11_16321243_C_T site on chromosome 11, and the primer was designed as follows:

[0054] 11PC-1-FAM: gaaggtgaccaagttcatgctACTGTGAACAACACTCCAAC (SEQ ID NO: 2);

[0055] 11PC-1-VIC: gaaggtcggagtcaacggattACTGTGAACAACACTCCAAT (SEQ ID NO: 3);

[0056] 11PC-1-R: CCATCAACCTTGTGGAGACC (SEQ ID NO: 4);

[0057] The KASPAssay Mix enzyme 5 μL was selected for amplification: (1.2 μL of 11PC-1-FAM, 1.2 μL of 11PC-1-VIC, 3 μL of 11PC-1-R, and 4.6 μL of ddH2O). The reaction system was as shown in Table 3, and the reaction procedure was as follows: 94°C for 15 min; 94°C for 20 s, 61-55°C for 30 s, 10 cycles, each cycle decreasing by 0.6°C; 94°C for 20 s, 55°C for 1 min, 26 cycles, and finally 30°C for 1 min.

[0058] Table 3 PCR reaction system of test population

[0059]

[0060] The F3 generation subpopulation 66 strains derived from population No. 14019 were genotyped using the marker Chr11_16321243_C_T. Among the 66 Chinese soybean germplasm, 10 germplasms were CC genotypes, and 15 germplasms were TT genotypes, and the genotyping results are shown in Table 4 and Figure 3

[0061] Table 4 Detection results of soybean molecular markers and hundred seed weight of subpopulation

[0062]

[0063]

[0064]

[0065] Table 5 Statistical analysis of the relationship between Chr11_16321243_C_T allelic variation types and hundred seed weight

[0066]

[0067] The average hundred-grain weight of the CC genotype and TT genotype families was 17.79 g and 14.21 g, respectively, and the average hundred-grain weight of the CC genotype family was significantly higher than that of the TT genotype family by 25.16% (P<0.001). It was shown that the size of soybean hundred-grain weight identified by the marker Chr11_16321243_C_T was reliable and effective.

[0068] In summary, the soybean with the genotype CC of Chr11_16321243_C_T is a soybean with high hundred-grain weight, the soybean with the genotype TT of CHR11_16321243_C_T is a soybean with low hundred-grain weight, and the hundred-grain weight of the soybean with the genotype CC of Chr11_16321243_C_T is higher than that of the soybean with the genotype TT of CHR11_16321243_C_T. When selecting the superior varieties of soybean hundred-grain weight, the soybean with the genotype CC of Chr11_16321243_C_T is selected for breeding and improvement.

[0069] Although the embodiments of the present application have been shown and described, it should be understood by those skilled in the art that various changes, modifications, substitutions and variations can be made thereto without departing from the principles and spirit of the present application, and the scope of the present application is defined by the appended claims and their equivalents.

[0070] In the above embodiments, the description of each embodiment has its own focus, and the parts not described or recorded in detail in a certain embodiment can be referred to the relevant description of other embodiments.

[0071] The above-described embodiments are only used to illustrate the technical solutions of the present application, rather than limit them; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or make equivalent substitutions for part of the technical features; and these modifications or substitutions do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application, and should be included in the protection scope of the present application.

Claims

1. Use of a SNP site, characterized in that, the SNP site is a SNP on chromosome 11 of Glycine max with a position of 16321243, corresponding to the 20th nucleotide from the 5' end of the sequence shown in SEQ ID NO: 1, and the genotype corresponding to the SNP site is A when the SNP site is CC homozygous, and the genotype corresponding to the SNP site is B when the SNP site is TT homozygous; the use is for screening or assisting in screening soybeans with different hundred-seed weights, wherein the soybeans with genotype A have a higher hundred-seed weight than the soybeans with genotype B.

2. A method of screening or assisting in screening soybeans for different seed weight, characterized in that, comprising the following steps: detecting whether the genotype of the soybean to be tested is genotype CC or genotype TT, wherein the soybean with genotype CC has a higher hundred-seed weight than the soybean with genotype TT; the soybean with genotype CC is a soybean with genotype CC homozygous based on the C20T SNP site; the soybean with genotype TT is a soybean with genotype TT homozygous based on the C20T SNP site; the C20T SNP site is a SNP on chromosome 11 of Glycine max with a position of 16321243, corresponding to the 20th nucleotide from the 5' end of the sequence shown in SEQ ID NO:

1.

3. The method of claim 2, wherein, the step of detecting whether the genotype of the soybean to be tested is genotype CC or genotype TT is as follows: (a1) using the genomic DNA of the soybean to be tested as a template, performing PCR amplification using a primer combination to obtain a PCR amplification product; the primer combination consists of the upstream primer 11PC-1-FAM shown in SEQ ID NO: 2, the upstream primer 11PC-1-VIC shown in SEQ ID NO: 3, and the downstream primer 11PC-1-R shown in SEQ ID NO: 4; (a2) after step (a1) is completed, detecting the fluorescence signal of the PCR amplification product using an instrument, and obtaining the genotype of the soybean to be tested according to the color of the fluorescence signal, wherein if the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled by primer 11PC-1-FAM, showing blue fluorescence, then the soybean sample to be tested is genotype CC; if the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled by primer 11PC-1-VIC, showing red fluorescence, then the soybean sample to be tested is genotype TT.

4. The method of claim 2, wherein, the step of detecting whether the genotype of the soybean to be tested is genotype CC or genotype TT is as follows: (b1) using the genomic DNA of the soybean to be tested as a template, performing PCR amplification using a primer combination to obtain a PCR amplification product; the primer combination consists of the upstream primer 11PC-1-FAM shown in SEQ ID NO: 2, the upstream primer 11PC-1-VIC shown in SEQ ID NO: 3, and the downstream primer 11PC-1-R shown in SEQ ID NO: 4; (b2) sequencing the PCR amplification product obtained in step (b1); (b3) obtaining the genotype of the soybean to be tested according to the sequencing result obtained in step (b2).

5. A kit for identifying or aiding in the identification of soybean seed weight, characterized in that, The primer combination comprises primers for detecting whether the genotype of the soybean to be tested is genotype CC or genotype TT; The primer combination consists of an upstream primer 11PC-1-FAM as shown in SEQ ID NO: 2, an upstream primer 11PC-1-VIC as shown in SEQ ID NO: 3, and a downstream primer 11PC-1-R as shown in SEQ ID NO: 4; The genotype CC is a genotype CC homozygote based on a C20T SNP site; The genotype TT is a genotype TT homozygote based on a C20T SNP site; The C20T SNP site is the 16321243th SNP on chromosome 11 of soybean based on the soybean Wm82.a2.v1 genome sequence, corresponding to the 20th nucleotide from the 5' end of SEQ ID NO:

1.

6. Use of the kit of claim 5 in identifying or assisting in identifying the hundred-seed weight of soybean.

7. Use of the kit of claim 5 in screening or assisting in screening soybeans with different hundred-seed weights.

8. Use of a primer combination in targeted breeding or assisting in targeted breeding of soybean lines with high hundred-seed weight, the primer combination consisting of an upstream primer 11PC-1-FAM as shown in SEQ ID NO: 2, an upstream primer 11PC-1-VIC as shown in SEQ ID NO: 3, and a downstream primer 11PC-1-R as shown in SEQ ID NO: 4.

Citation Information

Patent Citations

  • Molecular marker for identifying hundred-grain weight of soybeans and application of molecular marker

    CN105087757A

  • SNP site combination related to agronomic characters of soybeans, liquid-phase gene chip and application

    CN112852989A