A set of specific ssr markers of forest tree xylella fastidiosa, development method and application
By developing a specific SSR marker for *Dioscorea pseudococcus*, the shortcomings in genetic diversity research of *Dioscorea pseudococcus* have been addressed, enabling efficient population genetic diversity analysis and supporting the scientific prevention and control of forest canker.
Patent Information
- Application Number
- CN202510707029.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-29
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2045-05-29
AI Technical Summary
Current research on the genetic diversity of *Trichoderma pseudococcus* is relatively limited, which hinders a deeper understanding of its transmission characteristics and evolutionary mechanisms, and restricts scientific control strategies for forest canker.
A set of forest tree canker-specific SSR markers, including LPS01-LPS39, were developed. By designing SSR primer pairs targeting *Trichoderma pseudococcus*, PCR amplification and sequencing were performed to distinguish the genetic differences between different strains, providing highly polymorphic and specific amplification products.
This study enabled precise differentiation of population genetics of *Trichoderma pseudococcus*, improved the resolution of population genetic diversity analysis, revealed its spread and evolution trends, and provided a scientific basis for the prevention and control of forest canker.
Smart Images

Figure CN120555641B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of plant protection. Specifically, it is a group of specific SSR markers of forest tree canker disease fungus, development method and application. BACKGROUND
[0002] Forest tree canker disease caused by Botryosphaeriaceae fungi is one of the important diseases in southern China's plantations, which poses a serious threat to the plantation industry. The typical symptoms of the disease include the appearance of canker and rot on the host stem. During the development of the disease, the lesion gradually expands and shows a trend of color deepening. The diseased tissue is water-stained and collapses in the later stage of the disease, and in severe cases, it can lead to blackening and death of the branches and trunks, and even the whole plant. Because the host range of the disease is wide, and it occurs widely in eucalyptus, pine, and Chinese fir plantations in southern China, it poses a major challenge to the sustainable development of China's plantations.
[0003] Studies have shown that Lasiodiplodia pseudotheobromae is one of the main pathogens of canker disease in southern China's plantations. The pathogen belongs to the phylum Ascomycota, class Dothideomycetes, order Botryosphaeriales, family Botryosphaeriaceae, and genus Lasiodiplodia. Currently, L. pseudotheobromae has been found widely in plantations in Fujian, Guangdong, Guangxi Zhuang Autonomous Region, Hainan, and Yunnan, etc., and has strong pathogenicity, causing serious damage to different tree species. However, the genetic diversity of the pathogen in different host plants and different regions is limited, which affects the understanding of its transmission characteristics and evolutionary mechanisms, and restricts the development of scientific and effective disease control strategies. SUMMARY
[0004] Therefore, the technical problem to be solved by the present application is to provide a group of specific SSR markers of forest tree canker disease fungus, development method and application. These SSR (Simple Sequence Repeat) markers have high polymorphism and good repeatability, and can be widely used in the study of population genetic diversity of L. pseudotheobromae in different regions and different hosts, providing key technical means for further analyzing the transmission characteristics and evolutionary mechanisms of the pathogen, and providing scientific basis for the comprehensive prevention and control strategy of forest tree canker disease.
[0005] To solve the above technical problems, the present application provides the following technical solutions:
[0006] A set of SSR markers specific to the forest tree canker pathogen *Lasiodiplodia pseudotheobromae*; the SSR markers include LPS01, LPS03, LPS04, LPS08, LPS10, LPS13, LPS15, LPS21, LPS22, LPS23, LPS31, LPS34, LPS35, and LPS39; wherein:
[0007] The nucleotide sequence of LPS01 is shown in SEQ ID NO.1;
[0008] The nucleotide sequence of the LPS03 is shown in SEQ ID NO.2;
[0009] The nucleotide sequence of the LPS04 is shown in SEQ ID NO.3;
[0010] The nucleotide sequence of LPS08 is shown in SEQ ID NO.4;
[0011] The nucleotide sequence of LPS10 is shown in SEQ ID NO.5;
[0012] The nucleotide sequence of LPS13 is shown in SEQ ID NO.6;
[0013] The nucleotide sequence of LPS15 is shown in SEQ ID NO.7;
[0014] The nucleotide sequence of LPS21 is shown in SEQ ID NO.8;
[0015] The nucleotide sequence of LPS22 is shown in SEQ ID NO.9;
[0016] The nucleotide sequence of LPS23 is shown in SEQ ID NO.10;
[0017] The nucleotide sequence of LPS31 is shown in SEQ ID NO.11;
[0018] The nucleotide sequence of the LPS34 is shown in SEQ ID NO.12;
[0019] The nucleotide sequence of the LPS35 is shown in SEQ ID NO.13;
[0020] The nucleotide sequence of the LPS39 is shown in SEQ ID NO.14.
[0021] The 14 SSR markers mentioned above were validated in the *Dioscorea pseudocatechola* population, which showed high polymorphism with an average allele count of 5.214. When SSR primer pairs designed based on these SSR markers were used for PCR amplification of the corresponding SSR loci in the *Dioscorea pseudocatechola* genomic DNA, specific PCR amplification products were obtained. Sequencing of the PCR amplification products can effectively distinguish the genetic differences between different strains, providing stable molecular targets for genetic research on the *Dioscorea pseudocatechola* population.
[0022] A method for developing a specific SSR marker for the forest tree canker pathogen, wherein the forest tree canker pathogen is *Lasiodiplodia pseudotheobromae*, and the development method includes the following steps:
[0023] a) Extract genomic DNA from *Trichoderma pseudococcus* and obtain whole-genome sequencing data;
[0024] b) SSR sites were screened from whole-genome sequencing data using search parameters of 3-6 nucleotide repeat units, repeat number of 4-10 times, and 250 bp flanking sequences upstream and downstream of the repeat unit;
[0025] c) Compare the SSR sites obtained in step b) with the annotated genes in the whole genome of *Trichoderma pseudococcus* to screen out SSR sites located in non-coding regions.
[0026] d) Design SSR primer pairs based on the SSR sites screened in step c); the design parameters include: annealing temperature 55℃, 3′ end base is G or C, and the length of the amplification product is 100-450bp.
[0027] e) Using the SSR primer pairs designed in step d), PCR amplification of genomic DNA from *Trichoderma pseudococcus* strains from different hosts and regions was performed, and the polymorphism of the SSR region in the amplification product was detected by sequencing; SSR primer pairs that can perform specific amplification and whose SSR region in the amplification product is polymorphic were retained.
[0028] f) Based on the SSR primer pairs retained in step e), obtain the corresponding forest canker pathogen-specific SSR markers, namely the forest canker pathogen-specific SSR markers mentioned above.
[0029] Application of forest tree canker-specific SSR markers, wherein the application is to use the above-mentioned forest tree canker-specific SSR markers for any of the following:
[0030] (1) Identification of *Dispora simulans*;
[0031] (2) Genetic structure analysis of the *Dioscorea pseudocacodiformes* population;
[0032] (3) Genetic diversity analysis of the *Dioscorea pseudocacocarpa* population.
[0033] When applying the above-mentioned forest tree canker-specific SSR markers to the genetic diversity analysis of *Trichoderma pseudocaryophyllum* populations, the following steps should be followed:
[0034] S1. Isolate and purify the strains, and extract the genomic DNA of each strain of *Trichoderma pseudococcus*.
[0035] S2. Obtain the genotypes of the SSR loci corresponding to the above SSR markers in the genomic DNA of each strain of *Trichoderma pseudococcio*, and obtain the SSR genotype results.
[0036] S3. Calculate the population genetic diversity parameters of *Trichoderma pseudococcus* based on the SSR genotype results.
[0037] In the above application, in step S2, a primer set for specifically amplifying the SSR marker specific to forest tree canker fungi is used to perform PCR amplification of the genomic DNA of *Trichoderma pseudococcus*, and the length polymorphism of the PCR amplification product is detected to obtain the genotype of the genomic DNA of each *Trichoderma pseudococcus* strain at the SSR site.
[0038] In the above application, the primer set used for specific amplification of SSR markers specific to *Pseudomonas aeruginosa* contains 14 SSR primer pairs; wherein:
[0039] The sequences of the two primers in the SSR primer pair used for specific amplification of LPS01 are shown in SEQ ID NO.15 and SEQ ID NO.16, respectively;
[0040] The sequences of the two primers in the SSR primer pair used for specific amplification of LPS03 are shown in SEQ ID NO.17 and SEQ ID NO.18, respectively;
[0041] The sequences of the two primers in the SSR primer pair used for specific amplification of LPS04 are shown in SEQ ID NO.19 and SEQ ID NO.20, respectively;
[0042] The sequences of the two primers in the SSR primer pair used for specific amplification of LPS08 are shown in SEQ ID NO.21 and SEQ ID NO.22, respectively;
[0043] The sequences of the two primers in the SSR primer pair used for specific amplification of LPS10 are shown in SEQ ID NO.23 and SEQ ID NO.24, respectively;
[0044] The sequences of the two primers in the SSR primer pair used for specific amplification of LPS13 are shown in SEQ ID NO. 25 and SEQ ID NO. 26, respectively;
[0045] The sequences of the two primers in the SSR primer pair used for specific amplification of LPS15 are shown in SEQ ID NO.27 and SEQ ID NO.28, respectively;
[0046] The sequences of the two primers in the SSR primer pair used for specific amplification of LPS21 are shown in SEQ ID NO. 29 and SEQ ID NO. 30, respectively;
[0047] The sequences of the two primers in the SSR primer pair used for specific amplification of LPS22 are shown in SEQ ID NO. 31 and SEQ ID NO. 32, respectively;
[0048] The sequences of the two primers in the SSR primer pair used for specific amplification of LPS23 are shown in SEQ ID NO. 33 and SEQ ID NO. 34, respectively;
[0049] The sequences of the two primers in the SSR primer pair used for specific amplification of LPS31 are shown in SEQ ID NO.35 and SEQ ID NO.36, respectively;
[0050] The sequences of the two primers in the SSR primer pair used for specific amplification of LPS34 are shown in SEQ ID NO.37 and SEQ ID NO.38, respectively;
[0051] The sequences of the two primers in the SSR primer pair used for specific amplification of LPS35 are shown in SEQ ID NO. 39 and SEQ ID NO. 40, respectively;
[0052] The sequences of the two primers in the SSR primer pair used for specific amplification of LPS39 are shown in SEQ ID NO.41 and SEQ ID NO.42, respectively;
[0053] In each SSR primer pair, the odd-numbered primers are the forward primers, and the even-numbered primers are the reverse primers.
[0054] Fourteen SSR primer pairs were scientifically designed to specifically bind to the corresponding SSR sites in the genomic DNA of *Trichoderma pseudococcus* from different hosts and regions with different genetic backgrounds. They were able to stably obtain PCR amplification products of each strain at the corresponding sites, and distinguish different SSR genotypes by length polymorphism detection, thereby improving the accuracy of population genetic research.
[0055] In the above application, when detecting the length polymorphism of PCR amplification products, the chain termination sequencing method is used to obtain the base sequence of the PCR amplification products, and the length polymorphism of the PCR amplification products is obtained based on the base sequence of the PCR amplification products.
[0056] Occasional variations may occur in the genomic DNA of bacterial strains. When an insertion or deletion variation occurs in a genomic region linked to an SSR, and this variation is located within the PCR amplification region, the PCR amplification product will contain an abnormal number of bases, leading to errors in genotype determination based on product length. However, by using chain termination sequencing to obtain the base sequence of the PCR amplification product and calculating the length polymorphism of the PCR amplification product based on the base sequence, more accurate results can be obtained.
[0057] In the above application, in step S2, for each *Trichoderma pseudococcus*, a PCR reaction system is prepared using the SSR primer pair corresponding to the SSR site in the primer set for specific amplification of the SSR marker specific to forest canker pathogens, for each SSR site in its genomic DNA, in order to perform PCR amplification.
[0058] Constructing separate PCR reaction systems with multiple SSR sites for each strain helps reduce amplification interference and non-specific reactions, and improves primer amplification efficiency and result reproducibility.
[0059] In the above applications, each PCR reaction system contains: 100 ng of genomic DNA of *Trichoderma pseudococcosis* as a DNA template, 1 μL of 0.01 mol / L forward primer, 1 μL of 0.01 mol / L reverse primer, 18 μL of 2× high-fidelity PCR premix, and RNase-free double-distilled water; the volume of each PCR reaction system is 35 μL.
[0060] In the above application, the reaction program for PCR amplification in step S2 is as follows: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 1 minute, 55℃ annealing for 1 minute, 72℃ extension for 1 minute, for a total of 35 cycles; 72℃ final extension for 10 minutes.
[0061] The technical solution of the present invention achieves the following beneficial technical effects:
[0062] 1. The 14 SSR primer pairs provided in this invention, when used for PCR amplification of 14 SSR loci in the genomic DNA of *Trichoderma pseudococcus*, yield PCR products with high polymorphism and good specificity. This helps to accurately distinguish subtle genetic differences between different strains and improves the resolution of population genetic diversity and population structure. The SSR markers provided in this invention have been thoroughly screened and validated, and can be stably and repeatedly used in population genetics studies of 204 *Trichoderma pseudococcus* strains, providing a powerful molecular tool for in-depth analysis of the spread, evolution, and population structure of *Trichoderma pseudococcus* in different hosts and geographical regions.
[0063] 2. The SSR primers and SSR markers developed in this invention are currently the only molecular marker system specifically designed for the study of *Trichoderma pseudococcus* populations, filling a gap in this field. They can be used for comprehensive analysis of the genetic diversity, genetic structure, and genetic differentiation of *Trichoderma pseudococcus* populations, revealing their transmission pathways and evolutionary trends. This provides a theoretical basis and technical support for early warning, monitoring, and scientific control of plantation canker disease, reducing the risk of disease outbreaks, and has the potential value for widespread application in the actual control of forest canker disease. Attached Figure Description
[0064] Figure 1 The agarose gel electrophoresis results of PCR amplification of genomic DNA of different strains of *Trichoderma pseudocaryophyllum* using some SSR primer pairs in Example 1 of this invention;
[0065] Figure 2 The cumulative genotype distribution curves of 204 strains of *Trichoderma pseudococcus* in Example 2 of this invention;
[0066] Figure 3 The results of the genetic structure analysis of the *Pseudocoria pseudothecocarbamate* population based on STRUCTURE software in Example 2 of this invention are shown in the figure.
[0067] Figure 4 DeltaK curves of five geographical populations in Embodiment 2 of this invention. Detailed Implementation
[0068] Example 1: Development of SSR sites (SSR markers) for forest canker pathogens
[0069] The forest tree canker pathogen used in this embodiment is *Lasiodiplodia pseudotheobromae*.
[0070] In this embodiment, a sequencing strategy combining the second-generation sequencing platform Illumina HiSeq 2500 and the third-generation sequencing platform Oxford Nanopore Technologies was employed. First, second-generation sequencing libraries and third-generation sequencing libraries were constructed separately. Sequencing yielded second-generation sequencing data and third-generation whole-genome data. Then, the two sets of data were combined and assembled into complete genome sequences (i.e., whole-genome sequencing data) for five *Trichoderma pseudothecogenes* strains, thus achieving whole-genome sequencing of these five strains. These five representative strains were all collected from susceptible wild plants, and specific information is shown in Table 1. The more "+" signs in the table, the stronger the pathogenicity of the strain.
[0071] Table 1. Information on strains used for genome sequencing
[0072]
[0073] Five whole-genome sequencing data of *Trichoderma pseudococcus* were successfully obtained. The average size of the five whole-genome sequencing data (after assembly) was 43.47 Mb, the highest N50 was 5817267 bp, the average GC content was 54.76%, and the minimum number of contigs obtained from the whole-genome sequencing data (after assembly) was 8. This indicates that the whole-genome sequencing data obtained in this project has high assembly quality and good assembly integrity, and can be used as reference genome data for the development of SSR sites and the design of SSR primers for *Trichoderma pseudococcus*.
[0074] SSR primers were designed using five whole-genome sequencing datasets obtained from sequencing. Microsatellite repeat regions (SSR regions) were searched on the reference genome using Kraitv.1.3.3 software, resulting in 3945 simple repeat sequence sites (SSR sites). The search parameters were set as follows: SSR repeat unit length 3–6 nucleotides (i.e., tri-, tetra-, penta-, and hexa- selected in the software), repeat number ranging from 4 to 10, and flanking sequences of 250 bases (bp) for both upstream and downstream of the repeat unit. Of the 3945 SSR sites, 1971 met the above criteria, representing 50% of the total.
[0075] Through the above search operations, 1971 SSR loci were screened from the whole genome sequencing results. Subsequently, the annotated gene (RIFT3945; see https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCA_033955225.1 / ) in the whole genome of *Trichoderma pseudococcus* was compared with the retrieved SSR loci, and SSR loci located in non-coding regions were further screened, totaling 941.
[0076] Using Primer 3 software, SSR primer pairs were designed for the aforementioned 941 SSR sites, ensuring that at least one SSR primer pair was designed for each SSR site (each SSR primer pair contained two SSR primers). The main design parameters included: annealing temperature of 55℃, the first two bases of the 3' segment being set to G or C, and the target product length being 100–450 bp.
[0077] SSR primer pairs were selected from these designed primers. During selection, the SSR primer pairs were required to amplify fragments that exhibited polymorphism across five strains (i.e., the same SSR primer pair amplified the genomic DNA of five different strains, yielding a specific DNA fragment for each strain; and there were at least two different fragments among the specific DNA fragments amplified from the five strains). Simultaneously, the primers themselves should possess high specificity; furthermore, the primers should not easily form hairpin structures or primer dimers. For the final selected SSR primer pairs, the amplified DNA fragments (i.e., SSR sites) should be distributed as far as possible across different contigs of *Trichoderma pseudococcus* to avoid multiple primers binding to the same contig, thus preventing interference between primers.
[0078] The above steps screened out 39 SSR primer pairs, which correspond to 39 SSR loci, numbered LPS01 to LPS39. Using these selected SSR primer pairs, PCR was performed on the genomic DNA of 10 representative *Trichoderma pseudothecogenes* strains collected from different regions and hosts, exhibiting significant differences in pathogenicity and mating types. This was to verify whether the SSR primer pairs could amplify specific bands and whether these specific bands could be successfully sequenced.
[0079] Information on the 10 *Dioscorea pseudocacophonii* strains used in primer validation is shown in Table 2.
[0080] Table 2. Ten representative strains used for SSR primer validation.
[0081]
[0082] The agarose gel electrophoresis results of the amplification products obtained by PCR amplification of the genomic DNA of the above 10 strains of *Trichoderma pseudocaryophyllum* using some SSR primers are as follows: Figure 1 As shown in the figure, B represents the blank control and M represents the Maker. The figure demonstrates that not all designed SSR primer pairs amplify specific bands. Even if a particular SSR primer pair amplifies a specific band, the sequence of these specific bands (DNA fragments) does not necessarily exhibit polymorphism among the 10 strains. Furthermore, this polymorphism is not necessarily due to copy number differences of repeat units at the SSR site (it could also be due to SNP polymorphism or irregular additions or deletions, etc.).
[0083] Further analysis of the sequencing results is required. For a given SSR primer pair, amplifying the genomic DNA of 10 strains of *Trichoderma pseudococcus* is expected to yield 10 specific DNA bands (fragments). Sequence polymorphism among DNA fragments should primarily originate from SSR region polymorphism (i.e., differences in the number of repetitions of repeating units within the SSR region). Therefore, when analyzing the sequencing results, the 10 DNA fragments amplified by each SSR primer pair should be sequence-aligned to determine whether DNA sequence differences are primarily caused by variations in the SSR region. If the DNA sequence differences do not originate from the SSR region, the SSR primer pair should be discarded. Furthermore, if there is no significant polymorphism among the amplified DNA fragments, or if the differences are limited to the two sides of the DNA fragment (i.e., the head and the end), the corresponding SSR primer pair should also be discarded.
[0084] After the above screening process, 14 SSR primer pairs were finally obtained as shown in Table 3. Each SSR primer pair contains one forward primer and one reverse primer.
[0085] Table 3 14 SSR primer pairs
[0086]
[0087]
[0088] The reference sequence for the SSR locus corresponding to the SSR marker in the genomic DNA of *Trichoderma pseudococcus* (i.e., the *Trichoderma pseudococcus* whole genome sequence published at https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCA_033955225.1 / ) is as follows:
[0089] LPS 01_GGC_RIFT3495(SEQ ID NO.1):
[0090] ACCTCTCTGCAATACGAGCGGCGCGCCAGATTTTATTTTTGGGACCGCGCCAGGCCTTGCCGCTTGTTGCTCCGGAGAATTAAAGTAGGGGCGCGGGCGGCGGCGGCGGCGGCGGCGGGGGCGGGAAACCAAAGAATGCCCTAACCCACTGTTACTCTTCTTCCCCCCAAAAAAAGAAAGGGACCGATCTTTGTGCTGACTCGAAAATCTTTTCTTCTTTCTCGTGTAACAGTACCACAATGAGGGCGTCCTGAAGAAGTATGCGCCTAAGCTCAAGGTTGGCGAAGTCAAGGAGGAGGCTAAGCTATGATTGGGGGCTTGGACGGGACAAGAGAA
[0091] LPS 03_GTT_RIFT3495(SEQ ID NO.2):
[0092] GGGAAACAGCAAATCGCAGGACAGAGAGACATTCCCGTTCTCGTGTAGTCGTGTTTGTTTTTTTGGTAGGTGATGGACAGGTAGGTTGTTGTTGTTGTTGTTATAATCACTGGCACTTCCAGAATCTCCCAATCCTGGTCGTCGGCGCGGACTTGGGTCTCCGCTTCTCCTCGCACGCGTCATGGTCGTCCTCTTCGGGCACCTCGATGCGGTAGCGCCTCACGCTGCACGCGTCGTCGTCGTCGTTCTCGCCGTCGTAGAAA
[0093] LPS 04_GACC_RIFT3495(SEQ ID NO.3):
[0094] GATGTCACGATGCATGGTGCTGGCATTTACTGGCACCGCCCCGTTCCAGAGTAGTGAAGTCTGGTACGAGACCGACTAGGGTGTTTGCTGGCTTTGCATAACACACCTAGTGTAAGATGTACTGTGTAGCCTATAGTCTGACGACTGATCTTGAACTGACCGACTGACCGACTGACCGACCGACCGACCGCCGGCAGATCCGTCATGACCCCGGGAATTTATCCCCGGTCATCAACGATCCTCCTCAGCACGCCCCCGCGCACAGGAAGCAGATCAATCCTTCAGCTAACTTGTCGATTTCTTCGCAGATATGCCGAATTTTTTCTGCAGGATTCCTGAACTACCACCGCCCCCCTGCCCCGCCCGTCTCCACCGCCCGTCTCCACCGCCGTCGGATGGACCCGGGGCTGGGAAGGATGCATTGATCGAATAACAAGAGCCGAGGCTGGGCGATTGCTCGTGATGATG
[0095] LPS 08_GTG_RIFT3495(SEQ ID NO.4):
[0096] CGACGGAGGTGGAGATAACGACAGTGCCATTCGGGGACGATTCTGCAGCACGACATGATCATCGATGAGCAGTGGTGGTGGTGGTGAGAGACCGGAGCAAAAAAGTCCGTGTGGGGGCGGCCGGACCCACGCGGGTCAGCGAGAGGCAATTGCTGATCGCCGTTGACGCCTGCTAGCGAGGATGAAGTTGGTTAACGTTAGGGCACCGCTATTTCGAGACCCCTGGCCCGCCGCCCTCGCGTGGCTGGGGGGACGTGCTGACAGTCGTTA
[0097] LPS10_AAC_RIFT3495(SEQ ID NO.5):
[0098] TCAACATCCACCATCCACCGCCCACCACCACACGCGTCGACAAAGTTCTACGCACACTATGCACAGGTTTTGAACAAACTCCAGATGCGAAATTGACATTTCACTGACTAAATGAAAGCAGAATCTATTTGCGACCGAGGGCTGGTGCTTTCAGCAAATGCGAGGCTCGTGTGTTGTTGTCGCATGGACCGCGCGGGTTGTGAGCGATGCGAAGAGATGGAACAACAACAACAACAACGTTGGTTGAATGAACGATGAAGAAAAACGCCTCGCGAAAAGAAACACCAAGGCATCGCATCACGAACACCAAAATTTAGAGGAATTTCGCGAGCGAAAGTCCAGTTGTGAAGATACCGCTTGCTGCCAGAAGCTTAATTAAGGCCGGCGACCGAAAGCGAAGTACCACTCTCTAGCACTTTGCAGCTCCAAATCTTGCGCCGTTTCT
[0099] LPS13_GAG_RIFT3495(SEQ ID NO.6):
[0100] GGGGGAGAGGTTTGAGTTGGTGGAGCCGTGGGGTGGGCTGCACCCGCTGGAAGTGGTGGCGAGGGTGACGGAGGAGGATTTGGCGGTTTTGGTGCCGGGGAAGGGCGGGGATGGGGATGAGGAGGAGGAGGAGGAGTATGTGCTCAAGGCGGCGGTGAGCGCGTTTCCGGCGGGGTTTGATATACAAGAGAAGATGGATCAGCCGCTCACGGCAATCCACGAGCCGGTGCCGACGTACAAAGAGA
[0101] LPS 15_AAC_RIFT3495(SEQ ID NO.7):
[0102] TCCACCCCCTCTATAAGCCCCACGGGAGGCAAACTACGTAGTAGTATATAGACGAGGTAAAATCAAACAACAACAACAACCCACTCAGTCCTCATGCCACTCATTCAGTGCAAGACAATCACATCTCTTTTCATCGCCCAGTGCAACAGGTCGCCACTGAAGTAGAAGTTCCTGCG ACCTCTTAGTTCCATGACCTCTGGATGCGCCTCACCAACACGCTCCAGCTGGAGATTCAGCCGATCAAGACCACCCTGAACGAAAACATTGAGCAGCTTGCTAGCGTCTGCCGCGCTTAGGATCACATCCGCCAGAACCAGAAGCAGAACGTTGAGCGCCGCAAAAACACGACGTCTT
[0103] LPS 21_GCG_RIFT3495(SEQ ID NO.8):
[0104] CAAGTCTCATAGGGCAGGCCGCCGCTCCCGCTTTGTGGGAGGCCGTCATTCGCAGCCGCGTCTCGGATAATAATGGCCGTGTCCCGTGGCACCCCTCCCCTTCGCCCTTGCTTTTTGCTTCCCGCG GAGAACGTGGTTGCCCCTGTTTCTCCTGAAGAAACCATCACCTCACATGCGGCACGGCAACGTGGAGCGGCGGCGGCGGCGGCGGTGGTGGCTTTGGCTCATAACAGCAGAGTCACGCCATAGGAA
[0105] LPS 22_GTT_RIFT3495(SEQ ID NO.9):
[0106] GTTGTTGAACGACACGACCGACTCGCTCGACCACACGCGGCCGGCTTGGAGCGGGGGGTTGTTGTTGTTGTTGTTGTTGTTGCTGTCGCTGCTGCTTACCGCCGAGAATGGCTGTGAGGAAGACGGGACTGAGGTGTTGTTGTCATTGCTGCTGCTGCTGTAAGCAGGCGGTTCATCGGCGGGAAGCAGCGCCTTCGCGGCCGCCATCTGAGCTTCGAAGTCCTCGATGTGTTGCGCCACTAGCTGGTCGTGGCCGAGGCTGGGAAACGTCGGCGGGAAGGGTCCGGATGTCATG
[0107] LPS 23_AAAG_RIFT3495(SEQ ID NO.10):
[0108] TCATAATCGCAGCCACGAGCAAACAAAAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAAAAGGTGCCCATGCCACACTTCCTACGCCACACCGCAAAAACAGACTATTCTAGATCTTGCGCTACATATGAAAATGTAGCAGTCAACATCTGGACGGGCAGGAAATCTCACTGA
[0109] LPS 31_AAG_RIFT3495(SEQ ID NO.11):
[0110] CAACAAAAGGAAGCGTCCCGACGTGAAGTCAGGCGCAAAAGAAGAAAAAGAAGAAGAAGAAGAAGCATAAGAATAAAGTTTTGAAGGCTGCGTGACGGCCATTAGGGCGTAAGAAGGTTGTTGGTTGTTGTATGTAGATAGAGGTAAGGTAGTAGAGTAGGTAGGTAGGTAGTAGATAGGTAGACGTCAGATGAAGACTGATCTTTCGAAAAGAACAGAGCCATGAGAAAAACATGGCAGGATATCAAGAAAACAAATAACGAAACAGAAAAAGATTTCCCCAGGAAAAAAGATTCGATGCAGCCAACCAAGAAACTTTTCTTGAAAAAATGCCTCTTTTTACCTCGTATAAACCACTGCGAGCG
[0111] LPS 34_AAG_RIFT3495(SEQ ID NO.12):
[0112] GTAGACAGGTGCTCGTCTCGCGCATGCGCGACGGCACAGAGGTCAAGATGGACGCGCGGCGCTTGGAGCCGCTGATCGAAGCGTGCGTGAGGCGCGTTGCTGCTGCCGCGACGAGAAGAAAAGGCGCTGAGGGGGGAAAGGAGGAAAAGGAGGAGGAGGAGGAGGAGGAAGAAGAAGAAGAAGAAGAGGCTGTCGACGCGATCTTGCTGCTCTGCACGGGTGATGTGCCGGCGTTCGGGGCGGACCTGGGCGTGCCCGTTGTCGTGCCTCAGGACGCGGTGAGGCGGTTTATGGAGGAGAAGGGGGAAGGGAGAAAAAGGGCTTGGAAGTTAGTTCTTGTCAGCCCTGAGGAGCGGCAGGTTCAGGCGGCGCGGGGGCGGTGGGAGGGTGTGGGCGGGTGTGAAGTGCTTGGGGCGGCTGCGGCGACGCCGTATGGGGATGCGAGTAC
[0113] LPS 35_CGC_RIFT3495(SEQ ID NO.13):
[0114] TCGAGAATTCTGGATCGTGCGCGGCGCAAGCCCAGCTGAGAGCGCAAGGGACGAGACGAGACGAAAGTGGAGGCGAGAGTGGCCCACCGCGATGTGGTTCCGTTGGCGCGCACGGCCTGCTCGGCCGGGGTGGGGATGGGCCGGTCACCGCTCAACGGCGAATGTCGTCGCTGTCTGCCTGTCTGTCTGTCTGTCGTCGTCGTCGTCGCCGCCGCCGCCGCCGCCT TCGATCCGATCGCGCGTGGCGTGCCTCTCGAACGCCCTCTGCTGCGCTGCAAGCCAGCGCCCGAACTTGATGCGAGCGATAAGGGCGGCGTGGGCGCATCACGGCGAACCATTCCGGGAGATCCCCTTGGGCTGCTGGCTTCAGCTCTGTGCGTCAGCACTGGCCGTGGTGTCGCGCATCTGGGTCGCGGAAGGATCTGATGAGGTGGGCTTAGGGTGTTGGTGAA
[0115] LPS 39_GGA_RIFT3495(SEQ ID NO.14):
[0116] CCGCCAACTCGAAATACACCACCGCGGCGGAAGAGGAGGCAGTCGCTCGAGGCGGGCAAGGGCGATGGCGTCGGTCGGCGAAGAGCGCTGCCGTGCTGTCGACGTGGTGGGAGGAGGAGGAGGAGGAGGAGGAGCGGCG GCGGTCGGCTGCAGGAGGGGAAGGTGACACGCGGCGACGTTGCAGTTATCGAGGCGAAGAGAAAGTAGGTGAGAATGACCGACAAGCGCTGGGAGAGATGGAGGCGGAGCAGGTGGGCTTGCAGGGGAACGGTTGTGATA
[0117] Example 2: Population genetic analysis of forest canker pathogens based on SSR markers
[0118] In this embodiment, population genetic analysis was performed on 204 strains of *Trichoderma pseudococcosis* from five regions in southern China. The 204 strains came from Fujian (13 strains), Guangdong (90 strains), Guangxi Zhuang Autonomous Region (74 strains), Hainan (25 strains), and Yunnan (2 strains).
[0119] Using the 14 SSR primer pairs screened in Example 1, 204 PCR reaction systems were prepared for each SSR primer pair to amplify the corresponding SSR loci in the genomic DNA of 204 strains of *Trichoderma pseudococcidioides*. After PCR amplification, the length of the PCR product at each SSR locus was examined. The number of different lengths of the PCR product for a given SSR locus (mainly depending on the number of repetitions of the repeat unit) is considered the number of alleles present at that SSR locus. For a given strain, the allele composition at each SSR locus constitutes the SSR genotype result of that strain. Based on the allele composition at the SSR loci (SSR genotype results), genetic diversity analysis was performed on *Trichoderma pseudococcidioides* from five geographical populations.
[0120] Genomic DNA was extracted from *Trichoderma pseudococcus* using the CTAB method. The PCR reaction volume was 35 μL. Each PCR reaction volume contained 1 μL of *Trichoderma pseudococcus* genomic DNA (containing 100 ng DNA), 1 μL (0.01 mol / L) of forward primer, 1 μL (0.01 mol / L) of reverse primer, 18 μL of 2× High Fidelity PCR Master Mix (Sangon Reagent: NO. B639292), and 14 μL of RNase-free double-distilled water.
[0121] The PCR reaction procedure was as follows: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 1 minute, 55℃ annealing for 1 minute, 72℃ extension for 1 minute, for a total of 35 cycles; 72℃ final extension for 10 minutes.
[0122] After PCR, the PCR amplification products were sent to Sanger bidirectional sequencing (chain termination sequencing) by Sangon Biotech (Shanghai) Co., Ltd. The sequencing results were then edited and analyzed using MEGA 7. Based on the sequencing results (i.e., the base sequences of the PCR amplification products), the length of the PCR amplification product at each SSR locus was obtained, and the genotypes of each SSR locus in the 204 strains were statistically analyzed.
[0123] The number of alleles (Na), Simpson's index (λ), Nei's genetic diversity index (h), and the distribution index of different genotypes (Evenness) for each SSR locus were calculated using the R package v.3.6.33 and the poppr package. These four parameters can be collectively referred to as the genetic diversity index.
[0124] Table 4 Polymorphisms of 14 SSR loci
[0125]
[0126]
[0127] As shown in Table 4, PCR amplification of 14 SSR loci in the genomic DNA of *Trichoderma pseudococcus* using 14 SSR primer pairs yielded amplified products exhibiting good polymorphism. Each SSR locus contained 2 (LPS 35) to 10 (LPS 03) alleles, with an average of 5.214 alleles. The Simpson index (λ) ranged from 0.067 to 0.772, with an average of 0.514. The Nei's genetic diversity index (h) ranged from 0.067 to 0.776, with an average of 0.517. For each SSR locus, the Simpson index and Nei's genetic diversity index (h) were relatively close, with the lowest values for LPS01 and the highest for LPS03. The distribution index (Evenness) of different genotypes ranged from 0.401 to 0.976, with an average of 0.720. The lowest value corresponded to the SSR locus LPS 01, while the highest value was LPS 35.
[0128] Overall, the LPS01 locus has fewer alleles (3), resulting in the lowest values for the Simpson index (λ), Nei's genetic diversity index (h), and distribution index (E) for different genotypes (0.067, 0.067, 0.401, respectively). In contrast, the LPS03 and LPS39 loci have more alleles (10 and 9, respectively), and higher values for the other three genetic diversity indices: Simpson index (λ) of 0.772 and 0.75, Nei's genetic diversity index (h) of 0.776 and 0.753, and distribution index (E) of 0.784 and 0.789, respectively. These results indicate that the SSR loci developed in Example 1 exhibit high polymorphism and are suitable for population genetic diversity studies of *Trichoderma pseudococcus*. Furthermore, the SSR primer pair developed in Example 1 can effectively achieve specific amplification of the corresponding SSR loci in the genomic DNA of *Trichoderma pseudococcus*.
[0129] Furthermore, the cumulative genotype distribution curves of 204 strains of *Trichoderma pseudococcosis* were constructed using the R package v.3.6.33 and the poppr package, as shown below. Figure 2As shown in the figure, NumLoci represents the number of SSR loci (SSR primer pairs), MLG represents the number of genotypes, and the red dashed line indicates that the MLG discrimination rate is 100%. The 204 strains used in this example had a total of 156 genotypes at 14 SSR loci. The genotype numbers for the five geographical populations (Fujian FJ, Guangdong GD, Guangxi Zhuang Autonomous Region GX, Hainan HN, and Yunnan YN) were 12, 67, 53, 22, and 2, respectively. The number of genotypes in the population increased with the number of SSR loci, reaching its highest level (100%) when the number of SSR loci was 13. This indicates that the above SSR loci have high genotype diversity, and the corresponding number of SSR primer pairs (14) is sufficient for the genetic diversity study of the population composed of these 204 strains.
[0130] The genetic structure analysis of the population was performed using Structure v2.3.4 software. An admixture model was selected, with the burnin parameter set to 250,000 and the MCMC (Markov Chain Monte Carlo) parameter set to 1,000,000. K (number of clusters) was set from 1 to 10, and each K value was repeated 20 times. Following the methods described in Pritchard JK et al.'s 2000 paper "Inference of population structure using multilocus genotype data" and Falush D et al.'s 2003 paper "Inference of population structure using multilocus genotype data: linked loci and correlated allele frequencies," the optimal K value was calculated, and the final optimal K value was determined to be 2 (e.g., ...). Figure 4 (As shown). Figure 3 The results of the structure analysis are from... Figure 3 It can be seen that the 204 strains of *Trichoderma pseudococconiflorin* can be clearly divided into two major subgroups. In the figure, blue represents genetic subgroup 1, and orange represents genetic subgroup 2. The data are clonal correction data; 1 represents the Fujian population, 2 the Guangdong population, 3 the Guangxi Zhuang Autonomous Region population, 4 the Hainan population, and 5 the Yunnan population. This result further corroborates the high accuracy of the results obtained from the genetic analysis of *Trichoderma pseudococconiflorin* using the SSR loci (SSR primer pairs) developed in Example 1.
[0131] The results above indicate that the 14 SSR sites (14 SSR primer pairs) in Example 1 can be applied to cluster analysis and genetic diversity analysis of *Trichoderma pseudococcus*.
[0132] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of the claims of this patent application.
Claims
1. The application of a specific SSR primer set for *Pseudomonas aeruginosa*, characterized in that, The pathogen causing tree canker is *Dioscorea pseudoechocarpus*. Lasiodiplodia pseudotheobromae The SSR primer set contains 14 SSR primer pairs. in: The sequences of the two primers in the SSR primer pair used for specific amplification of LPS01 are shown in SEQ ID NO.15 and SEQ ID NO.16, respectively; The sequences of the two primers in the SSR primer pair used for specific amplification of LPS03 are shown in SEQ ID NO.17 and SEQ ID NO.18, respectively; The sequences of the two primers in the SSR primer pair used for specific amplification of LPS04 are shown in SEQ ID NO.19 and SEQ ID NO.20, respectively; The sequences of the two primers in the SSR primer pair used for specific amplification of LPS08 are shown in SEQ ID NO.21 and SEQ ID NO.22, respectively; The sequences of the two primers in the SSR primer pair used for specific amplification of LPS10 are shown in SEQ ID NO.23 and SEQ ID NO.24, respectively; The sequences of the two primers in the SSR primer pair used for specific amplification of LPS13 are shown in SEQ ID NO.25 and SEQ ID NO.26, respectively; The sequences of the two primers in the SSR primer pair used for specific amplification of LPS15 are shown in SEQ ID NO.27 and SEQ ID NO.28, respectively; The sequences of the two primers in the SSR primer pair used for specific amplification of LPS21 are shown in SEQ ID NO.29 and SEQ ID NO.30, respectively; The sequences of the two primers in the SSR primer pair used for specific amplification of LPS22 are shown in SEQ ID NO.31 and SEQ ID NO.32, respectively; The sequences of the two primers in the SSR primer pair used for specific amplification of LPS23 are shown in SEQ ID NO.33 and SEQ ID NO.34, respectively; The sequences of the two primers in the SSR primer pair used for specific amplification of LPS31 are shown in SEQ ID NO.35 and SEQ ID NO.36, respectively; The sequences of the two primers in the SSR primer pair used for specific amplification of LPS34 are shown in SEQ ID NO.37 and SEQ ID NO.38, respectively. The sequences of the two primers in the SSR primer pair used for specific amplification of LPS35 are shown in SEQ ID NO.39 and SEQ ID NO.40, respectively; The sequences of the two primers in the SSR primer pair used for specific amplification of LPS39 are shown in SEQ ID NO.41 and SEQ ID NO.42, respectively; In each SSR primer pair, the odd-numbered primers are the forward primers, and the even-numbered primers are the reverse primers; A specific SSR primer set for forest tree canker pathogens was used for genetic diversity analysis of the *Dioscorea pseudocarbazini* population.
2. The application according to claim 1, characterized in that, When using the SSR primer set specific to forest tree canker pathogens for genetic diversity analysis of *Trichoderma pseudocaryophyllum* populations, the following steps should be followed: S1. Isolate and purify the strains, and extract the genomic DNA of each strain of *Trichoderma pseudococcus*. S2. Obtain the genotypes of the SSR loci corresponding to the SSR primer pairs specific to forest tree canker in the genomic DNA of each strain of *Trichoderma pseudococcus*, and obtain the SSR genotype results. S3. Calculate the genetic diversity parameters of the population composed of *Trichoderma pseudococcus* based on the SSR genotype results.
3. The application according to claim 2, characterized in that, In step S2, the genomic DNA of *Trichoderma pseudococcus* is amplified by PCR using a specific SSR primer set for *Trichoderma pseudococcus*, and the length polymorphism of the PCR amplification product is detected to obtain the genotype of each strain of *Trichoderma pseudococcus* at the SSR site.
4. The application according to claim 1, characterized in that, When detecting the length polymorphism of PCR amplification products, chain termination sequencing is used to obtain the base sequence of the PCR amplification products, and the length polymorphism of the PCR amplification products is obtained based on the base sequence of the PCR amplification products.
5. The application according to claim 4, characterized in that, In step S2, for each strain of *Trichoderma pseudococcus*, a separate PCR reaction system is prepared for each SSR primer pair to perform PCR amplification.
6. The application according to claim 5, characterized in that, Each PCR reaction system contained: 100 ng of genomic DNA from *Trichoderma pseudococcosis* as a DNA template, 1 μL of 0.01 mol / L forward primer, 1 μL of 0.01 mol / L reverse primer, 18 μL of 2× high-fidelity PCR premix, and RNase-free double-distilled water; the volume of each PCR reaction system was 35 μL.
7. The application according to claim 6, characterized in that, In step S2, the reaction program for PCR amplification is as follows: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 1 minute, 55℃ annealing for 1 minute, 72℃ extension for 1 minute, for a total of 35 cycles; 72℃ final extension for 10 minutes.
Citation Information
Patent Citations
Citrus canker pathogen identification or traceability detection method, reagent and application
CN115820886A
Markers of plant health
WO2019055968A2