A SNP molecular marker related to corn plant height regulation and application thereof
By discovering SNP-25, 296, 496 sites on maize chromosome 1 and their associated gene Zm00001eb008340, the problems of insufficient applicability of molecular markers and insufficient gene mining in maize plant height genetic research have been solved, realizing an efficient and precise maize breeding method that is applicable to the efficient breeding of maize germplasm resources of different ecotypes.
Patent Information
- Application Number
- CN202510882966.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-28
- Publication Date
- 2026-02-24
- Estimated Expiration
- 2045-06-28
AI Technical Summary
Current technologies for genetic research on maize plant height suffer from limitations in the applicability of molecular markers and insufficient discovery of key regulatory genes, which affect breeding efficiency and effectiveness.
We discovered and validated SNP-25, 296, 496 on chromosome 1 of maize and its associated gene Zm00001eb008340. Through genome-wide association analysis and qRT-PCR, we verified its significant relationship with plant height, providing a precise molecular marker-assisted selection tool. Combined with gene editing technology, this enables efficient breeding.
It enables rapid screening of tall or short maize varieties, significantly shortens the breeding cycle, provides a breeding method that is stable in multiple environments, and is suitable for efficient breeding of maize germplasm resources of different ecotypes.
Smart Images

Figure CN120555644B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of agricultural biotechnology, and in particular to a SNP molecular marker related to the regulation of maize plant height and its application. Background Technology
[0002] Plant height is a key agronomic trait affecting maize yield and environmental adaptability. Appropriate plant height can improve lodging resistance, planting density, and harvest index, thereby promoting stable and increased maize yield. Maize is not only an important food crop worldwide but also a significant source of feed and industrial raw materials. Its high yield and wide adaptability make it a key crop in global agricultural production. However, compared to other food crops, maize plant height exhibits certain genetic variability. Therefore, breeders analyze the relationship between different maize genotypes and plant height to further develop tall or short-stalked maize varieties.
[0003] Although there have been studies on maize plant height genes, such as the Chinese patent CN201110333262.6 which discloses a SNP locus associated with maize plant height, the discovery of this locus provides an important basis for marker-assisted selection of plant height. However, maize plant height, as a complex quantitative trait, involves the synergistic regulation of multiple genes and environmental interactions. Existing research still has the following limitations: the applicability of known molecular markers is limited, and the discovery of key regulatory genes is insufficient.
[0004] In summary, improving maize plant height is an important goal in maize breeding and biotechnology improvement. Identifying functional genes related to maize plant height can provide technical support for molecular marker-assisted selection in breeding high-yielding maize. Summary of the Invention
[0005] To address the aforementioned issues, this invention provides a site on maize chromosome 1, Chr1: SNP-25,296,496, which is significantly associated with regulating plant height. This site was discovered through genome-wide association study (GWAS), which further identified the functional gene Zm00001eb008340 that regulates maize plant height. qRT-PCR results also showed that the expression level of this gene was significantly increased in the internodes at the V14 stage of all four parents, further validating the relationship between this molecular marker and plant height.
[0006] This invention is the first to discover that the SNP locus (Chr1:SNP-25,296,496) and its associated gene Zm00001eb008340 are novel targets for regulating maize plant height; a significant association between this locus and plant height was detected in three different environments. This provides a precise tool for marker-assisted breeding (such as MAS and MABC), enabling efficient selection of tall / dwarf varieties.
[0007] To achieve the above objectives, the present invention provides the following technical solution:
[0008] This invention provides a SNP molecular marker related to the regulation of maize plant height. The SNP site is located on maize chromosome 1, Chr1:SNP-25,296,496, and its molecular marker sequence is shown in SEQ ID NO:1, wherein the 201st base exhibits C / T polymorphism.
[0009] As a further supplement to the above scheme: when the genotype at the 201st site of the molecular marker is CC, maize exhibits the dwarf trait; when the base mutation is TT, maize exhibits the tall trait.
[0010] The present invention also provides a kit for detecting the SNP molecular marker, the kit comprising primers, probes or sequencing reagents for detecting the SNP site.
[0011] Preferably, the primer sequences are shown in SEQ ID NO:4 (front primer) and SEQ ID NO:5 (back primer). These primers have high specificity and can efficiently amplify molecular marker fragments.
[0012] The present invention also provides a method for regulating maize plant height by using gene editing technology to mutate the 201st base of the sequence shown in SEQ ID NO:1 from C to T to obtain a maize variety with a suitable height.
[0013] The gene editing technology mentioned is CRISPR / Cas9, CRISPR / Cas12a, TALEN, PE (Prime Editors), or ZFN. That is, in some specific embodiments, the gene editing tool can be existing technology tools such as the CRISPR / Cas9 system, the CRISPR / Cas12a system, Prime Editors (PE), ZFN technology (Zinc Finger Nucleases), and TALEN technology (Transcription Activator-Like Effector Nucleases).
[0014] The present invention also provides a maize plant height regulatory protein associated with the SNP molecular marker, the amino acid sequence of which is shown in SEQ ID NO:3.
[0015] The present invention also provides a gene encoding the protein, the nucleotide sequence of which is shown in SEQ ID NO:2. The expression level of the protein or gene is positively correlated with maize plant height growth.
[0016] The present invention also provides the application of the SNP molecular marker, the protein or the gene in marker-assisted breeding of maize, including: screening of tall or short maize varieties, genome-wide selection (GS) breeding or gene editing breeding.
[0017] Its applications include, but are not limited to: using this molecular marker for breeding strategies such as marker-assisted selection (MAS), marker-assisted backcross (MABC), genotype selection (GS), and / or genome-wide selection (GWS) of maize varieties to efficiently and accurately breed new tall or short maize varieties; it can also be used for the evaluation and screening of plant height traits of maize germplasm resources.
[0018] The present invention also provides a method for identifying or assisting in the identification of maize plant height based on the aforementioned molecular markers, comprising the following steps:
[0019] DNA was extracted from the corn sample to be tested;
[0020] Genotyping of Chr1 at SNP-25, 296, and 496 loci;
[0021] If the genotype at the 201bp site of the molecular marker is TT, it is determined to be tall maize; if it is CC, it is determined to be short maize.
[0022] In some specific embodiments, the product for detecting the molecular marker of the SNP site can be a detection product designed for the site described in this invention based on known single nucleotide polymorphism (SNP) detection methods such as Sanger sequencing, TaqMan probe method, ARMS-PCR (Amplification Refractory Mutation PCR), KASP (Kompetitive Allele-Specific PCR) method.
[0023] The features of this invention are as follows: This invention discovers a SNP molecular marker (Chr1:SNP-25,296,496) on maize chromosome 1 that is associated with plant height regulation, the sequence of which is shown in SEQ ID NO: 1. The base polymorphism (C / T) at this site is significantly correlated with maize plant height: when the genotype is CC, maize exhibits short stalks; when the genotype is TT, maize exhibits tall stalks. By detecting this SNP site, it is possible to assist in the breeding of tall or short maize varieties.
[0024] This invention uses the dwarf inbred line Ye107 as the male parent and crosses it with five different ecotypes of maize (one temperate and four tropical / subtropical) to construct a multi-parent population (917 recombinant inbred lines) with significant differences in plant height. Genome-wide association analysis (GWAS) and linkage analysis were used to locate SNPs 25, 296, and 496, and QTL intervals verified the reliability of this locus. qRT-PCR showed that Zm00001eb008340 was expressed at a significantly higher level in the tall parent than in the dwarf parent. This invention also discovered that the gene Zm00001eb008340 (encoding ubiquitin C-terminal hydrolase 26) associated with this SNP was positively correlated with plant height, especially showing high expression during the growth stage of maize V14. Primers and kits for detecting this gene or protein (such as primers shown in SEQ ID NO: 4 and SEQ ID NO: 5) are provided.
[0025] Compared with the prior art, the present invention has the following beneficial effects:
[0026] 1. Precision breeding technology: This invention provides a SNP molecular marker (Chr1:SNP-25,296,496) that is significantly associated with maize plant height. It can rapidly screen tall or short varieties by detecting C / T polymorphism, significantly shortening the breeding cycle.
[0027] 2. Functional gene verification: This invention is the first to discover and verify that the gene Zm00001eb008340 (encoding ubiquitin carboxyl-terminal hydrolase) affects plant height by regulating the auxin signaling pathway, providing a new target for molecular design breeding.
[0028] 3. Multi-environment stability: This invention uses GWAS and QTL combined analysis to confirm that the site is stably associated in three environments (PVE of 3.59%), overcoming the limitations of single methods and providing highly reliable results.
[0029] 4. Development of efficient tools: Matching kits and gene editing methods (such as CRISPR targeted mutations) can achieve targeted improvement of maize plant height, and are suitable for molecular marker-assisted selection (MAS) and genotype selection (GS).
[0030] 5. Wide applicability: Applicable to temperate and tropical / subtropical maize germplasm resources, and can be flexibly used for breeding high-density lodging-resistant dwarf varieties or high-stem varieties with increased biomass yield. Attached Figure Description
[0031] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0032] Figure 1A pedigree of NAM populations with significant differences in plant height was constructed by crossing five tropical / subtropical / temperate parents with the superior temperate dwarf parent Ye107.
[0033] Figure 2 Scatter plots showing the frequency distribution and correlation matrix of plant height phenotype in multi-parent populations under three different environments;
[0034] Figure 3 For (A) SNP label density heatmap; (B) phylogenetic tree of multi-parent population; (C) three-dimensional principal component analysis (PCA) plot; (D) linkage disequilibrium (LD) decay plot;
[0035] Figure 4 Manhattan plot (left) and QQ plot (right) for analyzing significant SNPs related to maize plant height using GWAS under different environments. (A) 21 Jinghong environment, (B) 22 Yanshan environment, and (C) 23 Yanshan environment, and (D) BLUP ("Best Linear Unbiased Prediction") environment.
[0036] Figure 5 The overlapping of SNPs and QTL intervals significantly associated with maize plant height, identified by GWAS and QTL mapping, is shown. The red line represents the QTLs identified in the 21 Jinghong environment, and the blue line represents the colocalization of SNPs identified by GWAS in the 21 Jinghong, 22 Yanshan, and 23 Yanshan environments and BLUP analysis.
[0037] Figure 6 The relative expression levels of the Zm00001eb008340 gene at different stages are shown. A represents the growth and development dynamics of the 7th intersegment in the five parents at four stages (V8, V14, VT, R3). B represents the relative expression level of the Zm00001eb008340 gene in the five parents. The symbol ** indicates... P Significance at < 0.005, *** indicates P The significance of < 0.001, where ns indicates that the difference is not significant. Detailed Implementation
[0038] To further illustrate the present invention, the following description, in conjunction with the accompanying drawings and embodiments, details the molecular marker site Chr1 (SNP-25,296,496) on maize chromosome 1 that regulates plant height, as well as the Zm00001eb008340 gene or protein associated with this site and their applications. However, these descriptions should not be construed as limiting the scope of protection of the present invention.
[0039] This invention provides a molecular marker site Chr1 (SNP-25,296,496) on chromosome 1 of maize, which is a reference site in genome B73 (RefGen_v5). In some specific embodiments, for the detection of this SNP site, this invention provides a molecular marker sequence as shown in SEQ ID NO: 1. As shown in SEQ ID NO: 1, the sequence exhibits C / T polymorphism at the 201 bp site from the 5' end. Those skilled in the art can design corresponding products for detection using the sequence shown in SEQ ID NO: 1 provided by this invention and employ detection methods known in the art. Based on the detection results, if the genotype at this site is detected as TT, the maize sample to be tested is determined to be a maize variety with suitable height.
[0040] In another aspect, this invention utilizes GWAS and linkage analysis to locate Chr1: SNP-25,296,496, which is significantly associated with regulating plant height on chromosome 1. This leads to the discovery of the functional gene Zm00001eb008340, which regulates maize plant height. The amino acid sequence of the Zm00001eb008340 protein is shown in SEQ ID NO: 3, and the gene sequence encoding this protein is shown in SEQ ID NO: 2. qRT-PCR results show that the expression level of this gene was significantly increased in the internodes of the four parents at stage V14, indicating a positive correlation between the expression level of this gene or protein and the regulation of maize plant height. In some specific embodiments, those skilled in the art can design corresponding detection products based on the sequences provided by this invention, such as those shown in SEQ ID NO: 2 or SEQ ID NO: 3, to screen for tall or short-stalked, high-yielding maize varieties based on the expression level of Zm00001eb008340.
[0041] The present invention also provides a kit for detecting the SNP molecular marker, the kit comprising primers, probes or sequencing reagents for detecting the SNP site, the primer sequences being shown in SEQ ID NO:4 (front primer) and SEQ ID NO:5 (back primer).
[0042] The SNP locus of this invention is defined as follows: The SNP locus located at 25,296,496 bp on chromosome 1 of the maize B73 reference genome (RefGen_v5) is named Chr1: SNP-25,296,496. This locus is a C / T polymorphism (reference allele C, variant allele T).
[0043] The gene Zm00001eb008340 is named according to the B73 RefGen_v5 genome annotation, MaizeGDB database ID: Zm00001eb008340; Zm = maize, 00001eb = genome version identifier, 008340 = gene ID.
[0044] The abbreviations used in the following examples have the following meanings: GWAS (Genome-Wide Association Study); QTL (Quantitative Trait Locus); RILs (Recombinant Inbred Lines); LD (Linkage Disequilibrium); PCA (Principal Component Analysis); MLM (Mixed Linear Model); qRT-PCR (Quantitative Real-Time PCR); SNP (Single Nucleotide Polymorphism).
[0045] Example 1
[0046] 1 Experimental Methods
[0047] 1.1 Plant Materials and Experimental Design
[0048] This study used five maize backbone inbred lines (YML32, CML171, TML418, NK40-1, and Chang7-2) as female parents and Ye107, a temperate maize dwarf inbred line with high density tolerance and high combining ability, as the male parent to obtain F1 hybrids. Seven generations of self-pollination were performed on the F1 plants using the single-seed transfer method, constructing a multiparental population consisting of five subpopulations: Population 1 (YML32 × Ye107), Population 2 (CML171 × Ye102), Population 3 (TML418 × Ye102), Population 4 (NK40-1 × Ye107), and Population 5 (Chang7-2 × Ye107), containing a total of 917 F8 RILs (…). Figure 1The distribution was as follows: Group 1 (173 individuals), Group 2 (190 individuals), Group 3 (176 individuals), Group 4 (180 individuals), and Group 5 (198 individuals). The parents and recombinant inbred lines of these multi-parent groups were planted in Jinghong City, Yunnan Province (N 21°27′~22°36′, E 100°25′~101°31′, altitude 552.7m) in 2021, and in Yanshan County, Yunnan Province (N 23°60′, E 104°4′, altitude 1572m) in 2022 and 2023, respectively. This experiment used a randomized complete block design (RCBD), with three biological replicates for each environment. Each experimental plot had a row length of 3.5 meters, a row spacing of 70 centimeters, a plant spacing of 25 centimeters, and 14 plants per row. Twenty days after flowering, 5-10 plants were randomly selected from each plot to measure the plant height from the ground to the tip of the tassel, expressed in centimeters (cm). The pedigree, heterosis groups, and ecotypes of the six parents are shown in Table 1.
[0049] Table 1 Parental Information
[0050]
[0051] 1.2 Heritability Analysis
[0052] After systematically organizing and quality-controlling the phenotypic data collected over three consecutive years, statistical analysis was performed on the data using SPSS (SPSS Statistics 26). This included calculating the mean, minimum, maximum, standard deviation, coefficient of variation, skewness, and kurtosis, and using kurtosis and skewness to assess the normality of the phenotypic data. Pearson correlation coefficient analysis and the creation of correlation graphs were performed using Origin (Origin 2022) software. Generalized heritability was calculated following the method of Knapp et al.
[0053] 1.3 DNA extraction and genome sequencing
[0054] Genomic DNA was first extracted from F8 RILs maize seedlings using the cetyltrimethylammonium bromide (CTAB) method. DNA purity was assessed using a nanophotometer (IMPLEN, CA, USA), and DNA concentration was measured using the Qubit™ DNA Assay Kit and a Qubit 2.0 fluorometer (Life Technologies, USA, Grand Island, NY, USA). For library preparation, 1.5 µg of high-quality DNA was processed from each sample using the TruSeq NanoDNA HT Sample Preparation Kit (Illumina, USA). DNA fragmentation to an average size of 350 bp was performed by sonication, followed by end repair, 3′ adenylation, and Illumina adapter ligation. Adapter-ligated DNA was amplified by polymerase chain reaction (PCR), and the resulting library was purified using the AMPure XP system. Fragment size distribution was validated using an Agilent 2100 bioanalyzer, and quantification was performed by real-time PCR. Sequencing was performed on an Illumina NovaSeq 6000 platform, producing 150 bp paired-end sequencing data with an insert length of 350 bp. Raw sequencing data underwent quality control (QC) filtering. The clean reads were aligned with the reference genome B73 (RefGen_v5) using BWA (Burrows-Wheeler Aligner) software to identify all genome-wide genetic variations. SNPs were then retrieved using Genome Analysis Toolkit software, with PLINK v1.9 used to filter SNPs with parameters set to -geno 0.2 and -maf 0.05, removing SNPs with a deletion rate greater than 10% and a minimum allele frequency (MAF) less than 5%. Finally, the selected SNPs were functionally annotated using ANNOVAR software.
[0055] 1.4 Phylogenetic Tree, PCA, and Linkage Disequilibrium Analysis
[0056] The distance matrix was calculated using the maximum parsimony (MP) method to construct a phylogenetic tree. Principal component analysis (PCA) was performed using GCTA software, and cluster analysis was conducted using the GAPIT package in R software. The PCA results were then visualized using scatter plots. The linkage disequilibrium (r) between pairwise SNP markers across the entire genome was calculated using PopLDdecay software. 2 The LD attenuation analysis results were visualized using the software's built-in script, Plot_OnePop.pl. Based on the LD attenuation pattern, the required number of markers for GWAS and its detection efficiency were further evaluated.
[0057] 1.5 Genome-wide association analysis
[0058] After sequencing with Illumina NovaSeq 6000, the BAM files were processed, and then a genome-wide association study (GWAS) of plant height was conducted using a mixed linear model (MLM) in GEMMA software. During GWAS analysis, individual kinship and population stratification were the main factors causing false positives. Therefore, this study used MLM for marker-trait association analysis, treating population genetic structure as a fixed effect and individual kinship as a random effect to correct for the influence of population structure and individual kinship. Minor allele frequency (MAF) > 5% and r were used as the marker-trait association factors. 2 SNPs associated with plant height were screened using a plink-indep-pairwise parameter of <0.2. The statistical significance threshold of -log10(p) > 6 was calculated using the formula −log10(1 / total number of SNPs), and SNPs significantly associated with pH were identified based on this threshold. Quantile-quantile (QQ) plots and Manhattan plots were then constructed using R software (v4.3.3). Significant SNP sites were further screened using Bed Tools v1.7. Based on the B73 v5 reference genome and annotation information, candidate genes associated with plant height were identified within a 20kb range upstream and downstream of significant SNPs.
[0059] 1.6 Construction of genetic linkage maps
[0060] Linkage maps were constructed using JoinMap 4.0 software, and the LOD threshold was determined using a 1000-permutation test. A QTL was considered significant if the LOD threshold was ≥2.5. Linkage groups were defined based on an LOD threshold ≥2.5, and genetic linkage maps were constructed using eligible SNP markers. Genotyping filtering of progeny markers was performed based on a 0.8 integrity score and a 0.001 partial segregation score, resulting in six population markers. Binary markers were then plotted every 15 non-linked markers within each population to obtain the final population markers. JoinMap 4.0 was used to sort the binary markers for each population, and the Kosambi function was used to calculate the genetic distance (cM) between markers.
[0061] 1.7 QTL Positioning Analysis
[0062] QTL mapping was performed using the Composite Interval Mapping (CIM) method in Windows QTL Cartographer 2.0. Phenotypic data of plant height were integrated into a high-density genetic linkage map, excluding SNP markers with a deletion rate ≥0.2 and loci with minor allele frequencies below 0.05. A 0.21 cM threshold was used to identify parental polymorphic QTLs. Thresholds were determined using 1000 random permutations with 95% confidence intervals. The LOD threshold associated with flanking markers was set to 2.5 to identify QTLs regulating plant height.
[0063] 1.8 Identification and Functional Annotation of Candidate Genes
[0064] By integrating GWAS and QTL mapping results, the physical locations of significant SNPs identified by GWAS were compared with QTL intervals. The BLAST function in MaizeGDB was used to determine the physical locations of significant SNPs. Candidate genes regulating plant height were identified within 20kb regions upstream and downstream of these significant SNPs. Functional annotation of the identified genes was performed using the NCBI, MaizeGDB, InterPro, and UniProt databases to identify candidate genes involved in plant height regulation.
[0065] 1.9 Relative expression analysis of candidate genes in parents
[0066] This invention involved sampling the middle of the 7th internode of five parental lines at four developmental stages: the 8-leaf stage (V8), rapid growth stage (V14), tasseling stage (VT), and milk stage (R3). Total RNA was extracted using the Tiangen RNAprep Pure Plant Kit, and genomic DNA removal and cDNA synthesis were performed using the FastKing RT Kit (With gDNase). The relative expression levels of four candidate genes in the five parental lines were determined using real-time quantitative PCR (qRT-PCR) based on the Tiangen SuperReal PreMix Plus (SYBR Green) kit (Tiangen, Beijing). The maize actin 1 gene was used as an internal control gene (primer sequences: SEQ ID NO.6 F-5'TACGAGATGCCTGATGGTCAGGTCA, SEQ ID NO.7 R-5'TGGAGTTGTACGTGGCCTCATGGA). The qRT-PCR procedure and system were strictly performed according to the standardized protocol used by Bi et al. Three technical replicates were set for each sample, and the relative expression levels of the genes were calculated using the method.
[0067] 2. Experimental Results
[0068] 2.1 Plant height phenotypic analysis
[0069] Preliminary statistical analysis of plant height phenotypic data from five RIL subpopulations revealed significant differences between the plant height of all maternal parents (156.0–216.0 cm) and the pH of the paternal parent Ye 107 (155.0 cm). The plant height of the RIL population also exhibited wide phenotypic variation. Figure 1 Descriptive statistics were performed on the plant height phenotypic data of the five RILs populations, as shown in Table 2. Population 4 had the highest plant height, ranging from 116.0 to 253.0 cm, with a mean of 190.0 cm. The coefficients of variation in the three environments were 13.6%, 13.2%, and 13.1%, respectively. Population 5 had the lowest mean plant height, at 164.4 cm, ranging from 82.0 to 258.0 cm, but exhibited the greatest variation, with coefficients of variation reaching 18.9%-19.2% across the three environments, indicating richer phenotypic variation. Frequency distribution analysis of the plant height phenotypic data showed that the absolute values of skewness and kurtosis for all populations in different environments were less than 1, conforming to normal distribution characteristics (Table 2). Figure 2 This satisfies the prerequisites for quantitative trait genetic analysis. The broad-sense heritability of plant height in populations 1-5 were 97.9%, 96.9%, 98.3%, 97.5%, and 96.2%, respectively. Furthermore, Pearson correlation analysis (p < 0.05 significance level) showed a highly significant positive correlation (0.94-0.97) between plant height of RILs in the same population across the three different environments. Figure 2 This indicates that maize plant height is mainly regulated by genetic factors and is less affected by the environment.
[0070] Table 2. Descriptive statistical analysis of plant height in multi-parental populations
[0071]
[0072] 2.2 Phylogenetic tree analysis, principal component analysis (PCA), and linkage disequilibrium analysis
[0073] Whole-genome resequencing (WGS) was used to scan the entire maize genome, identifying 6,389,682 high-quality SNPs distributed across all 10 chromosomes. The SNP marker density heatmap showed that the number of SNPs on chromosomes 1-10 were 891,814, 699,810, 717,023, 880,707, 669,104, 485,237, 564,060, 545,295, 473,708, and 462,924, respectively. Chromosome 1 had the highest number of SNPs, while chromosome 10 had the lowest. Figure 3A). Phylogenetic analysis showed that the phylogenetic tree constructed using the neighbor-joining method could be divided into 5 significantly different subpopulations ( Figure 3 B). The results of PCA are highly consistent with phylogenetic classification, showing five distinct subgroups ( Figure 3 C). Using 6,389,682 high-quality SNPs for LD attenuation analysis, it was found that when r 2 When the LD decays to the plateau threshold, the physical distance of LD decay is approximately 20 kb. Figure 3 D). Based on this characteristic, the present invention screens candidate genes within a 20 kb range upstream and downstream of significant SNPs.
[0074] 2.3 Discovery and Validation of Molecular Markers
[0075] 2.3.1 Genome-wide association analysis of pH in multi-parent populations
[0076] Based on phenotypic data of 917 F8 RILs and 6,389,682 high-quality SNPs from a multi-parental population, a mixed linear model (MLM) was used for GWAS analysis. Under a significance threshold of −log10(p) > 6, several SNPs significantly associated with plant height were detected, among which Chr1: SNPs-25,296,496 were detected in all environments (21 Jinghong, 22 Yanshan, 23 Yanshan, and BLUP). Figure 4 Furthermore, SNPs 25, 296, and 496 showed high p-values (6.95-7.56), explaining 3.07%-3.59% of the phenotypic variation. This locus provides important clues for further exploration of candidate genes regulating maize plant height. Since artificial populations may cause false positives in GWAS analysis, this study will use QTL analysis to further validate the molecular markers identified by GWAS to improve the accuracy of identification.
[0077] 2.3.2 QTL localization verification of GWAS results
[0078] Using plant height phenotypic data from different populations under various environments, combined with a constructed high-density genetic map, QTL mapping for maize plant height was performed. The mapping results were compared with GWAS analysis results. Ultimately, under the 21 Jinghong environment, the QTL qPH1-1 interval was identified from the NK40-1×Ye107 population, explaining 6.35% of the phenotypic variation; this QTL interval includes the Chr1:SNP-25,296,496 loci identified by GWAS. Figure 5 This indicates that the molecular marker Chr1:SNP-25,296,496 sites discovered by GWAS analysis were validated by QTL mapping, confirming that this is the same key site.
[0079] 2.4 Identification and functional verification of candidate genes related to plant height regulation
[0080] 2.4.1 Identification of candidate genes
[0081] This invention uses the B73_RefGen_v5 reference genome to screen for candidate genes regulating maize plant height within a 20kb range upstream and downstream of the significant site Chr1: SNP-25,296,496 in the qPH1-1 region, and performs functional annotation of the candidate genes using databases such as Maize GDB, InterPro, UniProt, and NCBI. This invention identified two candidate genes (Zm00001eb008340) significantly associated with regulating maize plant height within a 20kb range upstream and downstream of SNP-25,296,496. Gene functional annotation shows that candidate gene Zm00001eb008340 encodes ubiquitin C-terminal hydrolase 26 (UCH26). In Arabidopsis, UCH1 and UCH2 regulate auxin-dependent developmental pathways through their deubiquitinating enzyme activities. Specifically, these two enzymes directly affect the deubiquitination of ubiquitin substrates during auxin signal transduction by regulating the protein turnover of AXR3, a key regulator in the auxin response pathway, and may thus participate in the regulation of maize plant height growth and development.
[0082] 2.4.2 Relative expression level of Zm00001eb008340 in parental materials (qRT-PCR verification)
[0083] To investigate the regulatory effect of the candidate gene Zm00001eb008340 on maize plant height, qRT-PCR was used to analyze the expression patterns of five parents at four different developmental stages of maize. Internode length measurements showed that the internode length of parent NK40-1 was the longest at all stages, while Ye107 maintained the shortest. Figure 6 A). Therefore, the dwarf parent Ye 107 was used as a reference. Analysis showed that the expression level of gene Zm00001eb008340 in parents YML 32, CML171, TML418, and NK40-1 significantly increased from V8 to V14, with V14 being the most critical period for stem growth and development. Furthermore, the relative expression level of gene Zm00001eb008340 in NK40-1 and CML171 was significantly higher than that in YML32 and TML418 (…). Figure 6 (B) This expression pattern is consistent with the pH size distribution trend of NK40-1 and CML171, indicating that the gene Zm00001eb008340 has a positive regulatory effect on maize plant height. This was further verified by qRT-PCR, confirming its involvement in the regulation of plant height.
[0084] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A kit for detecting SNP molecular markers related to the regulation of maize plant height, characterized in that, The kit contains primers, probes, or sequencing reagents for the specific detection of SNP sites; the primer sequences are shown in SEQ ID NO: 4 and SEQ ID NO: 5; The SNP site is located at 25,296,496 bp on chromosome 1 of the RefGen_v5 reference genome of maize B73, and is named Chr1: SNP-25,296,496. The SNP site is a C / T polymorphism.
2. The application of Zm00001eb008340 gene expression level in the auxiliary identification of maize plant height, characterized in that... The procedure is as follows: Obtain internode tissue samples from maize plants during the rapid vegetative growth stage V14; detect the expression level of gene Zm00001eb008340 in the samples, and assess the plant height potential of maize plants based on the expression level. The expression level of the gene is positively correlated with the plant height of maize plants; the nucleotide sequence of the gene is shown in SEQ ID NO:
2.
3. The application according to claim 2, characterized in that, Includes the following steps: (a) Obtain internode tissue samples from maize plants during the rapid vegetative growth stage V14; (b) Detect the expression level of gene Zm00001eb008340 in the sample; (c) The expression level is compared with the expression level of a control inbred line, namely maize inbred line Ye107; Specifically, an expression level higher than that of the control inbred line indicates that the plant has the potential for tall stature; an expression level lower than that of the control inbred line indicates that the plant has the potential for short stature.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) locus related to maize plant high character
CN102373278A