Application of RGS14 expression promoter in preparation of medicine for preventing and / or treating myocardial infarction

By using RGS14 expression promoters, overexpressing RGS14 gene and protein, the anti-inflammatory and anti-apoptotic problems in myocardial infarction are solved, the protection and survival of cardiomyocytes are achieved, and the therapeutic effect of myocardial infarction is improved.

CN120571016APending Publication Date: 2025-09-02HUANGGANG CENT HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410233954.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-03-01
Publication Date
2025-09-02

AI Technical Summary

Technical Problem

The prior art lacks effective anti-inflammatory and anti-apoptotic treatment strategies in the prevention and treatment of myocardial infarction, resulting in an increase in the number of patients with heart failure and a poor prognosis of treatment.

Method used

RGS14 expression promoters, including RGS14 gene and protein, are used to overexpress RGS14 gene through recombinant vectors or recombinant viruses, to enhance the activity of RGS14 protein, inhibit cardiomyocyte apoptosis, reduce cardiomyocyte apoptosis, and improve myocardial infarction.

Benefits of technology

Overexpression of RGS14 can inhibit cardiomyocyte apoptosis, reduce cardiomyocyte damage, improve myocardial infarction, promote cardiomyocyte survival, and reduce the damage to cardiomyocytes by hypoxia and sugar stimulation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120571016A_ABST
    Figure CN120571016A_ABST
Patent Text Reader

Abstract

The invention provides an application of an RGS14 expression promoter in preparation of a medicine for preventing and / or treating myocardial infarction. Researches find that the RGS14 gene can improve myocardial infarction and is closely related to myocardial cell apoptosis. Overexpression of the RGS14 can inhibit apoptosis of myocardial cells and promote survival of the myocardial cells, which indicates that the RGS14 gene and the RGS14 expression promoter can be used for preparing medicines for preventing, relieving and / or treating myocardial infarction diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to use of an RGS14 expression promoter in preparing a medicament for preventing and / or treating myocardial infarction. Background Art

[0002] Myocardial infarction (MI), caused by thrombosis or vascular occlusion, is the leading cause of morbidity and mortality among all cardiovascular diseases. Following acute MI, loss of myocardial viability triggers a series of molecular and cellular remodeling reactions and triggers a series of repair events, including inflammation, hypertrophy, fibrosis, and the formation of discrete collagen scars. The inflammatory response of cardiomyocytes during persistent myocardial ischemia can directly lead to cardiomyocyte apoptosis. Persistent inflammation and cardiomyocyte apoptosis can severely impair cardiac function. MI can lead to left ventricular remodeling, ventricular dilatation, cardiac dysfunction, and ultimately, chronic heart failure and death. In recent decades, advances in coronary intervention and drug therapy have significantly reduced the morbidity and mortality of patients with acute MI. However, due to the massive cardiomyocyte death associated with the onset of heart failure, the number of patients with subsequent heart failure has increased, and the prognosis is poor. Therefore, further understanding of the pathogenesis and progression of MI and the exploration of novel anti-inflammatory and anti-apoptotic therapeutic strategies are crucial for the prevention and treatment of MI and its subsequent heart failure. Therefore, there is an urgent need to develop effective drugs for preventing and / or treating myocardial infarction.

[0003] Regulators of G-protein signaling (RGS) are a family of approximately 20 proteins. Almost all RGS proteins are guanosine triphosphatase (GTPase) activators that negatively regulate signal transduction. To date, at least 20 RGS proteins have been identified in cardiomyocytes and fibroblasts. They are involved in various cardiac pathophysiological processes, such as arrhythmias, heart failure, and hypertension. As a key member of the RGS family, RGS14 possesses multiple signaling regulatory elements. It contains a typical RGS domain, a GoLoco / G protein regulatory motif, and two tandem Ras / Rap binding domains. A previous study demonstrated that RGS14 can influence chemokine recruitment of lymphocytes by regulating chemokine receptor expression, thereby affecting lymphocyte adhesion and migration. Studies have also shown that RGS14 can regulate the MAPK signaling pathway and inhibit pathological cardiac remodeling by modulating the MRK / ERK1 / 2 signaling pathway. In a liver ischemia-reperfusion model, RGS14 was shown to suppress hepatic inflammation and apoptosis. However, the role of RGS14 in myocardial infarction has not been reported. Summary of the Invention

[0004] The present invention aims to provide the use of an RGS14 expression promoter in the preparation of a medicament for preventing and / or treating myocardial infarction. Experiments in the present invention have found that overexpression of RGS14 can inhibit cardiomyocyte apoptosis and promote cardiomyocyte survival. In a myocardial infarction model, RGS14 has the effects of inhibiting cardiac inflammation, reducing cardiomyocyte apoptosis, and improving myocardial infarction. Therefore, the RGS14 expression promoter can be used to prepare a medicament for preventing and / or treating myocardial infarction.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions:

[0006] In a first aspect of the present invention, there is provided the use of the RGS14 gene as a target gene in screening drugs for preventing, alleviating and / or treating myocardial infarction. The screening method includes screening for substances that can promote the expression of the RGS14 gene.

[0007] In a second aspect of the present invention, there is provided the use of RGS14 protein as a target in screening drugs for preventing, alleviating and / or treating myocardial infarction, wherein the screening method includes screening for substances that can enhance the activity of RGS14 protein.

[0008] In a third aspect of the present invention, provided is the use of RGS14 protein in the preparation of a medicament for preventing and / or treating myocardial infarction.

[0009] In a fourth aspect of the present invention, there is provided use of a substance that promotes RGS14 gene expression in the preparation of a drug for preventing, alleviating and / or treating myocardial infarction.

[0010] The above-mentioned substance that promotes the expression of the RGS14 gene can also be called an RGS14 expression promoter.

[0011] Furthermore, the substance that promotes RGS14 gene expression includes a recombinant vector or recombinant virus that can overexpress the RGS14 gene.

[0012] As a specific embodiment, the recombinant vector capable of overexpressing the RGS14 gene includes an RGS14 overexpression adenovirus vector, and the construction method thereof includes:

[0013] Using rat cDNA as a template, the nucleotide sequence of the primer pair shown in SEQ ID NO.4-SEQ ID NO.5 was amplified to obtain the CDS fragment of the rat RGS14 gene;

[0014] The adenovirus entry vector pENTR-U6-CMV-ATG-flag-T2A-EGFP was double-digested with BamHI and SpeI and recombined with the rat RGS14 gene CDS fragment, and then transformed into Escherichia coli T1 competent cells, cultured, screened, and sequenced to obtain the rat RGS14 overexpression entry plasmid;

[0015] The rat RGS14 overexpression entry plasmid was combined with the adenovirus recombinant plasmid pAd / PL-DEST TM (ThermoFisher, V49420) was used for Gateway site-specific recombination to obtain the AdRGS14 adenovirus overexpression plasmid pAd-CMV-RGS14-flag-T2A-EGFP.

[0016] The construction method of the adenovirus entry vector pENTR-U6-CMV-ATG-flag-T2A-EGFP is as follows:

[0017] The DNA fragment shown in SEQ ID NO.1 and the pENTR / D-TOPO double-digested with NotI and AscI were ligated using ligase (TOYOBO, LGK-101). TM The vector (ThermoFisher, K240020) was used for ligation reaction to obtain the modified adenovirus entry vector pENTR-U6-CMV-ATG-flag-T2A-EGFP.

[0018] In a fifth aspect of the present invention, there is provided use of a substance that enhances the activity of RGS14 protein in the preparation of a drug for preventing, alleviating and / or treating myocardial infarction.

[0019] Furthermore, the drug prevents, alleviates and / or treats myocardial infarction through at least one of the following effects: inhibiting cardiac inflammation, reducing myocardial cell apoptosis or improving myocardial infarction.

[0020] In a sixth aspect of the present invention, a drug for preventing, alleviating and / or treating myocardial infarction is provided, comprising at least one of the following substances:

[0021] (1) RGS14 protein;

[0022] (2) substances that promote RGS14 gene expression;

[0023] (3) Substances that enhance the activity of RGS14 protein.

[0024] Furthermore, the method for the drug to prevent, alleviate and / or treat myocardial infarction disease includes: under the stimulation of hypoxia and glucose deprivation, overexpression of RGS14 in the drug can significantly reduce the damage of hypoxia and glucose deprivation to the vitality of myocardial cells.

[0025] Furthermore, the medicine also includes pharmaceutically acceptable excipients.

[0026] Furthermore, the auxiliary material is selected from one of fillers, disintegrants, binders, diluents, lubricants, sweeteners or colorants.

[0027] Furthermore, the dosage form of the drug includes at least one of granules, tablets, pills, capsules, injections and dispersants.

[0028] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0029] The present invention provides the use of an RGS14 expression promoter in the preparation of a medicament for preventing and / or treating myocardial infarction. Research has revealed that the RGS14 gene can ameliorate myocardial infarction and is closely associated with cardiomyocyte apoptosis. Overexpression of RGS14 can inhibit cardiomyocyte apoptosis and promote cardiomyocyte survival, indicating that the RGS14 gene and an RGS14 expression promoter can be used to prepare a medicament for preventing, alleviating, and / or treating myocardial infarction. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following is a brief introduction to the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0031] Figure 1 The figure shows the expression level of RGS14 in the heart tissue of the sham operation group (Sham) and the myocardial infarction animal model; Figure 1 A is a bar graph showing the mRNA expression levels of apoptosis-related molecules (Bax, Bcl2) and RGS14 (GAPDH was used as an internal reference, and the results were normalized with the Sham group as "1", **: p < 0.01 vs Sham group). Figure 1 B is the protein level detection result and statistical graph of RGS14 (GAPDH is used as the internal reference, and the results are normalized with the Sham group as "1", **: p < 0.01 vs Sham group), Figure 1 C shows the results of RGS14 immunohistochemical staining, scale bar 50 μm.

[0032] Figure 2 The figure shows the expression level of RGS14 in primary cardiomyocytes after oxygen glucose deprivation (OGD) treatment (normal cultured cardiomyocytes were used as control); Figure 2A is a bar graph showing the mRNA expression levels of apoptosis-related molecules (Bax, Bcl2) and RGS14 (GAPDH was used as an internal reference, and the results were normalized with the Control group as "1", **: p < 0.01 vs Control group). Figure 2 B is a graph showing the protein level detection results and statistical graph of RGS14 (GAPDH was used as an internal reference, and the results were normalized with the Control group as "1", **: p < 0.01 vs Control group).

[0033] Figure 3 This is the result of Western Blot detection of RGS14 expression in heart tissues of wild-type (WT) and RGS14 knockout mice (KO).

[0034] Figure 4 The results of serum aspartate aminotransferase (AST), lactate dehydrogenase (LDH), creatine kinase (CK), creatine kinase MB isoenzyme (CK-MB), and α-hydroxybutyrate dehydrogenase (HBDH) levels in WT and RGS14-KO mice 24 hours after sham operation (Sham) or myocardial infarction (MI) (**: p < 0.01 vs WT Sham group, #: 0.01 ≤ p < 0.05, ##: p < 0.01 vs WT MI 24h group); Figure 4 A is the result of aspartate aminotransferase content test, Figure 4 B is the result of lactate dehydrogenase content test. Figure 4 C is the result of creatine kinase content test, Figure 4 D is the result of creatine kinase content test. Figure 4 E is the detection result of α-hydroxybutyrate dehydrogenase content.

[0035] Figure 5 The CD11b and LY6G immunohistochemical staining results and the cell number bar graph of the heart tissue of WT and RGS14-KO mice 24 hours after myocardial infarction surgery are shown. Figure 5 A is the immunohistochemical staining of CD11b and the bar chart of cell number. Figure 5 B is the immunohistochemical staining of LY6G and the bar chart of cell number, scale bar 50 μm (##: p < 0.01 vs WT MI 24h group).

[0036] Figure 6 Figure 3 is a bar graph showing TUNEL staining and cell number in heart tissue of WT and RGS14-KO mice 24 hours after myocardial infarction surgery, scale bar 50 μm (##: p < 0.01 vs WT MI 24h group);

[0037] Figure 7 This is a map of the modified adenovirus entry vector pENTR-U6-CMV-ATG-flag-T2A-EGFP.

[0038] Figure 8 The figure shows the results of Western Blot detection of RGS14 expression in primary cardiomyocytes infected with control adenovirus (AdshRNA) and RGS14 knockdown adenovirus (AdshRGS14), with GAPDH as the internal control;

[0039] Figure 9 Figure 2 is the expression detection result of apoptosis-related molecules in primary cardiomyocytes infected with AdshRNA adenovirus and AdshRGS14 adenovirus after OGD stimulation or Control treatment; Figure 9 A is the result of detection of Bax and Bcl2 mRNA expression levels (GAPDH was used as the internal reference, and the results were normalized with the AdshRNA Control group as "1", **: p < 0.01 vs AdshRNA Control group, #: 0.01 ≤ p < 0.05, ##: p < 0.01 vs AdshRNA OGD group); Figure 9 B is a graph showing the detection results of the protein expression levels of Bax and Bcl2 (GAPDH was used as an internal reference, and the results were normalized with the AdshRNA OGD group as "1", ##: p < 0.01 vs AdshRNA OGD group).

[0040] Figure 10 The figure shows the results of Western Blot detection of RGS14 expression in primary cardiomyocytes infected with control adenovirus (AdGFP) and RGS14 overexpression adenovirus (AdRGS14), with GAPDH as the internal control;

[0041] Figure 11 The results of apoptosis-related molecule expression detection in primary cardiomyocytes infected with AdGFP adenovirus and AdRGS14 adenovirus after OGD stimulation or Control treatment; Figure 11 A is the detection result of Bax and Bcl2 mRNA expression levels (GAPDH was used as the internal reference, and the results were normalized with the AdGFPControl group as "1", **: p < 0.01 vs AdGFPControl group, #: 0.01 ≤ p < 0.05, ##: p < 0.01 vs AdGFP OGD group); Figure 11B is the result of detection of protein expression levels of Bax and Bcl2 (GAPDH was used as an internal reference, and the results were normalized with the AdGFP OGD group as "1", ##: p < 0.01 vs. AdGFP OGD group). DETAILED DESCRIPTION

[0042] The present invention will be described in detail below in conjunction with specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific embodiments and examples are for illustrating the present invention, rather than for limiting the present invention.

[0043] Throughout this specification, unless otherwise specified, the terms used herein should be understood as having the same meaning as commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the event of any conflict, the present specification shall take precedence.

[0044] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or obtained through existing methods.

[0045] The application of the RGS14 gene of the present application in the preparation of a drug for preventing and / or treating myocardial infarction will be described in detail below with reference to examples and experimental data.

[0046] Example 1: RGS14 expression is downregulated in a myocardial infarction model

[0047] 1. Experimental Animals and Grouping

[0048] Wild-type mice (WT, purchased from Beijing Weitonglihua Experimental Animal Technology Co., Ltd.) aged 9-11 weeks and weighing 25-28g, with a male C57BL / 6j strain, were selected as experimental subjects. The mice were divided into two groups: sham operation group (Sham) and myocardial infarction 24h model group (MI). All experimental mice were housed in the SPF-grade experimental animal center of Renmin Hospital of Wuhan University. SRF-grade mouse feed was purchased from Beijing Huafukang Biotechnology Co., Ltd. Breeding conditions: room temperature between 22-24℃, humidity between 40-70%, alternating light and dark lighting time of 12h, and free access to water and food.

[0049] 2. Acquisition of Mouse Myocardial Infarction (MI) Model

[0050] The myocardial infarction model in mice was established by ligating the left anterior descending artery (LAD). The specific method is as follows:

[0051] 2.1 Preoperative preparation

[0052] (1) Anesthesia: Weigh the mouse first, calculate the required amount of anesthetic (3% sodium pentobarbital) at 90 mg / kg body weight, and inject it intraperitoneally. Record the injection time. Successful anesthesia is determined by the absence of noticeable reactions to tail or toe clamping and the mouse being in good condition (generally, no noticeable reaction occurs approximately 10 minutes after injection, and a toe clamping reaction occurs approximately 50 minutes after anesthesia. The optimal surgical time is approximately 30 minutes after anesthesia).

[0053] (2) Preparation of the surgical area: Remove the hair from the left chest, left thorax, and left forelimb of the mouse. After shaving, wipe the surgical area with wet gauze to remove the hair without affecting the surgical field of view.

[0054] (3) Intubation: Use a rubber band to secure the mouse's upper incisors to the slope of the V-shaped plate, and quickly insert the endotracheal tube accurately through the glottis into the trachea. Then, place the mouse in a right lateral position on a heating pad (the heating pad must be preheated in advance). Then, connect the endotracheal tube to the ventilator and secure the mouse. If the mouse's chest rise and fall is consistent with the ventilator frequency, it indicates that the endotracheal tube is successful.

[0055] 2.2 Left anterior descending artery ligation

[0056] The mouse was placed in lateral recumbency on an inclined surface of an intubation platform, and a 22G indwelling cannula was rapidly inserted into the trachea through the glottis. The cannula was connected to a ventilator circuit to maintain the mouse's respiratory rate and ventilator frequency. The mouse was secured in a supine position on a warming pad. A 1.5 cm transverse incision was made along the line connecting the axilla and the lower end of the sternum between the third and fourth ribs on the left side of the sternum. A purse-string suture was placed over the incision with 5-0 surgical suture for later use. The pectoral muscles were then bluntly dissected layer by layer, exposing the fourth intercostal space and making a small incision. The pericardium was opened with hemostats, the chest cavity was pressed to gently squeeze out the heart, and the left anterior descending coronary artery (LAD) was sutured with 6-0 silk suture. The procedure was considered successful when the anterior wall of the left ventricle faded and transient arrhythmia occurred. The heart was then placed into the chest cavity, the air in the chest cavity was evacuated, and the purse-string was tightened. Simultaneously, the surgical procedure for mice in the sham group was identical to that in the surgical group, except that the left anterior descending coronary artery was not ligated. After surgery, the wound skin was sutured and disinfected with iodine, and the mice were placed in a 28°C incubator until they recovered. Specimens were harvested 24 hours after ligation. All mouse surgeries were performed under double-blind procedures.

[0057] 2.3 Postoperative Care

[0058] After ligation of the descending aortic branch, when the mice showed spontaneous breathing and a strong reaction to toe pinching, the endotracheal tube was removed and the mice were placed in a cage containing autoclaved bedding, feed and drinking water and continued to be raised and observed in the breeding room.

[0059] 3. Get materials

[0060] 24 hours after surgery, the cardiac tissues of the ischemic area of ​​mice in the sham group (Sham) and ischemia-reperfusion group were quickly frozen in liquid nitrogen for subsequent myogenesis detection or fixed in 10% neutral formalin for 72 hours, dehydrated, embedded, and paraffin-sectioned for subsequent staining.

[0061] 4. Detection and Analysis of RGS14 Expression

[0062] The RT-PCR method was used to detect the mRNA level of RGS14 in the heart tissues of mice in the sham group and the MI 24h group. The specific method was as follows:

[0063] Total RNA was extracted using TRIzol reagent (T9424, Sigma-Aldrich). Reverse transcription was then performed using a reverse transcription kit (R323-01, Novagen) to generate cDNA. RT-PCR was performed using SYBR Green PCR Mix (Q111-02, Novagen). The RT-PCR program was set as follows: 95°C for 5 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 60 seconds. Gapdh was used as an internal control. The primers used were as follows:

[0064] Table 1

[0065]

[0066] Western blot was used to detect the protein expression level of RGS14 in the heart tissues of mice in the Sham group and the MI 24h group. The specific method was as follows:

[0067] Tissues were added to RIPA lysis buffer (65 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% SDS) containing protease (04693132001, Roche) and phosphatase inhibitors (4906837001, Roche). Tissues were ultrasonically disrupted, and the supernatant was isolated by centrifugation to obtain total protein. Protein concentration was determined using a BCA assay kit (23225, Thermo). Equal amounts of protein, mixed with loading buffer, were separated by 10% SDS-PAGE electrophoresis and transferred to a 0.45 μm PVDF membrane (IPVH00010, Millipore). The PVDF membrane was then blocked with 5% skim milk for approximately 1 hour at room temperature. After three 5-min washes with TBST, primary antibodies (RGS14 primary antibody: 16258-1-AP, Poteintech; GAPDH primary antibody: 2118, CST) were added and incubated overnight at 4°C. After three TBST washes, secondary antibodies raised against the corresponding species (Jackson Immuno Research) were added and incubated for 1 h at room temperature. Signals were collected using an ECL luminescent substrate (1705062, Bio-Rad) on a Bole gel imaging system (ChemiDoc XRS+) and quantified using Image Lab software.

[0068] Immunohistochemical staining was used to visualize the expression and distribution of RGS14 in cardiac tissue: 5 μm paraffin sections were fixed with EDTA and incubated with an RGS14 antibody overnight at 4°C. After washing with PBS, secondary antibodies (Mouse Two-Step Detection Kit (BLRE147-200T, Biolight)) were added and incubated at 37°C for 30 minutes. DAB (BLRE147-200T, Biolight) was then used for development, and hematoxylin (BLRE004, Biolight) was used to stain cell nuclei. Images were acquired using a slide scanner (win180, WINMEDIC), and quantitative analysis was performed using Image Pro Plus (version 6.0) software.

[0069] RT-PCR test results Figure 1 As shown in A, compared with the Sham group, the expression of Bax in the heart injury area of ​​mice in the MI 24h group was significantly upregulated, and the expression of Bcl2 was significantly downregulated, indicating that the MI model was successfully established. The mRNA and protein levels of RGS14 were both decreased compared with the Sham group ( Figure 1 A, B). Immunohistochemistry results also showed that the expression signal of RGS14 in the heart injury area of ​​mice in the MI 24h group was significantly weaker than that in the Sham group ( Figure 1C) These results indicate that RGS14 expression is downregulated in the myocardial infarction model.

[0070] Example 2: RGS14 expression is downregulated in oxygen-glucose-deprived cardiomyocytes

[0071] 1. Isolation and Culture of Primary Cardiomyocytes

[0072] Primary cardiomyocytes were isolated from 1-2 day old Sprague-Dawley rats. The specific operation was as follows: the rat hearts were isolated, washed with pre-cooled DMEM / F12 medium (C11330, Gibco), and cut into 1-2 mm 3 The fragments were digested with trypsin (Gibco, 25200). After completion, digestion was terminated with DMEM / F12 medium containing 20% ​​calf serum. The cell suspension was collected by centrifugation and resuspended in DMEM / F12 medium containing 15% fetal bovine serum (10099141C, GIBCO), 1% penicillin / streptomycin, and 5-bromodeoxyuridine (0.1 mM, to inhibit fibroblast proliferation, B5002-250MG, Sigma)) and cultured for 24 hours. Subsequently, serum-free medium was used for an additional 12 hours of maintenance culture.

[0073] 2. Construction of oxygen glucose deprivation (OGD) model: The culture medium was replaced with DMEM medium without serum, glucose and sodium pyruvate. Then, the cells were cultured in an incubator containing 95% N2 and 5% CO2 for 24 hours. Normally cultured cells were used as a control. The cells were then collected for subsequent testing.

[0074] 3. RT-PCR and Western blot were used to detect the expression of RGS14. The specific methods were the same as those in Example 1. The primer sequences used for RT-PCR were as follows:

[0075] Table 2

[0076]

[0077] Test results such as Figure 2 As shown in Figure 2, compared with the Control group, the expression of Bax in the OGD 24h group was significantly upregulated, and the expression of Bcl2 was significantly downregulated, indicating that the cell model was successfully constructed ( Figure 2 A). The mRNA and protein levels of RGS14 decreased compared with the Control group ( Figure 2 A, B). These results indicate that RGS14 expression is downregulated in oxygen-glucose-deprived cardiomyocytes.

[0078] Example 3: RGS14 gene deletion promotes the progression of myocardial infarction

[0079] 1. Experimental Animals and Grouping

[0080] C57 mice and RGS14 knockout (KO) mice were divided into two groups: WT Sham group, WT MI 24h group, KOSham group, and KO MI 24h group. The MI group was subjected to LAD surgery to establish a myocardial infarction model, and the Sham group was used as a control. The specific method was the same as in Example 1.

[0081] 2. Construction of RGS14 knockout mice

[0082] The guide RNA sequence (GGCCTGGGAACCTGCAGTGC TGG) for the target DNA region was predicted using an online CRISPR design tool (http: / / chopchop.cbu.uib.no / ). The RGS14-sgRNA expression vector was constructed using pUC57-sgRNA (Addgene, 51132) as the backbone vector. The purified Cas9 mRNA and sgRNA products were mixed and injected into single-cell fertilized C57BL / 6 mouse eggs using a FemtoJet 5247 microinjection system. The injected fertilized eggs were then transplanted into surrogate females. F0 mice were obtained after approximately 19-21 days of gestation. Two-week-old mouse ear tissue was obtained, and genomic DNA was extracted for gene identification. The identification primer sequences were:

[0083] Forward primer: 5′-CTGTGTGGACACTCCCATCC-3′ (SEQ ID NO. 22);

[0084] Reverse primer: 5′-ACCACAGAGAGAAGCAGCAC-3′ (SEQ ID NO. 23);

[0085] The mice used in the experiment were homozygous for the mutant, and the expression of RGS14 was detected by Western blot, using the same detection method as in Example 1.

[0086] 3. Get materials

[0087] 24 h after surgery, mice in the Sham and MI groups were killed by cervical dislocation, and 1 mL of blood was immediately collected from the inferior vena cava. The serum was separated and stored in a -80°C refrigerator for subsequent enzyme activity detection.

[0088] At the same time, cardiac tissues from the ischemic area were uniformly obtained and fixed in 10% neutral formalin for 72 hours, then dehydrated, embedded, and paraffin-sectioned for subsequent staining.

[0089] 4. Determination of serological indicators of myocardial infarction in mice.

[0090] Indicators for assessing the severity of myocardial infarction include the measurement of cardiac function-related enzyme activities (aspartate aminotransferase (AST), lactate dehydrogenase (LDH), creatine kinase (CK), creatine kinase isoenzyme (CK-MB), and α-hydroxybutyrate dehydrogenase (HBDH)), as well as analysis of cardiac tissue inflammation and apoptosis. These indicators are positively correlated with the severity of myocardial infarction. Serum enzyme activities of AST, LDH, CK, CK-MB, and HBDH were measured using an automated biochemical analyzer (3110, Hitachi).

[0091] 5. Pathological Staining

[0092] Immunohistochemical staining for CD11b and Ly6g: 5 μm paraffin sections were fixed with EDTA and incubated with CD11b (BM3925, Boster) or Ly6g (GB11229, Seville) antibodies overnight at 4°C. After washing with PBS, secondary antibodies (mouse two-step detection kit (BLRE147-200T, Biolight)) were added and incubated at 37°C for 30 minutes. DAB (BLRE147-200T, Biolight) was then used for development, and hematoxylin (BLRE004, Biolight) was used to stain cell nuclei. Images were acquired using a slide scanner (win180, WINMEDIC), and quantitative analysis was performed using Image Pro Plus (version 6.0) software.

[0093] TUNEL immunofluorescence staining: Paraffin-embedded tissues were cut into 5 μm sections and stained using the TUNEL staining kit (11684817910, Roche) according to the manufacturer's instructions. DAPI was used to stain cell nuclei. Images were observed under a fluorescence microscope (BX51, OLYMPUS) and quantitatively analyzed using Image Pro Plus (version 6.0) software.

[0094] The identification results of RGS14 knockout mice are as follows Figure 3 As shown, no obvious RGS14 signal was detected in the heart tissue of KO group mice, indicating that RGS14 gene knockout mice were successfully constructed.

[0095] The results of mouse cardiac function related enzyme activity detection were as follows Figure 4As shown in the figure, there was no significant difference between the two groups of mice in the Sham group, indicating that RGS14 gene deletion had no significant effect on the cardiac function of mice under normal circumstances. After the MI model was established, compared with the WT Sham group, the activities of cardiac function-related enzymes AST, LDH, CK, CK-MB, and HBDH in the WT MI 24h group were significantly upregulated, indicating that the myocardial infarction model was successfully established and cardiac function decreased. In the KO MI 24h group, the above indicators were more significantly upregulated, indicating that RGS14 deletion promoted the downregulation of central function in myocardial infarction.

[0096] The results of CD11b and LY6G immunohistochemical staining were as follows: Figure 5 As shown, more positive signals were observed in the heart tissue of the KO MI 24h group, and the number of positive cells was significantly greater than that of the WT MI 24h group, indicating that the infiltration of inflammatory cells was more significant in the KO MI 24h group, indicating that RGS14 deficiency promoted the inflammatory response of the heart during myocardial infarction.

[0097] The apoptosis of cardiomyocytes was detected by TUNEL staining. Figure 6 As shown in the figure, the number of apoptotic cells in the heart tissue of the KO MI 24h group of mice was significantly increased compared with the WT MI 24h group, indicating that RGS14 is related to cell apoptosis during myocardial infarction. RGS14 can promote cell apoptosis during myocardial infarction.

[0098] Example 4: Effects of RGS14 gene knockdown and overexpression on promoting cardiomyocyte apoptosis induced by OGD stimulation

[0099] 1. Construction of RGS14 knockdown and overexpression adenovirus cardiomyocytes

[0100] An adenoviral knockdown plasmid for AdshRGS14 was constructed, and AdshRNA (an adenovirus containing shRNA (silencing RNA)) was used as a control. An adenoviral overexpression plasmid for AdRGS14 was constructed, and AdGFP (an adenovirus containing GFP (green fluorescent protein)) was used as a control.

[0101] The construction of AdshRGS14 adenoviral knockdown plasmid and AdRGS14 adenoviral overexpression plasmid is as follows:

[0102] (1) Entry plasmid transformation

[0103] ①Synthesize the following DNA fragment with NotI and AscI restriction sites at both ends:

[0104]

[0105] ②Use ligase (TOYOBO, LGK-101) to ligate the above DNA fragment and pENTR / D-TOPO double-digested with NotI-HF (NEB, R3189V) and AscI (NEB, R0558V). TM The vector (ThermoFisher, K240020) was used for ligation reaction to obtain the modified adenovirus entry vector pENTR-U6-CMV-ATG-flag-T2A-EGFP, the map of which is shown in FIG. Figure 7 shown.

[0106] (2) Construction of rat RGS14 knockdown entry plasmid

[0107] ① Design and synthesize oligo annealing primers targeting rat RGS14 gene. The sequences are shown in Table 3.

[0108] Table 3

[0109]

[0110] ② pENTR-U6-CMV-ATG-flag-T2A-EGFP was linearized with AgeI-HF (NEB, R3552S) (also called BshTI) and EcoRI-HF (NEB, R3101V). After annealing, the above oligo primers were ligated with the linearized vector using ligase (TOYOBO, LGK-101) and transformed into Escherichia coli T1 competent cells (Full Gold, CD501-03). After culture, screening, and sequencing, the rat RGS14 knockdown entry plasmid was obtained.

[0111] (3) Construction of rat RGS14 overexpression plasmid

[0112] ① Using rat cDNA as a template, primers were designed (see Table 4) and the CDS sequence of RGS14 was obtained by PCR amplification.

[0113] Table 4

[0114] Primer name Sequence (5'-3') RGS14-F GGCTAGCGATATCGGATCCGCCACCATGCCAGGGAAGCCCAAG(SEQ ID NO.4) RGS14-R CGTCCTTGTAATCACTAGTTGGTGGAGCCTCCTGAGAACC(SEQ ID NO.5)

[0115] ② pENTR-U6-CMV-ATG-flag-T2A-EGFP was linearized with BamHI-HF (NEB, R3136V) and SpeI-HF (NEB, R3133V) (also called BcuI) to obtain a linearized vector. The above PCR product and the linearized vector were recombined with recombinase (Nanjing Novozymes Biotechnology Co., Ltd., C112-02) and then transformed into Escherichia coli T1 competent cells (Full Gold, CD501-03). After culture, screening, and sequencing, the rat RGS14 overexpression entry plasmid was obtained.

[0116] (4) Combine the knockdown entry plasmid or overexpression entry plasmid with the adenovirus recombinant plasmid pAd / PL-DEST TM (ThermoFisher, V49420) was used for Gateway site-specific recombination (GateWay@LR Clonase TMII EnzymeMix, ThermoFisher, 2484478) to obtain the AdshRGS14 adenoviral knockdown plasmid pAd-U6-RGS14shRNA-CMV-EGFP and the AdRGS14 adenoviral overexpression plasmid pAd-CMV-RGS14-flag-T2A-EGFP.

[0117] AdshRGS14 adenoviral knockdown plasmid or AdRGS14 adenoviral overexpression plasmid was linearized by PacI and transfected into HEK293A cells using PEI transfection reagent (Polysciences, 24765-100). Recombinant adenovirus was obtained using the Adeasy adenovirus packaging system (240009, Agilent Technologies). The recombinant adenovirus titer was 10 10 pfu / ml. Cultured cardiomyocytes were infected with adenovirus at a multiplicity of infection of 100 for 12 hours, after which cells were harvested for Western blot analysis. Cultured cardiomyocytes were infected with adenovirus at a multiplicity of infection of 100 for 12 hours. In in vitro experiments, cultured cardiomyocytes were infected with AdshRNA, AdshRGS14, AdGFP, or AdRGS14 before OGD treatment.

[0118] 2. OGD stimulation

[0119] Cardiomyocytes infected with adenovirus expressing AdshRNA, AdshRGS14, AdGFP or AdRGS14 were subjected to OGD stimulation. After stimulation, the harvested cells were subjected to RT-PCR and Western blot detection. The stimulation and detection methods were the same as those in Example 2.

[0120] The results of AdshRNA and AdshRGS14 adenovirus infection efficiency test are shown in Figure 8 The expression of RGS14 in cardiomyocytes of the AdshRGS14 group was significantly lower than that of the AdshRNA group, indicating that RGS14 knockdown was successful.

[0121] The results of apoptosis-related molecule expression detection in cells after OGD stimulation were as follows: Figure 9As shown in the figure, the levels of Bax and Bax mRNA in the AdshRNA OGD group were significantly higher than those in the AdshRNA Control group, while the mRNA level of Bcl2 was significantly lower than that in the AdshRNA Control group, indicating that cell apoptosis was activated and the OGD stimulation model was successfully established. In the AdshRGS14 OGD group, Bax was further upregulated and Bcl2 was further downregulated, indicating that cell apoptosis in the AdshRGS14 OGD group was more significant ( Figure 9 A), Western blot analysis further confirmed this result ( Figure 9 B) These results indicate that RGS14 knockdown promotes OGD-induced cardiomyocyte apoptosis and inhibits cardiomyocyte survival.

[0122] The results of AdGFP and AdRGS14 adenovirus infection efficiency test are shown in Figure 10 The expression of RGS14 in cardiomyocytes of the AdRGS14 group was significantly higher than that of the AdGFP group, indicating that RGS14 was successfully overexpressed.

[0123] The results of the detection of apoptosis-related molecules expression in cells after OGD stimulation are as follows Figure 11 As shown in the figure, the mRNA levels of Bax and Bax in the AdGFP OGD group were significantly higher than those in the AdGFP Control group, while the mRNA level of Bcl2 was significantly lower than that in the AdshRNA Control group, indicating that cell apoptosis was activated and the OGD stimulation model was successfully established. In the AdRGS14 OGD group, the upregulation of Bax and the downregulation of Bcl2 were inhibited, indicating that the cell apoptosis in the AdRGS14 OGD group was alleviated ( Figure 11 A), Western blot analysis further confirmed this result ( Figure 11 B) These results indicate that RGS14 overexpression can inhibit OGD-induced cardiomyocyte apoptosis and promote cardiomyocyte survival.

[0124] These results indicate that in myocardial infarction, RGS14 gene deletion significantly promotes cardiac inflammation and apoptosis, exacerbating myocardial infarction and worsening cardiac function, while RGS14 gene overexpression significantly inhibits myocardial infarction and protects cardiac function. Therefore, RGS14 has the potential to protect cardiac function and inhibit myocardial infarction, particularly in suppressing the development of myocardial infarction-related diseases induced by left anterior descending artery ligation.

[0125] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a list of elements includes not only those elements, but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0126] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0127] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.

Claims

1. Use of the RGS14 gene as a target gene in screening drugs for preventing, alleviating and / or treating myocardial infarction, characterized in that: The screening method includes screening substances that can promote the expression of RGS14 gene.

2. Use of RGS14 protein as a target in screening drugs for preventing, alleviating and / or treating myocardial infarction, characterized in that: The screening method includes screening substances that can enhance the activity of RGS14 protein.

3. Use of RGS14 protein in the preparation of drugs for preventing and / or treating myocardial infarction.

4. Use of a substance that promotes RGS14 gene expression in the preparation of a drug for preventing, alleviating and / or treating myocardial infarction.

5. The use according to claim 4, characterized in that The substance that promotes the expression of the RGS14 gene includes a recombinant vector or a recombinant virus that can overexpress the RGS14 gene.

6. Use of a substance that enhances the activity of RGS14 protein in the preparation of a drug for preventing, alleviating and / or treating myocardial infarction.

7. The use according to any one of claims 1 to 6, characterized in that: The drug prevents, alleviates and / or treats myocardial infarction through at least one of the following effects: inhibiting cardiac inflammation, reducing myocardial cell apoptosis or improving myocardial infarction.

8. A drug for preventing, alleviating and / or treating myocardial infarction, characterized in that: The drug contains at least one of the following substances: (1) RGS14 protein; (2) substances that promote RGS14 gene expression; (3) Substances that enhance the activity of RGS14 protein.

9. The drug according to claim 8, characterized in that The method for preventing, alleviating and / or treating myocardial infarction by the drug includes: under the stimulation of hypoxia and glucose deprivation, overexpression of RGS14 in the drug can significantly reduce the damage to myocardial cell vitality caused by hypoxia and glucose deprivation.