Use of maize zmLAX2 gene
By applying the maize ZmLAX2 gene and CRISPR/Cas9 technology, the development of the upper leaves and ears of maize can be precisely regulated, solving the problems of insufficient maize yield and lodging resistance in existing technologies, and realizing the breeding of new maize varieties with high yield, short stalks and lodging resistance.
Patent Information
- Application Number
- CN202511087736.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-05
- Publication Date
- 2026-01-02
- Estimated Expiration
- 2045-08-05
AI Technical Summary
Existing technologies are insufficient to effectively control the number of leaves above the ear, total number of leaves, number of ears, plant height, and ear height in maize, resulting in insufficient maize yield and lodging resistance.
By using the maize ZmLAX2 gene and directing its editing via CRISPR/Cas9 technology, the development of ear leaf (AM) and ear-mounted leaves was precisely regulated. Combined with marker-assisted selection, the coordination between ear leaf number and ear development was optimized.
The breeding of new high-yielding, short-stalked, and lodging-resistant maize varieties has been achieved, improving maize yield and lodging resistance.
Smart Images

Figure CN120574885B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of crop molecular biology and molecular breeding technology, specifically relating to maize. ZmLAX2 Applications of genes. Background Technology
[0002] corn( Zea mays L. As a globally important food, feed, and industrial raw material crop, maize occupies a vital position in my country's agricultural production system. The structure of a mature maize plant is mainly determined by the initiation of the lateral meristem (AM) and its subsequent growth activities. The female ear of maize typically begins about 5 to 7 internodes below the tassel. The timing of AM initiation not only determines the number of internodes from the tassel to the female ear but also affects the number of leaves above the main ear and the total number of leaves. Leaves above the ear are one of the plant's main photosynthetic organs and a primary site of carbohydrate synthesis. Studies have shown that physiological and biochemical indicators differ among leaves at different levels in maize. Specifically, the nitrogen content, chlorophyll content, leaf thickness, and net photosynthetic rate of leaves above the ear are greater than those in the middle and lower parts of the ear. Therefore, studying the influence of functional leaves above the ear on ear traits is of great significance. Furthermore, leaves above the ear are the main source of carbohydrates for maize grain filling; increasing the number of leaves above the ear can increase the source of carbohydrates in maize, enhance lodging resistance, and ultimately increase crop yield. Summary of the Invention
[0003] In view of the above-mentioned prior art, the present invention provides corn ZmLAX2 The gene has been given a new use in regulating the development of the upper leaves, total number of leaves, ear height, plant height, and ear height in maize, and can be used to breed new high-yielding, short-stalked, and lodging-resistant maize varieties.
[0004] To achieve the above objectives, the technical solution adopted by the present invention is: providing corn. ZmLAX2 The application of genes, corn ZmLAX2 Application of genes in regulating spike-leaf, total number of leaves, number of ears, plant height, or ear height in plants; ZmLAX2 The nucleotide sequence of the gene is selected from any of the following nucleotide sequences:
[0005] (1) The nucleotide sequence shown in SEQ ID NO.1;
[0006] (2) DNA molecules hybridized with the DNA sequence defined in (1) under stringent hybridization conditions: hybridization at 65°C with 6×SSC buffer, followed by washing with 0.1×SSC buffer at 65°C for 1 h;
[0007] (3) DNA molecules that have more than 90% homology with the DNA sequence defined in (1).
[0008] On the basis of the above technical solutions, the application can be further improved as follows.
[0009] Further, the corn ZmLAX2 gene is applied in the improvement of plant germplasm resources.
[0010] Further, the corn ZmLAX2 gene is applied in the regulation of ear leaf number, total leaf number, ear number, plant height or ear height of transgenic plants.
[0011] Further, the corn ZmLAX2 gene is used for cultivating new plant varieties with high yield, dwarf and lodging resistance.
[0012] Further, the corn ZmLAX2 gene function is inactivated / enhanced to increase / decrease total leaf number, ear leaf, or decrease / increase ear number, or reduce / increase plant height and ear height.
[0013] Further, the plant variety is corn.
[0014] Further, the corn ear leaf number, total leaf number, ear number, plant height or ear height is regulated by biological materials, and the biological materials are selected from any one of the following:
[0015] (1) an expression cassette containing the corn ZmLAX2 gene;
[0016] (2) a recombinant vector containing the corn ZmLAX2 gene;
[0017] (3) a transgenic cell line containing the corn ZmLAX2 gene.
[0018] Further, the nucleotide sequence of the primer pair for cloning the corn ZmLAX2 gene is shown in SEQ ID NO. 2 and SEQ ID NO. 3.
[0019] Further, the nucleotide sequence of the primer pair for specifically detecting the corn ZmLAX2 gene is shown in SEQ ID NO. 4 and SEQ ID NO. 5.
[0020] The beneficial effects of the application are: the application collects AM and boundary tissue of each leaf axil and corresponding SAM (or male ear) at six development stages (V2, V4, V6, V8, V10 and V12) of corn, and performs transcriptome sequencing. Zm00001d042258 ( ZmLAX2 ) highly related to AM initiation in WGCNA analysis. ZmLAX2Encoding an RNA ring finger protein. Simultaneously, phenotypic data on the number of leaves on the ear from 402 maize inbred lines and cover were used. ZmLAX2 Association analysis was performed on 405 minor allele frequencies (MAF) ≥0.05 in the genome and upstream and downstream 3000 bp regions to identify those highly associated with the number of leaves on the spike. ZmLAX2 Natural variation sites. Results showed that they were located at... ZmLAX2 A SNP (chr3.S_157658890) in the 5'UTR region was identified as significantly associated with the number of spikelet leaves phenotype (−log10 (pvalue) > 1.853871964). Haplotype analysis showed that the number of spikelet leaves in HAP-G of chr3.S_157658890 was significantly higher than that in HAP-A, indicating that AM initiation was delayed in HAP-G. However, different haplotypes... ZmLAX2 The results of the qRT-PCR experiment showed that ZmLAX2 The expression level in HAP-G was significantly lower than that in HAP-A.
[0021] This invention provides a new target for the genetic improvement of maize ear traits. Based on ZmLAX2 Natural variations can be used to optimize the coordination between the number of leaves on the ear and ear development in modern varieties through marker-assisted selection, which is of great value for improving plant architecture under high-density planting conditions. Furthermore, combining CRISPR / Cas9 technology with... ZmLAX2 Targeted editing can precisely regulate the development of AM and spikelet leaves, providing a molecular basis for modular design of plant type traits. Attached Figure Description
[0022] Figure 1 For corn ZmLAX2 Gene expression levels in the transcriptome of ear meristem;
[0023] Figure 2 for ZmLAX2 Association analysis of spikelet leaf number in natural populations; a is ZmLAX2 Genomic region association analysis and LD analysis were performed. The red highlighted points represent SNPs (chr3.S_157658890) significantly associated with the spike leaf phenotype. The horizontal dashed line represents the Bonferroni-corrected −log10 (P-value) = 1.853871964. b shows the spike leaf number analysis for different haplotypes of chr3.S_157658890, with significant differences determined by Student's t-test. c shows the number of spike leaves between two haplotypes of the significant SNP (chr3.S_157658890) associated with the spike leaf number. ZmLAX2Relative expression levels of each haplotype, at least 10 inbred lines per haplotype, three technical replicates per inbred line, error bars represent standard deviation SD, significant differences were determined by Student's t test;
[0024] Figure 3 For ZmLAX2 Identification of mutants and alignment of homologous genes; a zmlax2 Mutation site display of mutants and PCR sequencing verification, b ZmLAX2 and phylogenetic tree analysis of homologous proteins in different plant species ;
[0025] Figure 4 For ZmLAX2 Multiple sequence alignment of homologous proteins;
[0026] Figure 5 For ZmLAX2 Involved in regulating the initial development of AM in maize; a zmlax2 AM phenotype of maize ( lax2 ) and wild type (WT), scale bar 10 cm; b zmlax2 Phenotype of mature ears of mutants ( lax2 ), white arrows indicate extended ears, scale bar 2 cm; d zmlax2 Phenotype of post-pollination ears of wild type (WT), lax2 (- / -) homozygous ( lax2 (+ / -) ) and heterozygous mutants ( zmlax2 lax2 ) and wild type (WT), n = 10, significant differences were determined by Student's t test: *** p < 0.001;
[0027] Figure 6 For ZmLAX2 Expression pattern detection; a ZmLAX2 In situ hybridization experiment in the shoot tip of maize at the V2 stage, black arrows indicate ZmLAX2 signal in the P6 leaf axil, the sense probe was used as a negative control, scale bar 100 μm; b ZmLAX2 RT-qPCR experiment in different tissues, each group has three biological replicates, each replicate has three technical replicates, error bars represent standard deviation SD;
[0028] Figure 7 For ZmLAX2 Subcellular localization detection in maize protoplast, H2B-mCherry was used as a nuclear marker, and the scale was 10 μm;
[0029] Figure 8 For zmlax2 Agronomic trait investigation of mutants; a-h are zmlax2 Mutant lines ( lax2 ) and wild type (WT) ear number (EN), axillary meristem number (AM number), plant height (PH), ear height (EH), total leaf number (TL), tassel branch number (TBL), ear-leaf length (EL-L) and ear-leaf width (EL-W) statistical analysis; numerical values are shown as mean ± standard deviation SD (n ≥ 10 plants), *** indicates p<0.001; ** indicates p<0.01; ns indicates no significant difference. DETAILED DESCRIPTION
[0030] The specific embodiments of the present application will be described in detail below with reference to the examples.
[0031] Unless otherwise specified, the chemical reagents used in the examples are all conventional commercially available reagents, and the maize mutants used in the examples are zmlax2 Purchased from Qilu Normal University.
[0032] Example 1
[0033] I. Corn ZmLAX2 Gene acquisition
[0034] 1. Preparation of plant material: after sowing corn B73 seeds, wait for about 2 weeks, cut the flag leaves, and store them in liquid nitrogen.
[0035] 2. Extraction of total plant RNA: 300 mg of corn leaves were rapidly ground to powder in liquid nitrogen, 1 mL of TRizol was added, and after shaking well, centrifuged at 4°C 12,000 rpm for 10 min; the supernatant was transferred to a new centrifuge tube, 1 / 5 TRizol volume of chloroform was added, mixed well, and then allowed to separate at room temperature for 3 min, then centrifuged at 4°C 12,000g for 15 min. The supernatant was transferred to a new centrifuge tube, mixed well, and then 1 times the volume of isopropanol was added, mixed well, and then placed at -20°C for 30 min. Centrifuged at 4°C 10,000g for 15 min, discard the supernatant, wash the precipitate with 75% ethanol twice, each time at room temperature for 10 min, then centrifuge at 4°C 7500 rpm for 5 min, and then air dry the precipitate at room temperature for 10 min. Dissolve the precipitate with 60 μL of DEPC water to obtain the total plant RNA.
[0036] 3. Reverse transcription to obtain cDNA (Reverse transcription kit: M-MLV Reverse Transcriptase M1707 (Promega))
[0037] (1) The reverse transcription system is shown in Table 1 and Table 2, and the reaction process is as follows:
[0038] Table 1 Reverse transcription reaction system 1
[0039]
[0040] Mix the solution in Table 1 in a centrifuge tube, treat at 70°C for 5 min, and then place on ice for 5 min.
[0041] Table 2 Reverse transcription reaction system 2
[0042]
[0043] Continue to add the solution in Table 2 to the above centrifuge tube, incubate at 48°C for 1 h, treat at 70°C for 15 min, and then treat at 4°C for 10 min to obtain the reverse transcription product.
[0044] Add 25 μL ddH2O to the reverse transcription product, mix well, and then obtain the cDNA used in Table 3.
[0045] (2) Cloning of corn ZmLAX2 gene
[0046] The required primers for PCR amplification are as follows:
[0047] Primer F1: 5'-ATGGTCCCAACAACTAGGAA-3' (SEQ ID NO. 2);
[0048] Primer R1: 5'-GAGCACTCCGAATAATAACG-3' (SEQ ID NO. 3).
[0049] The PCR system is shown in Table 3;
[0050] Table 3 PCR system
[0051]
[0052] The PCR program is shown in Table 4;
[0053] Table 4 PCR program
[0054]
[0055] The PCR product obtained is sequenced, and the result is that the PCR product has the nucleotide sequence shown in SEQ ID NO. 1, and the gene shown in the sequence is named ZmLAX2. ZmLAX2 .
[0056] II. Detection of expression profiles of ZmLAX2 in different tissues
[0057] After the corn B73 seeds are sown, the Shoot, SAM, AM, Root, and Boundary parts are taken when they grow to about two weeks, and RNA is extracted, and reverse transcription is performed (the system and method are the same as above). The reverse transcription product is diluted 10 times, and 2 μL thereof is taken for Real time PCR. The Real time PCR system and procedure are referred to the operation instruction of the Yeasen kit Hieff® qPCR SYBR Green Master Mix (Low Rox Plus).
[0058] The primers for Real time PCR are as follows:
[0059] Primer F2: 5'-GCAGCTCCCAACCAAAGTAGA-3' (SEQ ID NO. 4);
[0060] Primer R2: 5'-CGTAATGGTGCAGGAGTTGATG-3' (SEQ ID NO. 5).
[0061] The Real time PCR system is shown in Table 5.
[0062] Table 5 Real time PCR system
[0063]
[0064] The Real time PCR procedure is as follows: 95℃ 10 min, 95℃ 15 s, 60℃ 1 min, 40 cycles. The melting curve is set as follows: 95℃ 10 s, 65℃ 1 min, 0.2℃ stepwise increase in temperature, reading of the fluorescence value, and increase in temperature to 95℃.
[0065] The results are shown in Figure 5 b ZmLAX2 There is a higher expression amount in the SAM.
[0066] Example 2
[0067] ZmLAX2 Association analysis
[0068] The number of leaves above the ear of each inbred in a population of 402 maize inbreds was counted. The SNP data of these inbreds are publicly available at Maizego (http: / / www.maizego.org / ). A total of 405 SNPs with minor allele frequency (MAF) ≥ 0.05, covering ZmLAX2 the genome were used for association analysis with the number of leaves above the ear.
[0069] (1) GWAS analysis using Tassel software with mixed linear model (MLM);
[0070] (2) LD between associated SNPs was calculated using LDBlockShow software;
[0071] (3) The p-value threshold used in this association analysis was Bonferroni method corrected using GEC software.
[0072] Example 3
[0073] mRNA in situ hybridization
[0074] All the actual and containers used in mRNA in situ hybridization were prepared with DEPC water or high temperature sterilization at 180℃.
[0075] 1. Probe preparation
[0076] (1) T7 sequence was added to the 5' end of the primer;
[0077] The T7 sequence is: 5'-TAATACGACTCACTATAGGG-3' (SEQ ID NO. 6);
[0078] (2) The extracted cDNA template was subjected to PCR amplification to obtain sense and antisense sequences, and the gel was recovered (note RNase-free);
[0079] (3) The in vitro transcription system was prepared according to the system shown in Table 6, and the reaction was carried out at 37℃ for 2 h;
[0080] Table 6 In vitro transcription system
[0081]
[0082] (4) The DNA template removal system was prepared according to the system shown in Table 7, and the reaction was carried out at 37℃ for 10 min;
[0083] Table 7 DNA template removal system
[0084]
[0085] (5) Prepare the following DNA precipitation system according to the system shown in Table 8, mix well, and store at -80°C overnight;
[0086] Table 8 DNA precipitation system
[0087]
[0088] (6) Discard the supernatant, add 500 μL of 70% ethanol;
[0089] (7) Centrifuge at 14000 rpm, 4°C, 5 min;
[0090] (8) Discard the supernatant, short spin, and aspirate the residual supernatant, and dry at room temperature (about 4-5 min);
[0091] (9) Add 100 μL of 50% deionized formamide, mix gently, and stand on ice for 30 min;
[0092] (10) Dispense and freeze at -80°C.
[0093] 2. Material fixation, embedding and sectioning
[0094] (1) Place the V2 and V4 period B73 inbred corn shoot tips (without leaves and root tissues) in the RNA-free FAA fixing solution, vacuum to 0.8 Mpa, and stand for 30 min;
[0095] (2) Replace the FAA solution and fix at 4°C for 16 h;
[0096] (3) Dehydrate the material at room temperature by alcohol gradient, and the alcohol concentration is 70%, 80%, 90%, 100%, 100%, 100%, 30-60 min for each gradient;
[0097] (4) 75% alcohol + 25% xylene, 50% alcohol + 50% xylene, 25% alcohol + 75% xylene, 100% xylene, 100% xylene, 100% xylene, 50% xylene + 50% paraffin. Prepare the treatment solution according to the above order, and treat the material for 30-60 min;
[0098] (5) Treat the material with 50% xylene + 50% paraffin xylene, and store in a 42°C incubator overnight;
[0099] (6) Treat the material with 100% paraffin and store in a 63°C incubator, replace the paraffin 2-3 times a day, and continue for 3-7 days;
[0100] (7) Embed the material in paraffin and solidify;
[0101] (8) The embedded material was sectioned using a Leica tissue microtome and placed on a RNAse-free slide at 8 mm thickness;
[0102] (9) The sections were placed in a 42°C slide warmer overnight.
[0103] 3. In situ hybridization
[0104] (1) The sections were gradient dehydrated in the following order and times: xylene 10 min, xylene 10 min, 100% ethanol 2 min, 100% ethanol 2 min, 95% ethanol 2 min, 95% ethanol 2 min, 90% ethanol 2 min, 80% ethanol 2 min, 60% ethanol 2 min, 30% ethanol 2 min, DEPC water 2 min;
[0105] (2) The sections were treated with 2xSSC solution for 20 min;
[0106] (3) The sections were placed in DEPC water for 5 min;
[0107] (4) The sections were placed in Proteinase K solution for 20 min;
[0108] (5) 0.2% glycine was dissolved in 1xPBS buffer and used to treat the sections for 2 min;
[0109] (6) The sections were treated with 1xPBS buffer for 2 min;
[0110] (7) Step (6) was repeated;
[0111] (8) The sections were treated with 4% PFA solution for 10 min;
[0112] (9) The sections were treated with 1xPBS buffer for 5 min;
[0113] (10) Step (9) was repeated;
[0114] (11) 662.5 μΐ of triethanolamine, 375 μΐ of 37% HC1 solution, and 250 μΐ of acetic anhydride were dissolved in 50 mL of 1xPBS buffer and used to treat the sections for 10 min;
[0115] (12) The sections were treated with 1xPBS for 5 min;
[0116] (13) Step (12) was repeated;
[0117] (14) The slides are treated in the following order and time: 30% alcohol 30 s, 60% alcohol 30 s, 80% alcohol 30 s, 90% alcohol 30 s, 95% alcohol 30 s, 100% alcohol 30 s, 100% alcohol 30 s;
[0118] (15) The slides are left to dry in the fume hood;
[0119] (16) The hybridization buffer is preheated at 65 °C;
[0120] (17) 200 µL of the prepared hybridization probe mixture is evenly coated on the glass slide where the sample is placed, and the cut sealing film is covered; the hybridization probe mixture is: 3 µL of probe + 40 µL of 50% deionized formamide solution + 160 µL of hybridization buffer;
[0121] (18) The slide is placed in a wet box, 5 layers of filter paper are placed under the wet box, 0.2×SSC solution is added to moisten, the cover is covered and the plastic wrap is sealed;
[0122] (19) The slide is placed in a 53 °C oven for hybridization for 16-20 h;
[0123] (20) The slide is placed in 2×SSC solution preheated at 55 °C for 1 h;
[0124] (21) The slide is placed in 1×SSC solution preheated at 55 °C for 1 h;
[0125] (22) The slide is placed in 1×SSC solution preheated at 55 °C for 1 h;
[0126] (23) The slide is placed in NTE solution at 37 °C for 5 min;
[0127] (24) Step (23) is repeated 3 times;
[0128] (25) The slide is treated with 1×PBS buffer at room temperature for 5 min;
[0129] (26) The slide is treated with Roche blocking solution for 45 min; the Roche blocking solution is: 1% blocking regent + 1×TBS buffer, preheated at 70 °C;
[0130] (27) A mixed solution is prepared by adding BSA at a final concentration of 1% and Triton 100 at a final concentration of 0.3% in 1×TBS buffer, and is used to treat the slide for 45 min;
[0131] (28) 200 μΐ of the digoxin primary antibody mixture was evenly spread on the glass slide where the sample was placed; the digoxin antibody mixture was: 3 μΐ of digoxin primary antibody + 197 μΐ of 1 x TBS buffer containing 1% BSA, 0.3% Triton 100;
[0132] (29) The slide was covered with the cut sealing film and placed in a humid chamber at room temperature for 2-3 h;
[0133] (30) The slide was treated with 1 x TBS buffer containing 1% BSA, 0.3% Triton 100 for 15 min;
[0134] (31) Step (30) was repeated 3 times;
[0135] (32) The slide was treated with buffer 3 for 5 min; buffer 3 was: a solution containing 0.1 M Tris-HCl (pH 9.5), 0.1 M NaCl, 50 mM MgCl2;
[0136] (33) Step (32) was repeated 2 times;
[0137] (34) 200 μΐ of the color developing solution mixture was evenly spread on the glass slide where the sample was placed; the color developing solution mixture was: 4 μΐ of NBT / BCIP + 196 μΐ of buffer 3;
[0138] (35) The slide was covered with the cut sealing film and placed in a humid chamber in the dark for 1-3 d;
[0139] (36) The slide was soaked in buffer 3 to unroll the film and dried under a fume hood;
[0140] (37) The slide was mounted with 50% glycerol;
[0141] (38) Photographed and observed.
[0142] Example 4
[0143] Phylogenetic tree analysis
[0144] (1) The full-length amino acid sequence of Zm00001d042258 downloaded from the MaizeGDB website was used for BLAST search in the Uniprot (http: / / www.uniprot.org / ) database to find the closest homologous proteins from other plant species;
[0145] (2) The Megalign program in the Clustal X software package was used to optimize the multiple sequence alignment. The Neighbor-Joining Algorithm phylogenetic tree of homologous proteins was constructed using MEGA7.0.
[0146] Example 5
[0147] Preparation, transformation and ZmLAX2 Subcellular localization of the
[0148] (1) The solutions required for the preparation and transformation of corn protoplasts were prepared:
[0149] Enzymatic solution (10 mL): 100 mM MES (pH 5.7) 1 mL, D-Mannitol 0.91 g, Cellulase R-10 0.15 g, Macerozyme 0.075 g (after the above solution is prepared, heat at 55 ℃ for 10 min), BSA 0.01 g, 100 mM CaCl2 1 mL, β-mercaptoethanol 4 µL, ddH2O to 10 mL;
[0150] W5 solution: 2 mM MES (pH 5.7), 154 mM NaCl, 125 mM CaCl2, 5 mM KCl;
[0151] Mmg solution: D-Mannitol 0.4 M, 15 mM MgCl2, 4 mM MES (pH 5.7);
[0152] 40% PEG: 40% PEG 4000, D-Mannitol 0.2 M, 0.1 M CaCl2;
[0153] (2) Corn seeds were soaked in ddH2O until germination, and the germinated seeds were placed on moist nutrient soil and cultured at 28 ℃ in the dark for about 10 d;
[0154] (3) The leaves of the cultured corn yellowing seedlings were cut into thin strips with a blade and placed in the enzymatic solution and wrapped with tin foil to avoid light;
[0155] (4) Vacuum to 0.8 kg / cm 2 for 30 min;
[0156] (5) Incubate at 28 ℃ for 3 h;
[0157] (6) The enzymatically treated protoplasts were filtered using 3 layers of filter cloth, washed with an equal volume of W5 solution, and gently mixed;
[0158] (7) Centrifuge at 100×g for 4 min;
[0159] (8) Aspirate the supernatant, add 20 mL of W5 solution to resuspend the cells, and then filter the protoplasts through 3 layers of filter cloth;
[0160] (9) Add 20 mL of W5 solution, centrifuge at 100×g for 4 min, and discard the supernatant;
[0161] (10) Add an appropriate amount of mg solution to the protoplasts obtained in step (9) to suspend them, and mix gently;
[0162] (11) Take 100 µL of protoplasts obtained in step (10) and add them to a 2 mL round-bottom centrifuge tube containing 6 µg of plasmids, and mix well;
[0163] (12) Add 104 µL of 40% PEG and mix gently; let stand at room temperature for 12 min;
[0164] (13) Add 1.5 mL of W5 solution to the solution from step (12) and shake gently.
[0165] (14) Centrifuge at 100×g for 4 min and discard the supernatant;
[0166] (15) Add 200 µL of W5 solution to the protoplasts obtained in step (14) and incubate at 28 °C in the dark for about 12 h;
[0167] (16) Mix gently, take about 20 µL of protoplast solution onto a glass slide, cover with a coverslip and place under a Zeiss LSM 980 ultra-high resolution confocal microscope to observe fluorescence and take pictures.
[0168] The plasmids used to transform maize protoplasts were: the subcellular localization vector ZmLAX2-GFP and the nuclear localization marker pBI221-H2B-mcherry plasmid.
[0169] Experimental results:
[0170] corn ZmLAX2 Gene expression levels in the transcriptome of ear meristem, such as Figure 1 As shown in the figure, BEL represents belowear leaf, AEL represents above ear leaf, SAM represents shoot apical meristem, EL represents ear leaf, and 16 d, 21 d, 28 d, 35 d, 42 d and 49 d represent the corresponding number of days;ZmLAX2 The gene is highly expressed in the ear leaf (AEL) and the leaf at the ear position (EL) at each developmental stage of the maize.
[0171] ZmLAX2 The correlation analysis of the number of ear leaves in the natural population is shown in FIG. 1, wherein G and A represent different SNP sites, respectively. Figure 2 The correlation analysis of the candidate gene shows that the site of chr3.S_157658890 plays an important role in determining the number of ear leaves. ZmLAX2
[0172] Figure 3 and Figure 4 The homologous gene is shown in FIG. 3. ZmLAX2
[0173] Figure 5 Compared with the wild type, the mutant has a reduced number of fruiting ears and ear leaves, proving that the mutant gene is involved in the initiation of the AM (lateral meristem) of the maize and the regulation of the ear leaf. lax2 ZmLAX2
[0174] Figure 6 The mRNA in situ hybridization experiment result shows that the gene is expressed in the SAM (apical meristem), the young leaf primordium and the leaf axil of P6; the qRT-PCR experiment further proves that the gene is highly expressed in the SAM and the meristem boundary meristem. ZmLAX2 ZmLAX2
[0175] The subcellular localization detection in the maize protoplast shows that the ZmLAX2-GFP fusion protein is mainly located in the nucleus. ZmLAX2 Figure 7
[0176] Figure 8 The field phenotype analysis shown in FIG. 4 shows that, compared with the wild type, the plant height, the number of fruiting ears and the length of the leaf at the ear position of the mutant are reduced, but the total number of leaves is increased. zmlax2 The nucleotide sequence of the maize gene is shown as follows:
[0177] ZmLAX2
[0178] 5'-ATGGTCCCAACAACTAGGAACCTGTTGTTGCACCATGACGTCGACGGCAAGAGCAGCCGCGGCAGGCCGTGCTACCACCCGGCCGGCCACCAGTACTACGTCGGCATCGCCGCCCAACTGGAGGCCTCGGCGGCATCCGCCGCGTGGCAGCAGGACCACCAGAGCAAGCCGTCGAGATCCCCTCGGCTGCTGGGCATGGCAGACGACGAGCAGCCGGACGCGGCGGCAGGGCCCAGCACGAGCTCCGCATCACCGGGCGGCGCCGGCGCAGGAAACGGACGAGGAGGAGACTGGCTCCAGCTTGGCCTAGCCGCAGCCGCGGCGTCGGCGTCGTCCTCCGGCGACAACAGCACCATGGATCCGGATCCCCCGGCTCCCACGGAGCTGGAGCTTTCCGCCTATGACAAGCGGAACGCCTGCAGGATGAGGCGGCCGCCGTTGTTCCCGCTGCCGCTTAGGAGCTACCACCCGCCCTACGGCTACGGACGGTATCGACCGGCGGCGGCAGCAGCTAGCCGGTCCATGCCGTTCATGCCTCCGTCCAGGTGCTCCAGCAGCGATGCCATAATAAGAGTCATCAGCCCGCCGCGGCGGCGGACGGAGGCGCCCAGGCTGTGGCTGACGCTTCAGGCAGCTCCCAACCAAAGTAGAGAGCCTGTTTTGCCTCAGATAGCAAAGAGCTACCTAAGAATCAAGGACAGCAACATGACGGTGGAGGTGGTGATGAAGTACTTGGCCGAGAAGCTAGGGGTCGCGCGGTCTCGGTCTCGGTCTCGGTCTCATCAGGTATGCATCAACTCCTGCACCATTACGTTATTATTCGGAGTGCTCTAA-3' (SEQ ID NO. 1).
[0179] Although the present application has been described in detail with particular reference to certain embodiments thereof, it should be understood that modifications and alterations can be made hereto without departing from the scope and spirit of the application. It is also understood that the present application covers all conceivable modifications and alterations of the application.
Claims
1. Zea mays ZmLAX2 application of the gene, characterized in that: The corn ZmLAX2 application of the gene in regulating the number of leaves on ear, the length of leaves on ear, the total number of leaves, the number of ears, the plant height or the ear height; the ZmLAX2 The nucleotide sequence of the gene is the nucleotide sequence shown in SEQ ID NO.
1.
2. Use according to claim 1, characterized in that: Regulation of leaf number on ear, leaf length on ear, total leaf number, ear number, plant height, or ear height on a maize ear by a biological material selected from any one of: (1) a cassette comprising the maize ZmLAX2 gene; (2) a recombinant vector comprising the corn gene ZmLAX2 of claim 1. (3) a transgenic cell line containing the corn ZmLAX2 gene.
3. Use according to claim 1, characterized in that: The maize ZmLAX2 The nucleotide sequences of the primer pairs for cloning the genes are shown in SEQ ID NO. 2 and SEQ ID NO.
3.
4. Use according to claim 1, characterized in that: a primer pair for specifically detecting the corn ZmLAX2 The nucleotide sequences of the primer pair for the gene are shown in SEQ ID NO. 4 and SEQ ID NO. 5.
Citation Information
Patent Citations
Application of genes of auxin influx carrier AUX1 / LAX family in breeding of corns and broomcorns
CN102492718A