SNP molecular marker of sorghum stem diameter related gene SbSD15 and application thereof

Abstract

This invention discloses genes related to sorghum stem diameter. SbSD15 This invention relates to the molecular markers of SNPs and their applications, and pertains to the fields of molecular biology and crop breeding technology. The technical problem this application aims to solve is how to rapidly and accurately identify the stem diameter trait of sorghum. To this end, it provides an application for detecting the polymorphism or genotype of SNPs in the sorghum genome, wherein the SNP is the 138th nucleotide of SEQ ID NO: 1 in the sequence listing, and its nucleotide type is G or A. This application also provides compositions and / or kits for detecting the SNP. The method established by this invention can be used to predict the phenotype of sorghum stem diameter, can be used for early screening of sorghum to be screened, and can be used for marker-assisted breeding of sorghum. It has important application value in the research of discovering sorghum germplasm resources with heavier stem diameter and breeding tall and thick sorghum varieties.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and crop breeding technology, specifically to genes related to sorghum stem diameter. SbSD15 SNP molecular markers and their applications. Background Technology

[0002] sorghum ( Sorghum bicolor Sorghum, also known as common sorghum, is an annual herbaceous plant belonging to the genus Sorghum of the Poaceae family. Originating in Africa, it is one of the world's five major crops, classified as a C4 crop, and widely cultivated in arid, semi-arid tropical, subtropical, and temperate regions. It boasts high photosynthetic efficiency and high biomass yield, serving as both pasture and fodder, silage, and hay. As one of my country's oldest grain crops, sorghum possesses drought resistance, tolerance to poor soil, and strong stress resistance, making it a major dryland crop in arid and saline-alkali areas. It is also an important grain crop in northern and western my country, showing broad application prospects in animal husbandry and aquaculture, and is considered a promising new forage crop.

[0003] Soil salinization is a widespread problem worldwide, with approximately 20% of usable arable land already salinized or undergoing salinization to varying degrees. The loss of land suitable for crop cultivation has become a serious issue for agricultural sustainability. Salt is one of the most significant environmental stressors, drastically reducing arable land area while also lowering crop yields and quality. Using salt-tolerant crops is an important strategy to mitigate this problem. Sorghum was previously considered to have moderate salt tolerance, and the temperate regions of western and northeastern China are the main sorghum-growing areas. It possesses strong drought resistance, flood resistance, salt and alkali tolerance, and high-temperature resistance, making it suitable for planting on saline-alkali and arid marginal lands. Sorghum is renowned for its strong resilience and wide adaptability, with salt tolerance being one of its main characteristics. Therefore, planting salt-tolerant sorghum varieties is an effective measure to fully utilize saline-alkali land resources and increase sorghum yields.

[0004] Stalk diameter, as an important trait of sorghum stalks, plays a crucial role not only in lodging resistance but also in increasing stalk yield and monitoring plant growth. Studies have shown that compared to major crops such as corn, wheat, and rice, sorghum can achieve higher biomass yields and economic benefits when grown on saline-alkali land. The starch in the grain or the sucrose-rich juice in sweet sorghum stalks can be fermented into biofuels and bioproducts. Furthermore, sorghum, especially photoperiod-sensitive varieties, can produce large quantities of aerial lignocellulose biomass, serving as a sustainable and economically viable conversion feedstock.

[0005] The application relates to a method for identifying or assisting in identifying the stem thickness of sorghum, and a method for breeding sorghum. SUMMARY

[0006] The application aims to solve the problem of how to identify or assist in identifying the stem thickness of sorghum or how to breed sorghum.

[0007] To solve the above technical problem, the application provides the use of a substance for detecting the polymorphism or genotype of a SNP in a sorghum genome, the SNP being a site in the sorghum genome, the nucleotide type of which is G or A, the 138th nucleotide in SEQ ID NO: 1 in the sequence listing; the use can be any of the following:

[0008] A1) the use of the substance in identifying or assisting in identifying the stem thickness of sorghum,

[0009] A2) the use of the substance in breeding sorghum,

[0010] A3) the use of the substance in preparing a product for identifying or assisting in identifying the stem thickness of sorghum,

[0011] A4) the use of the substance in preparing a product for breeding sorghum.

[0012] In the above use, the substance can be B1), B2) or B3) as follows:

[0013] B1) the substance is a primer composition for amplifying a DNA fragment of the sorghum genome containing the SNP site,

[0014] B2) the substance is a PCR reagent containing the primer composition of B1),

[0015] B3) the substance is a kit containing the primer composition of B1) or the PCR reagent of B2).

[0016] In the above use, the genotype of the SNP can be genotype GG, genotype AA or genotype GA, genotype GG is a homozygous type of the SNP being G; genotype AA is a homozygous type of the SNP being A; and genotype GA is a heterozygous type of the SNP being G and A.

[0017] The SNP is located in a gene in the sorghum genome (BTx623(v3.1) sequence as the reference genome, the SNP is located in a gene SbSD15 The gene is located on the 10th chromosome of sorghum at 7299379-7306909, and is related to the stem thickness of sorghum. SbSD15 The gene is located on the 10th chromosome of sorghum at 7299379-7306909, and is related to the stem thickness of sorghum.

[0018] The present application also provides a method for identifying or assisting in identifying the stem thickness trait of sorghum, which comprises detecting the genotype of the SNP site in the genome of the sorghum to be tested, and identifying or assisting in identifying the stem thickness trait of sorghum according to the genotype, wherein the SNP site is the SNP site described above.

[0019] The method can comprise detecting the genotype of the SNP in the sorghum to be tested, and identifying or assisting in identifying the stem thickness of sorghum according to the genotype of the sorghum to be tested, wherein the stem thickness of the sorghum with genotype AA is significantly higher or candidate higher than that of the sorghum with genotype GG.

[0020] Alternatively, the method for identifying or assisting in identifying the stem thickness trait of sorghum can be any of the following:

[0021] (1) The sorghum to be tested with genotype AA of the SNP is or is candidate for high-stem-thickness sorghum.

[0022] (2) The average stem thickness of the sorghum to be tested with genotype AA of the SNP is significantly higher or candidate higher than that of the sorghum to be tested with genotype GG.

[0023] As an embodiment, the method for identifying or assisting in identifying the stem thickness of sorghum can comprise the following steps:

[0024] (1) Using the genomic DNA of the sorghum to be tested as a template, KASP is performed using primer composition F1; the primer composition F1 can be composed of primer F1-A, primer F1-B, and primer F1-C;

[0025] The primer composition F1 has primer F1-A with a nucleotide sequence that is a single-stranded DNA molecule of SEQ ID NO: 2 in the sequence listing or a nucleotide sequence that is 22-42 of SEQ ID NO: 2 in the sequence listing;

[0026] The primer composition F1 has primer F1-B with a nucleotide sequence that is a single-stranded DNA molecule of SEQ ID NO: 3 in the sequence listing or a nucleotide sequence that is 22-43 of SEQ ID NO: 3 in the sequence listing;

[0027] The primer composition F1 has primer F1-C with a nucleotide sequence that is a single-stranded DNA molecule of SEQ ID NO: 4 in the sequence listing.

[0028] (2) After step (1) is completed, fluorescence detection is performed to determine the genotype of the SNP site of the sorghum to be tested;

[0029] (3) Identifying the stem thickness of the sorghum to be tested according to the genotype result: the average stem thickness of the sorghum to be tested with genotype AA of the SNP is significantly higher or candidate higher than that of the sorghum to be tested with genotype GG.

[0030] The application also provides the use of the above method in sorghum breeding.

[0031] The application also provides a method for sorghum breeding, which comprises detecting the genotype of the SNP site in the sorghum genome, and selecting sorghum with the genotype AA of the SNP site as a parent for breeding, wherein AA is the homozygous type of A of the SNP site.

[0032] As an implementation method, the method for sorghum breeding can comprise the following steps:

[0033] (1) using the genomic DNA of the sorghum to be tested as a template, and performing KASP using the above primer set F1;

[0034] (2) after step (1) is completed, performing fluorescence detection to determine the genotype of the SNP site of the sorghum to be tested;

[0035] (3) selecting sorghum with the genotype AA for breeding of high stem thickness, and selecting sorghum with the genotype GG for breeding of low stem thickness.

[0036] In the present application, the index of plant breeding includes the stem thickness of sorghum, and the purpose of plant breeding includes breeding sorghum with high stem thickness.

[0037] The stem thickness of sorghum described above can be the stem thickness of mature sorghum.

[0038] In the above application and method, the sorghum can be a pure line sorghum inbred line. In the above application and method, the sorghum inbred line can be selected as a parent for breeding.

[0039] In the above application and method, the stem thickness of the sorghum variety with low stem thickness is relative to the hybrid parent sorghum. If the stem thickness of the two hybrid parent sorghums is the same, the stem thickness of the sorghum variety with high stem thickness can be equal to or higher than that of the hybrid parent sorghum; if the stem thickness of the two hybrid parent sorghums is not the same, the stem thickness of the sorghum variety with high stem thickness can be equal to or higher than that of the hybrid parent sorghum with higher stem thickness.

[0040] The application also provides a product for detecting the polymorphism or genotype of the SNP site in the sorghum genome, which can be the above SNP site, and the product contains the above substance, and the product can be any one of the following:

[0041] C1) a product for detecting or assisting in detecting single nucleotide polymorphism or genotype related to the stem thickness trait of sorghum,

[0042] C2) a product for identifying or assisting in identifying the stem thickness trait of sorghum,

[0043] C3) a product for sorghum breeding,

[0044] C4) a product of screening or breeding of a single plant or strain or line or variety of Sorghum bicolor according to the stem thickness trait of Sorghum bicolor.

[0045] In the above-mentioned applications, methods and products, the substance can be a reagent or instrument required for determining the polymorphism or genotype of the SNP by at least one of the following methods: DNA sequencing, restriction enzyme digestion fragment length polymorphism, single strand conformation polymorphism, denaturing high performance liquid chromatography and SNP chip. Among them, the SNP chip includes chip based on nucleic acid hybridization reaction, chip based on single base extension reaction, chip based on allele specific primer extension reaction, chip based on "one-step" reaction, chip based on primer ligation reaction, chip based on restriction enzyme reaction, chip based on protein DNA binding reaction, and chip based on fluorescence molecule DNA binding reaction.

[0046] Specifically, the product can be D1), D2) or D3) as follows:

[0047] D1) the product is a primer composition for amplifying a fragment of Sorghum bicolor genomic DNA containing the SNP site,

[0048] D2) the product is a PCR reagent containing the primer composition of D1),

[0049] D3) the product is a kit containing the primer composition of D1) or the PCR reagent of D2).

[0050] In the above, the primer composition consists of primer F1-A, primer F1-B and primer F1-C;

[0051] The primer F1-A is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 2 or a single-stranded DNA with a nucleotide sequence of 22-42 of SEQ ID NO: 2 in the sequence listing;

[0052] The primer F1-B is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 3 or a single-stranded DNA with a nucleotide sequence of 22-43 of SEQ ID NO: 3 in the sequence listing;

[0053] The primer F1-C is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 4.

[0054] In the above applications, methods and products, the primer composition can or can not be labeled with a label. The label refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Labels include, but are not limited to, dyes; radioactive labels such as 32P; binding moieties such as biotin; hapten such as digoxigenin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, etc. The label can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The label can include or be combined with a nucleic acid or protein sequence, provided that the sequence comprising the label is detectable. In some embodiments, the nucleic acid is directly detected without a label (e.g., the sequence is directly read).

[0055] The primer composition F1 as described can be a primer composition consisting of a single-stranded DNA whose nucleotide sequence is positions 22-42 of SEQ ID NO: 2 in the sequence listing, a single-stranded DNA whose nucleotide sequence is positions 22-43 of SEQ ID NO: 3 in the sequence listing, and a single-stranded DNA whose nucleotide sequence is SEQ ID NO: 4 in the sequence listing, and the primer composition F1 can also be a primer set of a single-stranded DNA represented by SEQ ID NO: 2 in the sequence listing, a single-stranded DNA represented by SEQ ID NO: 3 in the sequence listing, and a single-stranded DNA represented by SEQ ID NO: 4 in the sequence listing. SEQ ID NO: 2 in the sequence listing consists of 42 nucleotides, the first to 21st nucleotides are a FAM sequence (as a label), and the 22nd to 42nd nucleotides are a specific sequence; SEQ ID NO: 3 in the sequence listing consists of 43 nucleotides, the first to 21st nucleotides are a HEX sequence (as a label), and the 22nd to 43rd nucleotides are a specific sequence.

[0056] The present application also provides a DNA molecule whose nucleotide sequence is SEQ ID NO: 1 in the sequence listing.

[0057] The use of the above DNA molecule is also within the scope of the present application, and the use can be any one of the following:

[0058] E1) use of the DNA molecule for identifying or assisting in identifying a sorghum stalk thickness trait,

[0059] E2) use of the DNA molecule in sorghum breeding,

[0060] E3) use of the DNA molecule for preparing a product for identifying or assisting in identifying a sorghum stalk thickness trait,

[0061] E4) use of the DNA molecule for preparing a product for sorghum breeding.

[0062] E5) The application of the DNA molecule described therein in the screening or breeding of sorghum individual plants, lines, strains, or varieties based on the sorghum stem thickness trait.

[0063] E6) The application of the DNA molecule described therein in the assisted screening or assisted breeding of sorghum individual plants, lines, strains or varieties based on the sorghum stem thickness trait.

[0064] Optionally, in the above applications, the DNA molecule serves as a detection target.

[0065] The substance that detects the SNP polymorphism and genotype or the haplotype can be combined with other substances (such as substances that detect single nucleotide polymorphisms or genotypes of other molecular markers associated with sorghum stem diameter) to prepare a product for identifying sorghum stem diameter varieties.

[0066] This invention utilizes the analysis of sorghum inbred line populations... SbSD15 Genetic variation analysis revealed one SNP located in a gene in the sorghum genome associated with stem diameter. SbSD15 The gene sequence, specifically position 138 of SEQ ID NO: 1, provides primer compositions for amplifying sorghum genomic DNA fragments including the stated SNP, and also provides a method for identifying or assisting in the identification of sorghum stem diameter using these primer compositions. The method established in this invention can be used to predict the phenotype of sorghum stem diameter, for early screening of sorghum to be screened, and for marker-assisted breeding of sorghum. It has significant application value in the research of discovering sorghum germplasm resources with high stem diameter and breeding tall sorghum varieties. Detailed Implementation

[0067] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0068] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0069] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0070] The experimental methods in the following examples are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0071] The 174 sorghum inbred line association population in the following examples was provided by the Ecological Grassland Husbandry Engineering Laboratory of the Institute of Botany, Chinese Academy of Sciences, and the breed names of the association population are as follows: Accession in Supplemental Table 10 in Xiaoyuan Wu, et al.. Genomic footprints of sorghum domestication and breeding selection for multiple end uses. Molecular Plant, 2022, VOLUME 15, ISSUE 3, P537-551 (DOI: https: / / doi.org / 10.1016 / j.molp.2022.01.002). The detailed information of the varieties is shown in Table 1, and the germplasm resource information can also be obtained from the SorGSD website (https: / / ngdc.cncb.ac.cn / sorgsd / sorgsd / ).

[0072] Example 1, discovery of SNP molecular markers associated with sorghum stem diameter

[0073] I. Stem diameter statistics of the test materials

[0074] 1. Planting of the test materials

[0075] In 2021 and 2022, 174 sorghum inbred line association population germplasm resources were planted in farmland soil in Nonggao New District, Dongying City, Shandong Province, China, using a randomized complete block design. The test plot was 3 m long and 2 m wide, with 5 rows of 10 plants each, a plant spacing of 0.3 m, and a row spacing of 0.5 m, with normal irrigation.

[0076] 2. Stem diameter statistics of the test materials

[0077] After the 174 sorghum inbred line association population was fully matured, 3 plants were selected from each material, and the stem diameter of the middle part of the third node of the main stem of each plant was counted. The average value of three repetitions was taken as the final result of the stem diameter of the sample, as shown in Table 1.

[0078] 3. Calculation of the stem diameter BLUP value of the test materials

[0079] The best linear unbiased prediction (BULP) of stem thickness phenotype in 2021 and 2022 was performed using the R package lme4. The calculated BLUP values ​​were then used for subsequent genome-wide association studies. The formula for calculating the BLUP value is as follows:

[0080] Y= (1|Line) + (1|Year) + (1|Rep in Line:Year) + (Line:Year)

[0081] Where Y represents the calculated BLUP value of stem diameter, Line represents the natural population of sorghum, Year represents the year, and Rep represents repetition.

[0082] II. Genes SbSD15 Discovery of related SNP molecular markers

[0083] 1. Whole-genome sequencing of 174 sorghum inbred line associated populations

[0084] Using HaploView software (https: / / www.broadinstitute.org) to... SbSD15 Linkage disequilibrium (LD) analysis was performed on 168 SNP sites in the gene sequence, and r was set. 2 A threshold of >0.8 was used as the SNP locus for tight linkage, and tag SNP loci significantly associated with sorghum stem diameter were screened. The t-test using GraphPad Prism v8.0 software (https: / / www.graphpad-prism.cn) was used to analyze the significant differences in stem diameter corresponding to different alleles at the tag SNP loci, and significantly different superior allelic variations were screened as functional SNP loci. One-way ANOVA was used to evaluate the selected alleles. SbSD15 Differential analysis was performed on haplotype combinations.

[0085] 2. Genes SbSD15 Discovery of related SNP molecular markers

[0086] Based on the stem diameter of sorghum inbred lines and their genome sequencing results, a gene associated with sorghum stem diameter was screened. SbSD15The genotype of the gene. The gene includes one SNP site corresponding to the 7306131th position on the 10th chromosome of the inbred line BTx623 of sorghum (BTx623(v3.1) sorghum genome sequence information), and the nucleotide is G or A. The genotype detection results of each sorghum variety are shown in Table 1. The results show that the SNP site has two genotypes (referred to as SNP genotype), namely GG or AA, and the genotype GG is the homozygous type of SNP G, and the genotype AA is the homozygous type of SNP A.

[0087] III. Genes SbSD15 Design of related genotype AA molecular marker specific primer and establishment of its method

[0088] 1. Design of related SNP site genome specific primer

[0089] The specific primer sequence of the SNP (SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 in the sequence listing) is synthesized by Zhongyu Jinbao Biotechnology Co., Ltd.

[0090] The primer set F1 for identifying the polymorphism of the SNP site is as follows:

[0091] Specific primer F1-A (SEQ ID NO: 2): 5′- SbSD15 GCACAATGGTGGTTGGTGCTG-3′;

[0092] Specific primer F1-B (SEQ ID NO: 3): 5′- GAAGGTGACCAAGTTCATGCT GGCACAATGGTGGTTGGTGCTA-3′;

[0093] Universal primer F1-C (SEQ ID NO: 4): 5′-CGACTGTCCATCTTCAGTGAGGATA-3′.

[0094] The nucleotide sequence of the KASP molecular marker containing the SNP site developed by the present application is shown in SEQ ID NO: 1 (173bp), and the nucleotide at the 138th position of the sequence is G or A, represented by R.

[0095] 5′-ATCATATTTCTCTATATAGTGCGCAGACTTCTAGTGTATCCCCTGGCAGCAAAGAGCATGTTTATAATTCCTTTCTTATTTTTATAATTAAGCAGATGCCTCAGGTGTTAACAGCTGGCACAATGGTGGTTGGTGCTRGTGCAGAAAATATCCTCACTGAAGATGGACAGTCG-3′.

[0096] The primer set F1 for identifying the polymorphism of the SNP site is designed according to the sequence SEQ ID NO: 1 (sense strand).

[0097] The underlined sequence in the primer F1-A is the FAM sequence; the underlined sequence in the primer F1-B is the HEX sequence. The single-stranded DNA molecule amplification sequence shown in the sequence SEQ ID NO: 2 and SEQ ID NO: 4 is a fragment of the sequence SEQ ID NO: 1 with the SNP site being G, and the fluorescence signal of the fluorescent group combined with the FAM sequence in the template can be read by using an enzyme marker or a fluorescence quantitative PCR instrument;

[0098] The single-stranded DNA molecule amplification sequence shown in the sequence SEQ ID NO: 3 and SEQ ID NO: 4 is a fragment of the sequence SEQ ID NO: 1 with the SNP site being A, and the fluorescence signal of the fluorescent group combined with the HEX sequence in the template can be read by using an enzyme marker or a fluorescence quantitative PCR instrument.

[0099] 2. Establishment of a method for detecting the stem thickness of sorghum by using KASP molecular markers

[0100] 2.1 DNA extraction

[0101] The genomic DNA of the test sorghum variety is extracted and dissolved with ddH2O as a template for PCR amplification.

[0102] 2.2 PCR amplification and fluorescence signal detection

[0103] The template obtained in step 1 is subjected to PCR amplification using the primer set F1 to detect the polymorphism (nucleotide type) and genotype of the SNP site; the PCR product of the primer set F1 is subjected to fluorescence data reading by using a Douglas-Araya high-throughput flow line type fluorescence signal scanner, and the fluorescence signal is processed by using a Douglas special software-Kraken.

[0104] Preparation of primer mixture: first, the three primers F1-A, F1-B and F1-C are diluted with ddH2O to 100 mmol·L -1 , respectively, to obtain primer F1-A solution, primer F1-B solution and primer F1-C solution. Take 60 μL of primer F1-A solution, 60 μL of primer F1-B solution and 150 μL of primer F1-C solution, and add 230 μL of 10 mM Tris-HCL to obtain primer mixture F1.

[0105] 2 μL PCR fluorescence quantitative instrument detection reaction system includes: genomic DNA 50 ng, primer mix F1 0.02 μL, LGC company 1 × KASP Mix (Low Rox) 0.6 μL, the rest is ddH2O. According to the operation manual of Douglas-Nexar and Soellex water bath system, edit program and run, save data.

[0106] If the F1 primer group PCR product shows only the fluorescence signal of the fluorescence group combined with the FAM sequence, the genotype of the SNP site to be tested in the sorghum is GG (i.e. the homozygous type of SNP site G in the sorghum genome); if it shows only the fluorescence signal of the fluorescence group combined with the HEX sequence, the genotype of the SNP site to be tested in the sorghum is AA (i.e. the homozygous type of SNP site A in the sorghum genome; if it shows both the fluorescence signal of the fluorescence group combined with the FAM sequence and the fluorescence signal of the fluorescence group combined with the HEX sequence, the genotype of the SNP site to be tested in the sorghum is GA (i.e. the heterozygous type of SNP site G and A in the sorghum genome).

[0107] Determination of genes GAAGGTCGGAGTCAACGGATT The genotype is determined, thereby identifying or assisting in identifying the stem thickness of the sorghum variety to be tested: the stem thickness of the sorghum corresponding to the genotype AA of the sorghum to be tested is significantly higher than that of the sorghum corresponding to the genotype GG.

[0108] Example 2, the application of the SNP molecular marker of the sorghum stem thickness significantly associated gene SbSD15 Application of the SNP molecular marker of the gene

[0109] Sorghum to be tested: 174 sorghum inbred line association population

[0110] I. Determination of sorghum stem thickness

[0111] The method is the same as in Example 1, and the results show that 174 sorghum inbred lines are planted in the farmland soil of Nonggao New District, Dongying City, Shandong Province, China, and there are significant differences in the stem thickness of different sorghum varieties. The BLUP value of the stem thickness of sorghum ranges from 8.81 to 28.38 mm, and the stem thickness of 90 sorghum inbred lines is more than 17.46 mm, accounting for about 51.72% of the association population.

[0112] II. Molecular identification or auxiliary identification of the stem thickness of sorghum inbred lines

[0113] Extract the genomic DNA of the sorghum to be tested and dissolve it with ddH2O as a template. The genomic specific primer SNP primer group F1 in Example 1 is used for PCR amplification, and the SbSD15 polymorphic information of the SNP site of the gene is obtained, thereby determining the genotype of the sorghum to be tested SbSD15The related genotype, thereby identifying or assisting in identifying the stem thickness of the test sorghum variety: the stem thickness of the sorghum (such as a sorghum inbred line) with AA genotype of the SNP to be tested is significantly higher than or higher than the sorghum (such as a sorghum inbred line) with GG genotype of the SNP.

[0114] The genotype of one SNP site and the stem thickness of the sorghum in 174 test sorghums are shown in Table 1 and Table 2. The SNP site of the test sorghum contains two genotypes of GG and AA (shown in the SNP genotype column). The test results show that among the 174 sorghum varieties, 45 sorghum varieties with genotype AA have a stem thickness higher than 17.46 mm, and 66 sorghum varieties with genotype GG have a stem thickness lower than 17.46 mm. The stem thickness of 71.43% of the sorghum varieties with genotype AA is higher than 17.46 mm, and the stem thickness of 59.46% of the sorghum varieties with genotype GG is lower than 17.46 mm. This indicates that it is effective to use genotype AA to eliminate low-stem-thickness sorghum varieties, select high-stem-thickness sorghum varieties with genotype AA, and use molecular markers for assisted selection of sorghum stem thickness.

[0115] Table 1, stem thickness and genotype of one SNP site of 174 sorghum inbred lines

[0116]

[0117] Note: IS: improved sweet sorghum; IG: improved grain sorghum; LG: local grain sorghum; AL: unknown sorghum; LB: local broom sorghum; Wild: wild sorghum; Sudangrass: forage sorghum; Weedy: weed sorghum.

[0118] The following examples use GraphPad Prism v8.0 statistical software to process data, and the experimental results are expressed as mean ± standard deviation. One-way ANOVA test is used, P<0.05 (*) indicates significant difference, P<0.01 (**) indicates extremely significant difference, and P<0.001 (*** ) indicates extremely significant difference.

[0119] When the significance level is 0.05, mark the smallest mean with a lowercase Latin letter a, and continue until a mean that is significantly different from it is marked with the letter b. Then compare the mean marked with the letter b with each mean above it that is greater than it, and add the letter b to all means that are not significantly different from it, and do not add the letter b to means that are significantly different. Repeat this process until the largest mean is marked and compared. Means that have the same letter are not significantly different; means that do not have the same letter are significantly different.

[0120] The difference significant analysis of two genotypes and stem diameter shows that the homozygous genotype (AA) of SNP of the stem diameter of sorghum is extremely significantly different from the homozygous genotype (GG) of sorghum (P<0.001 (***)), and the stem diameter of sorghum corresponding to the genotype SNP-AA is extremely significantly higher than or higher than the stem diameter of sorghum corresponding to the genotype SNP-GG.

[0121] Table 2 Genes SbSD15 SNP sites corresponding to the stem diameters of 174 sorghum inbred lines and difference analysis

[0122]

[0123] The above results show that SbSD15 The genotype is related to the stem diameter of sorghum: the stem diameter of the sorghum to be tested SbSD15 The stem diameter of the sorghum with the genotype AA is significantly higher than SbSD15 The stem diameter of the sorghum with the genotype GG, SbSD15 The genotype AA can be used as a molecular marker for identifying or assisting in identifying the stem diameter of different sorghum lines. In the breeding of sorghum for the purpose of breeding sorghum with a high stem diameter, the sorghum with the genotype AA can be selected as a parent for breeding. SbSD15 SbSD15 The genotype AA can be selected as a parent for breeding.

[0124] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under the same parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In general, according to the principle of the present application, this application intends to include any changes, uses or improvements of the present application, including changes made by conventional techniques known in the art, which are outside the scope disclosed in the present application.

Claims

1. Use of a substance for detecting polymorphism or genotype of SNP in a sorghum genome, characterized in that, The SNP is the 138th nucleotide of SEQ ID NO: 1 in the sequence listing, and the nucleotide type is G or A; the application is any one of the following: A1) the use of the substance in identifying or assisting in identifying the stem thickness trait of sorghum, A2) the use of the substance in screening or selecting sorghum single plants or strains or lines or varieties according to the stem thickness trait of sorghum, A3) the use of the substance in preparing a product for identifying or assisting in identifying the stem thickness trait of sorghum, The substance is B1), B2) or B3) as follows: B1) the primer composition for amplifying the sorghum genomic DNA fragment including the SNP site, B2) the PCR reagent containing the primer composition of B1), B3) the kit containing the primer composition of B1) or the PCR reagent of B2).

2. The use of claim 1, wherein the primer composition in B1) consists of primer F1-A, primer F1-B, and primer F1-C; The primer F1-A is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 2 in the sequence listing or a single-stranded DNA with a nucleotide sequence of 22-42 of SEQ ID NO: 2 in the sequence listing; The primer F1-B is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 3 in the sequence listing or a single-stranded DNA with a nucleotide sequence of 22-43 of SEQ ID NO: 3 in the sequence listing; The primer F1-C is a single-stranded DNA molecule with a nucleotide sequence of SEQ ID NO: 4 in the sequence listing.

3. A method for identifying or aiding in the identification of a sorghum stalk thickness trait, characterized in that, The method comprises detecting the genotype of the SNP site in the genome of the sorghum to be tested, and identifying or assisting in identifying the stem thickness trait of sorghum according to the genotype, wherein the SNP site is the SNP site described in claim 1, and the stem thickness of sorghum with genotype AA is higher than or is expected to be higher than that of sorghum with genotype GG.

4. The use of the method of claim 3 in sorghum breeding.

5. A method of breeding sorghum, characterized by, The method comprises detecting the genotype of the SNP site described in claim 1 in the genome of sorghum, and selecting sorghum with genotype AA of the SNP site as the parent for breeding, wherein AA is the homozygous type of the SNP site, and the breeding purposes include breeding sorghum with high stem thickness.

Images