Turnip extracting solution as well as preparation method and application thereof
The turnip extract obtained by the preparation method solves the problem of insufficient natural active ingredients in skin care products, and achieves multiple skin care effects of whitening, anti-oxidation, anti-inflammatory, moisturizing and anti-aging.
Patent Information
- Application Number
- CN202510813363.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-18
- Publication Date
- 2025-09-05
AI Technical Summary
Existing skin care products lack natural and effective active ingredients, especially the potential of Tibetan turnip in the field of skin care products has not been fully utilized.
Provided is a method for preparing a turnip extract. The turnip extract with a specific gravity of 1.01 g/ml is obtained through multiple decoctions, decolorization and concentration. The turnip extract is used in the development of whitening, anti-oxidation, anti-inflammatory, moisturizing and anti-aging products.
Turnip extract effectively inhibits melanin production, has anti-oxidation and anti-inflammatory properties, promotes skin moisturizing and collagen production, reduces collagen degradation, and has multiple skin care benefits.
Smart Images
Figure CN120585697A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of skin care products, in particular to a turnip extract and a preparation method and application thereof. Background Art
[0002] As time goes by, people's pursuit of a higher spiritual life has given rise to a preference for natural, safe, and effective ingredients. As a result, the industry centered around plant extracts has rapidly developed into an independent emerging sector, particularly in the cosmetics and skincare fields, where major brands are vying to launch new products containing plant extracts. Tibetan turnip (Brassicarapa L.), a plant considered both medicinal and edible in Tibetan medicine, is rich in active ingredients (such as vitamin C, flavonoids, and trace elements), resulting in a variety of pharmacological effects. Given its diverse active ingredients, we have focused on its potential in the skincare industry. However, to date, the potential and use of Tibetan turnip as a natural skincare ingredient has not been fully reported. Summary of the Invention
[0003] In order to solve the above problems, the present invention provides a turnip extract and its preparation method and application. The present invention studies the potential of turnip extract as a skin care ingredient and finds that it has good effects in whitening, anti-oxidation, anti-inflammatory, moisturizing and anti-aging, and is suitable for development as a new skin care ingredient.
[0004] In order to achieve the above object, the present invention provides the following technical solutions:
[0005] The present invention provides a method for preparing a turnip extract, comprising the following steps:
[0006] 1) mixing turnip with water and boiling to obtain a decoction;
[0007] The decoction is performed three times, wherein the mass ratio of the turnip to water is 1:6 in both the first and second decoctions, and 1:4 in the third decoction. The decoction conditions include: a temperature of 80° C. and a decoction time of 2 hours each time;
[0008] 2) Decolorizing, filtering and concentrating the decoction obtained in step 1) to obtain a turnip extract; concentrating the decoction at 80° C. The turnip extract has a specific gravity of 1.01 g / ml.
[0009] The present invention also provides a turnip extract prepared by the preparation method described in the above technical solution, wherein the specific gravity of the turnip extract is 1.01 g / ml.
[0010] The present invention also provides the use of the turnip extract described in the above technical solution in preparing skin whitening products.
[0011] Preferably, the turnip extract whitens the skin by inhibiting melanin production and tyrosinase activity.
[0012] The present invention also provides the use of the turnip extract described in the above technical solution in the preparation of skin antioxidant products.
[0013] The present invention also provides the use of the turnip extract described in the above technical solution in the preparation of anti-inflammatory products.
[0014] The present invention also provides the use of the turnip extract described in the above technical solution in the preparation of skin moisturizing products.
[0015] Preferably, the turnip extract moisturizes the skin by upregulating the expression of Flg gene, Spt gene and Ivl gene.
[0016] The present invention also provides the use of the turnip extract described in the above technical solution in the preparation of skin anti-aging products.
[0017] Preferably, the turnip extract has anti-aging effects by promoting the production of collagen and elastin and inhibiting the synthesis of matrix metalloproteinase 1.
[0018] Beneficial effects of the present invention:
[0019] In the present invention, a turnip extract and its application in the preparation of whitening, anti-oxidation, anti-inflammatory, moisturizing and anti-aging products are reported. The turnip extract is extracted from Tibetan turnip (Brassicarapa L.), which is a well-known "medicinal and edible" plant. The turnip extract of the present invention can effectively inhibit the production of melanin by B16 cells and inhibit the activity of the rate-limiting enzyme (tyrosinase) in the melanin synthesis pathway; effectively prevent the increase in the level of reactive oxygen species (ROS) in HaCaT cells, and has a significant antioxidant effect; can effectively prevent SDS surfactant from causing inflammation to HaCaT cells and reduce the production of inflammatory factor TNF-α; can significantly upregulate the expression of cell natural moisturizing factor, ceramide de novo synthesis rate-limiting enzyme and epidermal barrier-related genes; can effectively promote the production of cell collagen and elastin, and reduce the synthesis of matrix metalloproteinase 1 (MMP-1) that degrades collagen under ultraviolet irradiation, thereby playing an anti-aging role. The turnip extract of the present invention has multiple active functions and is suitable for the development of skin care products, providing a new natural ingredient option for the field of skin care. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.
[0021] Figure 1The results show that the turnip extract inhibits melanin and tyrosinase activity, where A is the effect of turnip extract on B16 cell activity tested by MTT method, B is the effect of turnip extract on melanin production inhibition, and C is the effect of turnip extract on tyrosinase activity inhibition;
[0022] Figure 2 The results show that turnip extract can reduce the cell oxidation caused by Rosup, where A is the effective dilution factor of Rosup to stimulate HaCaT cells to produce ROS, B is the effect of turnip extract in inhibiting cell oxidation, and C is the effect of different types of turnip extract in inhibiting cell oxidation;
[0023] Figure 3 The turnip extract reduces the level of inflammation caused by SDS, where A is the effect of SDS on HaCaT cell activity, B is the dose-response curve of SDS on HaCaT cells, C is the effect of turnip extract in inhibiting cell inflammation, and D is the effect of different types of turnip extract in inhibiting cell inflammation;
[0024] Figure 4 The results show that the turnip extract can enhance the skin barrier and moisturizing ability, wherein A represents the effect of turnip extract on up-regulating the expression of Flg gene, B represents the effect of turnip extract on up-regulating the expression of Spt gene, C represents the effect of turnip extract on up-regulating the expression of Ivl gene, D represents the effect of different types of turnip extract on up-regulating the expression of Flg gene, E represents the effect of different types of turnip extract on up-regulating the expression of Spt gene, and F represents the effect of different types of turnip extract on up-regulating the expression of Ivl gene;
[0025] Figure 5 The figure shows that turnip extract promotes the production of ColⅠ and ELN and inhibits the production of MMP-1, where A is the effect of turnip extract on the activity of HSF cells, B is the dose-response curve of turnip extract on HSF cells, C is the effect of turnip extract in promoting the production of ColⅠ, D is the effect of turnip extract in promoting the production of ELN, E is the effect of turnip extract in inhibiting the production of MMP-1, F is the effect of different types of turnip extracts in promoting the production of ColⅠ, G is the effect of different types of turnip extracts in promoting the production of ELN, and H is the effect of different types of turnip extracts in inhibiting the production of MMP-1. DETAILED DESCRIPTION
[0026] The present invention provides a method for preparing a turnip extract, comprising the following steps:
[0027] 1) mixing turnip with water and boiling to obtain a decoction;
[0028] The decoction is performed three times, wherein the mass ratio of the turnip to water is 1:6 in both the first and second decoctions, and 1:4 in the third decoction. The decoction conditions include: a temperature of 80° C. and a decoction time of 2 hours each time;
[0029] 2) Decolorizing, filtering and concentrating the decoction obtained in step 1) to obtain a turnip extract; concentrating the decoction at 80° C. The turnip extract has a specific gravity of 1.01 g / ml.
[0030] The present invention comprises mixing turnips with water and decocting them to obtain a decoction. The decoction is performed three times, with the turnips and water having a mass ratio of 1:6 in both the first and second decoctions, and a mass ratio of 1:4 in the third decoction. The decoction is performed at a temperature of 80°C and for 2 hours per decoction. The turnips are preferably ground to approximately 1 cm in size before decoction. In the present invention, the turnips are preferably 9-year-old turnips.
[0031] The decoction obtained in the present invention is decolorized, filtered, and concentrated to obtain a turnip extract; the concentration is performed at 80°C, and the turnip extract has a specific gravity of 1.01 g / ml. In the present invention, the decoctions obtained from the three extractions are preferably combined and then decolorized using an AB-8 resin column. In the present invention, filtration is preferably performed using a diaphragm stainless steel filter press.
[0032] The present invention also provides a turnip extract prepared by the preparation method described in the above technical solution, wherein the specific gravity of the turnip extract is 1.01 g / ml, and the mass percentage content of flavonoids in the turnip extract is 0.37%.
[0033] The present invention also provides the use of the turnip extract described in the above technical solution in the preparation of skin whitening products. In the present invention, the turnip extract preferably whitens skin by inhibiting melanin production and tyrosinase activity.
[0034] The present invention also provides the use of the turnip extract described in the above technical solution in the preparation of skin antioxidant products.
[0035] The present invention also provides the use of the turnip extract described in the above technical solution in the preparation of anti-inflammatory products.
[0036] The present invention also provides the use of the turnip extract described in the above technical solution in the preparation of a skin moisturizing product. In the present invention, the turnip extract preferably moisturizes the skin by upregulating the expression of the Flg gene, the Spt gene, and the Ivl gene.
[0037] The present invention also provides the use of the turnip extract described in the above technical solution in the preparation of skin anti-aging products. In the present invention, the turnip extract preferably promotes collagen and elastin production and inhibits matrix metalloproteinase 1 synthesis to achieve anti-aging effects.
[0038] The concentration of 1.01 g / ml of the radish extract was used. The 100% concentration of the radish extract was used in the experiment to dilute the radish extract with the appropriate cell culture medium (containing 10% fetal bovine serum and 1% penicillin-streptomycin). For example, a 5% concentration would contain 50 μl of the radish extract per 1 ml of the culture medium.
[0039] In order to further illustrate the present invention, the present invention is described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0040] Example 1
[0041] The process of extracting turnip extract from Tibetan turnip is as follows:
[0042] The turnip raw material was crushed into a size of about 1 cm, and the turnip pieces were added into the extraction tank according to the feeding amount of 750 kg per tank. Pure water was added and boiled at 80°C for 2 hours. The extraction was repeated 3 times (the amount of water added for the 1st and 2nd times was 6 times the mass of the turnip raw material, and the amount of water added for the 3rd time was 4 times the mass of the turnip raw material). The extracts were combined, decolorized using an AB-8 resin column, and filtered using a diaphragm stainless steel filter press to obtain a decolorized filtrate, which was concentrated in an 80°C water bath to finally obtain a turnip extract stock solution with a specific gravity of 1.01 g / ml.
[0043] The active effects of turnip extract were determined from five aspects: whitening function, antioxidant effect, anti-inflammatory ability, moisturizing effect, and anti-aging effect. The specific experimental method is as follows (the concentration of turnip extract used in the experiment is v / v):
[0044] 1. Whitening function
[0045] 1. The MTT method was used to determine the toxic effect of turnip extract on melanoma cells B16.
[0046] 2. Use melanocyte-stimulating hormone α-MSH to induce melanin production in B16 cells. α-MSH (working concentration of 10 nM) was mixed with turnip extract and incubated with B16 cells for 48 hours. α-MSH + Abrutin (arbutin) was used as a control treatment group (working concentrations of α-MSH and Abrutin were both 10 nM). After 48 hours, the B16 cells were digested and centrifuged (1000 rpm, 3 minutes). The supernatant was removed and 200 μl of 1M NaOH solution containing 1% (v / v) DMSO was added. The cells were lysed in a 37°C metal bath for 1 hour. The lysate was transferred to a 96-well plate and the absorbance was measured at 405 nm.
[0047] 3. After treating B16 cells with the above solution treatment method for 24 hours, digest and centrifuge the cells (1500 rpm, 10 minutes). Remove the supernatant and add 100 μl of Triton X-100. Repeat freeze-thaw cycles at -80°C for 5 minutes and 37°C for 5 minutes three times. Then, let the cells stand at room temperature for 10 minutes. Centrifuge at 12000 rpm for 5 minutes. Remove 100 μl of the supernatant and transfer it to an Eppendorf tube. Add 2 mg / ml L-DOPA hydrochloride solution and incubate at 37°C for 20 minutes. Then, transfer the cells to a 96-well plate and measure absorbance at 475 nm.
[0048] 2. Antioxidant Effect
[0049] 1. Use the reactive oxygen species positive control reagent Rosup (ROSUP) included with the Beyotime ROS Detection Kit to stimulate ROS production in human keratinocytes (HaCaT). HaCaT cells were treated with Rosup diluted in culture medium at 1:1000, 1:500, and 1:250 ratios for 3 hours. After incubation at 37°C in the dark for 20 minutes using a DCFH-DA probe, intracellular ROS levels were measured by flow cytometry to determine the concentration of Rosup that stimulates ROS production in HaCaT cells.
[0050] 2. Treat HaCaT cells with turnip extract for 24 hours, then add Rosup solution diluted in culture medium. After treating HaCaT cells for 3 hours, add DCFH-DA probe, incubate at 37°C in the dark for 20 minutes, and test ROS content by flow cytometry.
[0051] 3. Anti-inflammatory ability
[0052] 1. A skin inflammation model was established using SDS, a strong surfactant that can disrupt the stratum corneum and induce skin inflammation. HaCaT cells were treated with SDS solutions at concentrations of 2, 4, 8, 10, 20, and 40 μg / ml for 24 hours. The half-maximal inhibitory concentration of SDS on HaCaT cells was then determined using CCK-8 assay.
[0053] 2. After treating HaCaT cells with the turnip extract for 24 hours, add SDS solution and treat the HaCaT cells for 24 hours. Then, use an ELISA kit to detect the TNF-α content in the cell supernatant.
[0054] 4. Moisturizing effect
[0055] 1. Select protein genes related to skin barrier and moisturizing: filaggrin (FLG), serine palmitoyltransferase (SPT) and involucrin (IVL).
[0056] FLG (filaggrin): can be degraded into free amino acids, which helps produce natural moisturizing factors that maintain epidermal hydration. Low FLG leads to dry skin.
[0057] SPT (serine palmitoyltransferase): The rate-limiting enzyme for the de novo synthesis of ceramide. Ceramide is the main component of intercellular lipids in the stratum corneum and plays an important role in the skin barrier function.
[0058] IVL (involucrin): A component of the epidermal keratinocyte membrane and an important component of the epidermal barrier.
[0059] 2. After treating HaCaT cells with turnip extract for 24 hours, total RNA of HaCaT cells was extracted using RNAfast200 kit, and RNA concentration was detected using Nanodrop. Reverse transcription and cDNA synthesis were performed using TaKaRa kit, and the reaction procedure was 42°C, 5 min; 37°C, 45 min; 85°C, 5 s. SYBR Green (10 μl), upstream and downstream primers (0.5 μl each), cDNA template (1 μl) and RNA-free enzyme-free water (8 μl) were used to establish a 20 μl qRT-PCR system, and the reaction procedure was 95°C, 10 min; (95°C, 15 s; 60°C, 1 min) × 3; 95°C, 5 s; 65°C, 5 s. The primers used are shown in the following table:
[0060] Table 1 Primer sequences used for qRT-PCR
[0061] Gene Upstream primer sequence (5'-3') Downstream primer sequence (5'-3') Flg SEQ ID No.1: GTGGCAGTCCTCACAGTTCT SEQ ID No.2: CACTTCCGTGCTGAGAGTGT Spt SEQ ID No.3:ATCGTTTCAGGCCCTCCAAG SEQ ID No.4: CAAGTCCCCACGCCATACTT Ivl SEQ ID No.5: GCTCCTCAAGACTGTTCCTCC SEQ ID No.6: CAGGCAGTCCCTTTACAGCA
[0062] 5. Anti-aging effect
[0063] 1. The CCK-8 method was used to determine the toxic effect of turnip extract on human dermal fibroblasts HSF.
[0064] 2. After treating HSF cells with turnip extract for 24 hours, the cell culture supernatant was collected and the contents of type Ⅰ collagen (ColⅠ) and elastin (ELN) were detected using ELISA detection kits.
[0065] 3. After treating HaCaT cells with turnip extract for 24 hours, they were irradiated with ultraviolet light (UVB) to establish an ultraviolet irradiation model. After further culture for 12 hours, the cell supernatant was collected and the matrix metalloproteinase 1 (MMP-1) content was detected using an ELISA detection kit.
[0066] result:
[0067] 1. Turnip extract has a good whitening effect
[0068] 1%, 3%, and 5% concentrations of turnip extract can effectively inhibit the production of melanin in B16 cells stimulated by α-MSH, and the inhibitory effect is better than arbutin. In addition, turnip extract can also effectively reduce the activity of tyrosinase and reduce the synthesis of cellular melanin ( Figure 1 ).
[0069] 2. Turnip extract has good antioxidant capacity
[0070] Rosup diluted at a ratio of 1:250 can effectively stimulate HaCaT cells to produce higher levels of reactive oxygen species (ROS). This dilution ratio of Rosup reagent was used in the antioxidant experiment. Flow cytometry showed that the increase in intracellular ROS levels in HaCaT cells treated with turnip extract for 24 hours in advance was effectively suppressed after stimulation with Rosup. At a concentration of 0.25%, turnip extracts of different years and types were tested, and the nine-year-old turnip extract had a significant antioxidant effect ( Figure 2 ).
[0071] 3. Turnip extract has good anti-inflammatory effect
[0072] The CCK-8 method was used to determine the concentration of SDS for establishing the skin inflammation model to be 13.5μg / ml. ELISA experiments showed that after 24 hours of pre-treatment of HaCaT cells with turnip extract, the level of TNF-α produced by the cells was significantly reduced by SDS, indicating that turnip extract can effectively prevent inflammation and has a good anti-inflammatory effect. In the anti-inflammatory test of different types of turnip extracts (fixed concentration 1%), the nine-year-old turnip extract also performed well ( Figure 3 ).
[0073] 4. Turnip extract has good moisturizing function
[0074] qRT-PCR experiments showed that after 24 hours of treatment with turnip extract in HaCaT cells, the levels of three genes, Flg, Spt, and Ivl, were all upregulated to varying degrees, indicating that it can enhance skin epidermal hydration and barrier strength. The same experiment was conducted on turnip extracts of different years and types (fixed concentration 0.5%), and the results showed that all types of turnip extracts were able to upregulate the expression of at least two genes ( Figure 4 ).
[0075] 5. Turnip extract has good anti-aging effect
[0076] The toxic effect of turnip extract on HSF cells was tested using the CCK-8 method, and a concentration of 3% was determined to be the half-maximal inhibitory concentration of HSF cells. To avoid the influence of turnip extract itself on cell activity, a concentration of 2% or less was used. ELISA kits were used to detect the content of type I collagen (ColⅠ) and elastin (ELN) in the supernatant of HSF cells after 24 hours of treatment with turnip extract. The results showed that turnip extract could promote the production of ColⅠ and ELN in HSF cells. In addition, HaCaT cells were pre-treated with turnip extract for 24 hours (using disodium phosphamide, an MMP-1 inhibitor, as a positive control), and the cells were irradiated with ultraviolet light (UVB). After further culture for 12 hours, the content of matrix metalloproteinase 1 (MMP-1) in the cell supernatant was detected by ELISA kit. The results showed that pre-treatment with turnip extract could reduce the production of MMP-1 when HaCaT cells were damaged by ultraviolet light, thereby reducing the degradation of collagen and achieving the purpose of anti-aging ( Figure 5 ).
[0077] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.
Claims
1. A method for preparing a turnip extract, characterized in that: The following steps are involved: 1) mixing turnip with water and boiling to obtain a decoction; The decoction is performed three times, wherein the mass ratio of the turnip to water is 1:6 in both the first and second decoctions, and 1:4 in the third decoction. The decoction conditions include: a temperature of 80° C. and a decoction time of 2 hours each time; 2) Decolorizing, filtering and concentrating the decoction obtained in step 1) to obtain a turnip extract; concentrating the decoction at 80° C. The turnip extract has a specific gravity of 1.01 g / ml.
2. A turnip extract prepared by the preparation method according to claim 1, wherein the turnip extract has a specific gravity of 1.01 g / ml.
3. Use of the turnip extract according to claim 2 in the preparation of skin whitening products.
4. The use according to claim 3, characterized in that The turnip extract whitens the skin by inhibiting melanin production and tyrosinase activity.
5. Use of the turnip extract according to claim 2 in the preparation of skin antioxidant products.
6. Use of the turnip extract according to claim 2 in the preparation of anti-inflammatory products.
7. Use of the turnip extract according to claim 2 in the preparation of skin moisturizing products.
8. The use according to claim 7, characterized in that The turnip extract moisturizes the skin by up-regulating the expression of Flg gene, Spt gene and Ivl gene.
9. Use of the turnip extract according to claim 2 in the preparation of skin anti-aging products.
10. The use according to claim 9, characterized in that The turnip extract has anti-aging effects by promoting the production of collagen and elastin and inhibiting the synthesis of matrix metalloproteinase 1.