Use of barmatine or a salt thereof against methicillin-resistant staphylococcus aureus

Abstract

The application belongs to the technical field of antibacterial preparations, and particularly relates to the use of pamaquin or a salt thereof in resisting methicillin-resistant Staphylococcus aureus. Pamaquin or a salt thereof can effectively inhibit and kill methicillin-resistant Staphylococcus aureus in vitro, the effective inhibitory concentration of pamaquin or a salt thereof on methicillin-resistant Staphylococcus aureus is greater than or equal to 500 μg / mL, and the effective bactericidal concentration is greater than or equal to 1000 μg / mL; in vivo, pamaquin or a salt thereof can effectively eliminate methicillin-resistant Staphylococcus aureus in blood and / or viscera, so as to reduce the load of methicillin-resistant Staphylococcus aureus in blood and / or viscera.

Description

Technical Field

[0001] This invention belongs to the field of antibacterial preparation technology, specifically relating to the use of palmatine or its salts in the treatment of methicillin-resistant Staphylococcus aureus. Background Technology

[0002] Methicillin-resistant Staphylococcus aureus (MRSA), a typical multidrug-resistant Gram-positive pathogen, poses a significant challenge to clinical treatment due to the bacteremia and other infectious diseases it causes. Because MRSA is inherently resistant to β-lactam antibiotics and can further overcome the targets of other antimicrobial drugs through acquired resistance mechanisms, conventional antimicrobial therapy is prone to failure, significantly increasing patient mortality and the healthcare burden. The spread and prevalence of this drug-resistant pathogen could even trigger a public health crisis similar to the widespread drug resistance crisis of the penicillin era. Therefore, effective control of MRSA infection has become an urgent need in the global anti-infective field.

[0003] Currently, vancomycin is the primary first-line treatment for MRSA infections in clinical practice. However, its long-term use has induced the emergence of vancomycin-resistant MRSA (VRSA), further exacerbating the treatment dilemma. Against this backdrop, overcoming the resistance predicament of existing β-lactam antibiotics and developing novel anti-MRSA drugs has become a key strategy to mitigate the risk of treatment failure under the pressure of antibiotic selection. However, progress in the development of existing antibiotics is slow, and there is an urgent need to discover candidate compounds with novel mechanisms of action or high in vivo activity.

[0004] It is worth noting that current antimicrobial drug development still heavily relies on in vitro antimicrobial activity screening. While some natural products and their monomeric components exhibit potent antimicrobial activity in vitro, their actual potency in vivo is significantly reduced or even inactivated due to complex pharmacokinetic processes (such as absorption, distribution, metabolism, and excretion), biotransformation, and tissue-specific distribution. This "in vitro-in vivo potency difference" greatly limits the efficiency of candidate drug development; therefore, there is an urgent need to screen novel anti-MRSA compounds that combine both in vitro activity and in vivo efficacy. Summary of the Invention

[0005] The purpose of this invention is to provide a new use of palmatine or its salts in the fight against methicillin-resistant Staphylococcus aureus (MRSA). Verification by this invention shows that palmatine or its salts have excellent anti-MRSA performance both in vivo and in vitro, with an effective inhibitory concentration of ≥500 μg / mL and an effective bactericidal concentration of ≥1000 μg / mL against MRSA.

[0006] To achieve the above objectives, the present invention can adopt the following technical solutions:

[0007] One aspect of this invention provides the use of palmatine or its salts in non-therapeutic applications against methicillin-resistant Staphylococcus aureus.

[0008] Preferably, in the above-described uses, barmatine or its salts have one or more of the following functions:

[0009] (A1) Barmatine or its salts have the function of increasing the permeability of the cell wall structure of methicillin-resistant Staphylococcus aureus;

[0010] (B1) Parmadine or its salts have the function of damaging the cell membrane of methicillin-resistant Staphylococcus aureus;

[0011] (C1) Barmatine or its salts have the function of disrupting the extracellular barrier structure and intracellular homeostasis system of methicillin-resistant Staphylococcus aureus;

[0012] (D1) Barmatine or its salts have the function of inhibiting intracellular ATP synthesis in methicillin-resistant Staphylococcus aureus;

[0013] (E1) Parmadine or its salts have the function of inhibiting the formation of biofilm structures of methicillin-resistant Staphylococcus aureus;

[0014] (F1) Palmatine or its salts have the function of promoting mecA gene expression.

[0015] Preferably, in the above-mentioned uses, the barmatine salt is a hydrochloride salt.

[0016] Another aspect of the present invention provides the use of palmatine or a salt thereof in the preparation of a medicament for treating a disease, namely, a methicillin-resistant Staphylococcus aureus infection.

[0017] Preferably, in the above-mentioned uses, the disease is anemia or inflammation.

[0018] Preferably, in the above-described uses, barmatine or its salts have one or more of the following functions:

[0019] (A2) Parmatin or its salts have the function of reducing the viral load of methicillin-resistant Staphylococcus aureus in the blood;

[0020] (B2) Parmatin or its salts have the function of reducing the load of methicillin-resistant Staphylococcus aureus in organs.

[0021] Preferably, in the above-mentioned uses, the dosage form of the drug includes tablets, powders, injections, oral liquids, sprays, patches, or ointments.

[0022] Preferably, in the above-mentioned uses, the barmatine salt is a hydrochloride salt.

[0023] The beneficial effects of this invention include:

[0024] (1) Palmatine can effectively inhibit and kill methicillin-resistant Staphylococcus aureus in vitro. Its effective inhibitory concentration against methicillin-resistant Staphylococcus aureus is ≥500μg / mL, and its effective bactericidal concentration is ≥1000μg / mL.

[0025] (2) Barmatine can effectively clear methicillin-resistant Staphylococcus aureus from the blood and / or organs in the body, thereby reducing the viral load of methicillin-resistant Staphylococcus aureus in the blood and / or organs.

[0026] (3) In the concentration range of 1×MIC to 8×MIC, the hemolytic activity of palmatine was maintained in the range of 0.45% to 3.90% (1×MIC: 0.45%, 2×MIC: 1.38%, 4×MIC: 2.50%, 8×MIC: 3.90%), which was significantly lower than the clinical safety threshold (5%). Furthermore, palmatine did not affect liver and kidney function and had a certain protective effect on the liver and kidneys, indicating that palmatine has good safety. Attached Figure Description

[0027] Figure 1 The dynamic antibacterial curve of berberine against MRSA;

[0028] Figure 2 The effect of barmatine on the conductivity of MRSA;

[0029] Figure 3 The results of NPN fluorescent dye uptake after MRSA treatment with barmatine;

[0030] Figure 4 Results of β-galactosidase activity after treatment of MRSA with palmatine;

[0031] Figure 5 To observe the effects of palmatine on the morphology and structure of MRSA cells under electron microscopy, a and c were blank control groups; b and d were 2×MIC palmatine treatment groups.

[0032] Figure 6 The effect of palmatine on MRSA DNA content was investigated; where a and d were blank control groups; b and e were 1×MIC palmatine treatment groups; and c and f were 2×MIC palmatine treatment groups.

[0033] Figure 7 The effect of barmatine on energy metabolism in MRSA;

[0034] Figure 8 The effect of barmatine on the biofilm formation ability of MRSA; where *: P<0.05 compared with the control group; **: P<0.01 compared with the control group; ***: P<0.001 compared with the control group;

[0035] Figure 9 The effect of bamatine on MRSAmecA; where *: P<0.05 compared with the control group; **: P<0.01 compared with the control group; ***: P<0.001 compared with the control group;

[0036] Figure 10 The hemolytic activity of different concentrations of palmatine;

[0037] Figure 11 Survival curves for each group of mice;

[0038] Figure 12 This is a graph showing liver and kidney indicators in mice.

[0039] Figure 13 HE staining results of mouse lung tissue (×400); where a) is the normal group; b) is the model group; c) is the vancomycin group; d) is the high-dose palmatine group; e) is the medium-dose palmatine group; and f is the low-dose palmatine group. Detailed Implementation

[0040] The embodiments described are provided to better illustrate the present invention, but are not intended to limit the scope of the invention to the embodiments described. Therefore, non-essential improvements and adjustments made to the embodiments by those skilled in the art based on the above description are still within the scope of protection of the present invention.

[0041] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit this disclosure. Singular expressions include plural expressions unless they have a distinct meaning in the context. As used herein, it should be understood that terms such as “comprising,” “having,” “including,” are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials, or combinations thereof. The terminology of the invention is disclosed in the specification and is not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials, or combinations thereof may be present or added. As used herein, “ / ” may be interpreted as “and” or “or,” depending on the context.

[0042] In a first aspect, embodiments of the present invention provide the use of palmatine or a salt thereof in non-therapeutic anti-methicillin-resistant Staphylococcus aureus.

[0043] It should be noted that this invention has verified that palmatine or its salts possess excellent antibacterial properties against methicillin-resistant Staphylococcus aureus (MRSA) and can be used in vitro against MRSA with excellent antibacterial effects. Specifically, the effective inhibitory concentration of palmatine or its salts against MRSA is ≥500 μg / mL, and the effective bactericidal concentration is ≥1000 μg / mL. That is, the minimum inhibitory concentration (MIC) of palmatine or its salts against MRSA is 500 μg / mL, and at a concentration of 1000 μg / mL, the bactericidal rate of palmatine or its salts against MRSA can reach 99.99%, meeting the MBC (Methicillin-Containing Capacity) criteria.

[0044] In some specific examples, in the above uses, barmatine or its salts have one or more of the following functions:

[0045] (A1) Barmatine or its salts have the function of increasing the permeability of the cell wall structure of methicillin-resistant Staphylococcus aureus;

[0046] (B1) Parmadine or its salts have the function of damaging the cell membrane of methicillin-resistant Staphylococcus aureus;

[0047] (C1) Barmatine or its salts have the function of disrupting the extracellular barrier structure and intracellular homeostasis system of methicillin-resistant Staphylococcus aureus;

[0048] (D1) Barmatine or its salts have the function of inhibiting intracellular ATP synthesis in methicillin-resistant Staphylococcus aureus;

[0049] (E1) Parmadine or its salts have the function of inhibiting the formation of biofilm structures of methicillin-resistant Staphylococcus aureus;

[0050] (F1) Palmatine or its salts have the function of promoting mecA gene expression.

[0051] It should be noted that this invention, through the construction of an in vitro pharmacodynamic model, discovered that palmatine or its salts inhibit MRSA proliferation through multi-target synergistic effects. Electron microscopy observations showed that palmatine or its salts could disrupt cell wall and plasma membrane structures. Combined with changes in indicators such as conductivity and ATP content, this confirmed that it exerts its antibacterial effect by disrupting membrane barrier integrity and interfering with energy metabolism. Furthermore, even at sub-inhibitory concentrations, palmatine or its salts could still significantly inhibit bacterial growth within biofilms, and the inhibitory effect was dose-dependent, indicating that it can overcome biofilm drug resistance barriers. In addition, data from mecA gene expression regulation and hemolysis assays showed that palmatine or its salts enhanced antibacterial efficacy by regulating the PBP2a drug resistance gene pathway. The hemolysis assay provided a safety basis for its clinical translation. This multi-mechanism of action demonstrates that palmatine or its salts have the potential to become a multi-target therapeutic agent against drug-resistant bacteria.

[0052] In some specific examples, in the above uses, palmatine salt is the hydrochloride salt, i.e., palmatine hydrochloride.

[0053] Secondly, embodiments of the present invention provide the use of palmatine or its salt in the preparation of a medicament for treating a disease, namely, methicillin-resistant Staphylococcus aureus infection.

[0054] It should be noted that, based on the above-mentioned resistance of palmatine or its salts to methicillin-resistant Staphylococcus aureus, palmatine or its salts can be prepared into drugs for treating diseases related to methicillin-resistant Staphylococcus aureus infection. Diseases related to methicillin-resistant Staphylococcus aureus infection include, but are not limited to, wounds infected with methicillin-resistant Staphylococcus aureus, including, but not limited to, surgical wounds.

[0055] In some specific examples, the disease described above is anemia or inflammation.

[0056] In some specific examples, in the above uses, barmatine or its salts have one or more of the following functions:

[0057] (A2) Parmatin or its salts have the function of reducing the viral load of methicillin-resistant Staphylococcus aureus in the blood;

[0058] (B2) Parmatin or its salts have the function of reducing the load of methicillin-resistant Staphylococcus aureus in organs.

[0059] It should be noted that this invention is based on the construction of a systemic bacteremia animal model and implements a multi-dimensional detection system: dynamic monitoring of body weight, analysis of whole blood cell parameters, quantitative analysis of pathogen load in the circulatory system, assessment of pathological damage to liver and kidney tissues, colony counting in parenchymal organs, and pathological anatomical observation. A multi-parameter comprehensive evaluation system is constructed to scientifically analyze the in vivo antibacterial effect of palmatine or its salts. According to the statistical analysis of experimental data, the model group exhibited significant pathological characteristics: significant weight loss, significant inhibition of behavioral activity, motor dysfunction in some individuals, and a cumulative mortality rate of 50%. Quantitative blood infection counts showed that the bacterial load in the blood and major organs of this group was significantly higher than that of other groups. Liver and kidney biochemical indicators were higher than those of the control group. Histopathological examination of the lungs showed extensive parenchymal damage and obvious lesions. The high-dose palmatine or its salt treatment group maintained the body weight of the physiological control, showed no significant abnormalities in feeding and drinking behavior, had a good survival status, and a significantly higher survival rate than the model group (70% and 80% for the low- and medium-dose groups, respectively). Simultaneously, etiological testing showed a decrease in peripheral blood bacterial load in the treatment group, and a significant reduction in bacterial load in major organs (heart, liver, spleen, lungs, and kidneys), with no statistically significant difference compared to the vancomycin-positive control group. Biochemical analysis indicated a dose-dependent improvement in liver and kidney function parameters across all dosage groups, with organ coefficients returning to physiological ranges. Histopathological evaluation using HE staining revealed intact alveolar structure in the lung tissue of the palmatine or its salt treatment group, with no inflammatory infiltration or fibrotic lesions observed; the pathological score was comparable to that of the vancomycin group. This demonstrates that palmatine or its salts possess good in vivo antibacterial efficacy.

[0060] In some specific examples, the dosage forms of the drugs used in the above-mentioned applications include tablets, powders, injections, oral liquids, sprays, patches, or ointments.

[0061] It should be noted that the dosage form of the drug for treating methicillin-resistant Staphylococcus aureus infection in this invention can be any type known in the art, such as tablets, powders, injections, oral liquids, sprays, patches, or ointments. The preparation methods for the above dosage forms are known in the art.

[0062] In some specific examples, in the above uses, palmatine salt is the hydrochloride salt, i.e., palmatine hydrochloride.

[0063] To better understand the present invention, specific examples are provided below to further illustrate the content of the present invention, but the content of the present invention is not limited to the examples below.

[0064] In the following examples, TSB liquid culture medium was purchased from Qingdao Haibo Biotechnology Co., Ltd.

[0065] Example 1

[0066] This invention provides experiments on the in vitro antibacterial effect of palmatine on MRSA, specifically including the determination of the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of palmatine on MRSA, the effect of palmatine on the growth curve of MRSA, the effect of palmatine on the conductivity of MRSA, the effect of palmatine on the cell wall of MRSA, the effect of palmatine on the cell membrane of MRSA, the observation of the antibacterial effect of palmatine on MRSA by scanning electron microscopy (SEM) and transmission electron microscopy (TEM), the observation of changes in the intracellular DNA content of bacteria by laser focusing microscopy, the effect of palmatine on the energy metabolism of MRSA, the determination of the ability of palmatine to inhibit the formation of MRSA biofilm, the effect of palmatine on the mecA gene encoding PBP2a, and the determination of the hemolysis rate of erythrocytes by palmatine.

[0067] (I) Determination of the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of bamatine against MRSA

[0068] The minimum inhibitory concentration (MIC) of bamatine against MRSA was determined by microdilution, and the minimum bactericidal concentration (MBC) was determined by colony counting, as detailed below:

[0069] (1) 96-well plate loading: Add 200 μL of stock solution (concentration 4000 μg / mL, solvent: TSB liquid medium) to the highest concentration well (the first well from the left in the 96-well plate). Starting from the second well, add 100 μL of TSB liquid medium to each well. Use a pipette to transfer 100 μL of stock solution from the first well to the second well for serial dilution, setting 14 mass concentration gradients. Then, use a pipette to add another 100 μL of 1×10⁻⁶ TSB liquid medium to each well. 6 CFU / mL bacterial suspensions were used to achieve final concentrations of palmatine of 2000 μg / mL, 1000 μg / mL, 500 μg / mL, 250 μg / mL, 125 μg / mL, 62.5 μg / mL, 31.25 μg / mL, 15.63 μg / mL, 7.81 μg / mL, 3.91 μg / mL, 1.95 μg / mL, 0.98 μg / mL, 0.49 μg / mL, and 0.25 μg / mL. Positive control wells (200 μL bacterial suspension) and negative control wells (200 μL TSB culture medium) were also included, with three replicates per group.

[0070] (2) MIC result interpretation: After incubating the 96-well plate at 37℃ for 24 hours, the results of the culture system in the 96-well plate were interpreted. The negative control wells remained clear and transparent, while the positive control wells showed obvious turbidity. The MIC criterion is defined as the lowest drug concentration threshold at which complete bacterial colonies can be formed and are visible to the naked eye.

[0071] (3) MBC result evaluation: After completing the MIC test, 100 μL was taken from the negative control well (clear and transparent) of each test group and spread evenly on the TSA agar surface using a sterile spreader to form a bacterial film; the culture medium after inoculation was transferred to a constant temperature incubation environment of 37℃ and incubated for 24 h. After the incubation was completed, the colony count was performed; the MBC value was determined by counting the colony forming units of each well and combining the CLSI drug susceptibility test standard: when the drug concentration reaches the point that the initial bacterial count is reduced by more than 99.9% (residual bacterial count), the critical concentration is identified as the minimum bactericidal concentration (MBC).

[0072] The results showed that at a concentration of 500 μg / mL palmatine, the culture wells remained clear and transparent, and the growth of 90% of the strains was inhibited. Therefore, the MIC of palmatine was determined to be 500 μg / mL. Furthermore, colony count analysis indicated that when the drug concentration was increased to 1000 μg / mL, the viable count of MRS decreased by four logarithmic orders (99.99% sterilization rate), meeting the MBC criteria. These results demonstrate that palmatine can significantly inhibit the growth of MRSA and has a direct bactericidal effect.

[0073] (II) Test of the effect of barmatin on the growth curve of MRSA

[0074] Based on the MIC of palmatine for the test strain, a concentration gradient was set up. Palmatine solutions of 1000 μg / mL, 500 μg / mL, 250 μg / mL, 125 μg / mL, 62.5 μg / mL, 31.25 μg / mL, and 15.63 μg / mL were added sequentially from left to right to 96-well plates. Then, MRSA bacterial suspension (1×10⁻⁶) was transferred... 5100 μL of cFU / mL was added to each well and mixed thoroughly to achieve final concentrations of 2×MIC (the MIC of palmatine against MRSA is 500 μg / mL, 2×MIC represents 1000 μg / mL, and the same applies below), 1×MIC, 1 / 2×MIC, 1 / 4×MIC, 1 / 8×MIC, 1 / 16×MIC, and 1 / 32×MIC. A 200 μL blank bacterial suspension was used as a control. The 96-well plate was incubated at 37℃, and the OD600nm was measured at 0h, 2h, 4h, 6h, 8h, 10h, 12h, 14h, 16h, 18h, 20h, 22h, and 24h. A time-dependent antibacterial curve of palmatine was plotted with incubation time on the x-axis and OD600nm value on the y-axis to analyze its dynamic antibacterial effect. The experiment was repeated three times.

[0075] The results are as follows Figure 1 As shown, the results indicate that the antibacterial effect of palmatine on MRSA is concentration-dependent. Within 14 hours, the turbidity of the culture medium in the 1×MIC and 2×MIC groups did not show a significant increase. The control group entered the logarithmic growth phase at 5 hours and reached the stationary phase at 17–24 hours. In contrast, the sub-inhibitory concentration groups (1 / 32×MIC to 1 / 2×MIC) delayed bacterial proliferation in the initial 6 hours. Although growth recovered in the subsequent period, the increase in turbidity was lower than that in the control group. These data demonstrate that palmatine can effectively inhibit the proliferation of MRSA, and the antibacterial strength is positively correlated with the drug concentration.

[0076] (III) Test on the effect of barmatine on the conductivity of MRSA

[0077] Methicillin-resistant Staphylococcus aureus (MRSA) bacterial pellets were collected, washed with sterile PBS, and resuspended in solutions containing different concentrations of palmatine. The pellets were mixed thoroughly to final concentrations of 2×MIC, 1×MIC, 1 / 2×MIC, and 1 / 4×MIC, and incubated at 37℃ for 8 hours using a shaker at 180 rpm. Samples were taken at 0h, 2h, 4h, 6h, and 8h, and the supernatant was collected by centrifugation (6000 rpm, 10 min). Untreated bacterial suspensions were used as a blank control group. The conductivity of the supernatant at different time points was measured using a conductivity meter. The experiment was repeated three times.

[0078] Changes in conductivity as Figure 2 As shown, the differential effect of different concentrations of palmatine on the permeability of MRSA membranes is evident. In the negative control group, conductivity showed a rapid increase from 0 to 2 hours, decreased from 2 to 4 hours, and then stabilized from 4 to 8 hours. While the 1 / 2×MIC group exhibited a similar fluctuation pattern, its conductivity increase was greater than that of the control group, suggesting a partial membrane damage effect. The 1×MIC and 2×MIC groups showed a rapid increase in conductivity in the early stages of the experiment (0-2 hours), confirming that this concentration threshold can rapidly disrupt membrane integrity. Furthermore, the conductivity values ​​of the 1×MIC and 2×MIC groups remained higher than those of the negative control group throughout the 0-8 hour period.

[0079] (iv) Tests on the effect of barmatin on the cell wall of MRSA

[0080] In the following tests, NPN is a commonly used fluorescent probe for measuring cell wall permeability. When the bacterial outer membrane structure is intact, NPN cannot penetrate the dense peptidoglycan layer due to polar repulsion. If the cell wall is structurally damaged, the probe molecules can penetrate into the hydrophobic region and excite a fluorescent signal.

[0081] (1) In a reaction system containing 5 mM HEPES buffer (pH = 7.4), ATCC 43300 (Staphylococcus aureus) bacterial suspension (1 × 10⁻⁶) was added. 5 The CFU / mL solution was mixed with 10 μM NPN (N-phenyl-1-naphthylamine, purchased from Beijing Solarbio Science & Technology Co., Ltd.), and incubated at 37℃ for 1 h. The background fluorescence signal intensity was measured using a spectrophotometer (excitation wavelength 350 nm, emission wavelength 420 nm).

[0082] (2) An equal volume of bacterial suspension was mixed with palmatine solution in sterile 96-well black plates to achieve final concentrations of 2×MIC, 1×MIC, 1 / 2×MIC, and 1 / 4×MIC. Fluorescence was recorded over time. Each group was repeated three times. The MRSA strain treated with 30 μg / mL vancomycin was set as the positive control group; the original bacterial suspension without drug treatment was used as the negative control group, and fluorescence intensity was detected and analyzed simultaneously.

[0083] Test results are as follows Figure 3 As shown, when palmatine (1×MIC and 2×MIC) was applied to MRSA strains, the uptake rate of the NPN fluorescent probe showed a rapid upward trend within the first 2 minutes of drug treatment, and the intracellular fluorescence signal intensity showed a significant enhancement effect compared with the blank control group. Compared with vancomycin, palmatine also exhibited cell wall permeability regulation properties. These results indicate that palmatine can cause changes in the permeability of MRSA cell wall structure.

[0084] (V) Effects of barmatin on MRSA cell membranes

[0085] It should be noted that β-galactosidase, as a highly conserved hydrolytic enzyme, is widely found in animal tissues, plants, microbial systems, and in vitro cultured cell systems. This enzyme possesses dual catalytic properties: it specifically hydrolyzes β-galactosidic bonds and can also mediate transgalactosidase reactions. When cell membrane integrity is impaired, leading to abnormally increased permeability, intracellularly stored β-galactosidase can leak out. Based on this characteristic, quantitative detection of the enzyme activity level in the extracellular environment can serve as an effective biomarker for assessing the degree of damage to biological membrane structures.

[0086] (1) Culture ATCC43300 to the logarithmic growth phase (OD). 600nm =0.5), add different concentrations of palmatine solution to make the final concentrations of palmatine 2×MIC, 1×MIC, 1 / 2×MIC, and 1 / 4×MIC, so that the bacterial concentration is 1×10. 5 CFU / mL. Additionally, sterile PBS buffer was used instead of palmatine as a control group.

[0087] (2) Incubate at 37℃ and 180rpm in a shaker: Take 1mL of bacterial culture at 0h, 2h, 4h, 6h and 8h and place it in a 1.5mL centrifuge tube. Centrifuge at 15000rpm and 4℃ for 10min, discard the supernatant, add 1mL of extraction solution, and sonicate to break up the bacteria (ice bath, power 200W, sonication for 3s, interval 10s, repeated 30 times). Centrifuge at 15000rpm and 4℃ for 10min, take the supernatant, place it on ice for testing, and determine the β-galactosidase activity according to the kit instructions.

[0088] Test results as follows Figure 4 As shown, the results indicated that the extracellular β-galactosidase activity in the untreated control group did not show significant fluctuations. In the groups treated with 1×MIC and 2×MIC palmatine concentrations, the extracellular enzyme activity showed a sharp upward trend within 2 hours, and remained at a dynamic equilibrium level in the subsequent period. Furthermore, the degree of membrane damage was concentration-dependent.

[0089] (vi) Observation of the antibacterial effect of bamatine on MRSA by scanning electron microscopy (SEM) and transmission electron microscopy (TEM)

[0090] The logarithmic-phase bacterial suspension was mixed with an equal volume of palmatine solution to achieve a final palmatine concentration of 2×MIC. A blank control group without treatment was also included. The samples were incubated at 37°C with shaking at 180 rpm for 6 hours. The cells were collected by centrifugation at 4000 rpm for 10 minutes and washed three times with sterile PBS buffer. The bacterial pellet was then fixed with 2.5% glutaraldehyde at 4°C for 12 hours. A gradient of ethanol solutions was used to dehydrate the samples, with each concentration gradient lasting 15 minutes. Subsequently, the samples were dried using tert-butanol in two separate applications, employing a critical point dehydrator. After gold sputtering, the samples were observed using a scanning electron microscope. For the fixation of transmission electron microscopy samples, glutaraldehyde was used for fixation for 12 hours, followed by fixation with 1% osmium tetroxide solution for another 1 hour. The bacterial cells were collected by centrifugation at 4000 rpm for 10 minutes, washed three times with sterile PBS buffer, and dehydrated by an acetone gradient. The samples were embedded in epoxy resin and left overnight, then dried at 50°C for 48 hours. Finally, they were stained with 1% uranium acetate for 30 minutes and observed using a transmission electron microscope.

[0091] SEM imaging results are as follows Figure 5As shown, the results indicated that the untreated MRSA control group exhibited a typical regular spherical structure and maintained a tight, grape-like aggregation. After treatment with 2×MIC palmatine, the ultrastructure of the pathogen underwent significant changes: most bacterial surfaces showed irregular collapse, the original cluster connection network was broken, and over 80% of the cell membranes showed discontinuous rupture. TEM observations showed that the cell membranes of the control group were intact and continuous, and the intracellular matrix electron cloud was uniformly and densely distributed; while the cells in the 2×MIC palmatine intervention group showed multidimensional damage characteristics, including cytoplasmic vacuolation, separation of cytoplasm from the cell wall, cell shrinkage and decreased electron density, cell wrinkling, cell rupture, and leakage of contents. These results indicate that palmatine can disrupt the extracellular barrier structure and intracellular homeostasis system of MRSA.

[0092] (vii) Observation of changes in intracellular DNA content in bacteria using laser focusing microscopy

[0093] It should be noted that DNA, as the core carrier of bacterial genetic regulation, dominates the proliferation, differentiation, and genetic information transmission processes of pathogens. Due to the fluorescent properties of DAPI, this probe can selectively penetrate the cell wall and cell membrane of living cells, specifically binding to intracellular nucleic acids and generating a high-intensity blue fluorescent signal. This study evaluated the intervention effect of palmatine on intracellular nucleic acid metabolism by comparing the palmatine-treated group and the blank control group of MRSA strains through fluorescence signal intensity analysis.

[0094] The bacterial suspension was mixed with palmatine solution to prepare different final concentration gradients of palmatine (final concentrations of 2×MIC and 1×MIC), and cultured at 37℃ with shaking (1800 rpm, 8 h). After culture, the mixture was incubated with 10 μg / mLDAPI (4',6-diamidinyl-2-phenylindole) staining solution in the dark for 15 min, and then 10 μL of the mixture was evenly spread on a clean glass slide. After mounting with anti-fluorescence quencher, fluorescence signals were immediately acquired using a laser confocal microscopy (CLSM) system.

[0095] Test results are as follows Figure 6 As shown in the results, the fluorescence intensity of bacteria treated with palmatine was lower than that of the control group. The experiment suggests that palmatine may exert its antibacterial effect by interfering with nucleic acid metabolism pathways, and preliminarily verifies that DNA is its potential target.

[0096] (viii) Effects of barmatine on energy metabolism in MRSA

[0097] It should be noted that ATP, as the core energy carrier for microbial metabolic activities, can reflect the physiological activity state of bacteria through dynamic changes in its intracellular concentration.

[0098] The bacterial suspension was mixed with palmatine solution to achieve final concentrations of 2×MIC, 1×MIC, 1 / 2×MIC, and 1 / 4×MIC. The bacterial suspension without palmatine served as a blank control. Each group was repeated three times. The cells were incubated at 37℃ with constant temperature shaking at 180 rpm. At 0h, 1h, 2h, 3h, 4h, 5h, and 6h of incubation, the cells were collected by centrifugation (12000 rpm, 5 min). After resuspending in PBS, the cells were disrupted at low temperature using an ultrasonic cell disruptor (200W power, 3s sonication time, 3s interval, 40 cycles). The cells were then centrifuged (12000 rpm, 5 min), and the supernatant was collected. The ATP content was determined according to the ATP kit instructions.

[0099] Test results as follows Figure 7 As shown, the results indicated that after 1 hour, intracellular ATP levels in both the control group and all treatment groups decreased. However, with prolonged treatment time, the intracellular ATP content in the control group increased, and the trend was similar to that of the control group at 1 / 4×MIC concentration. In contrast, the intracellular ATP content in the 1 / 2×MIC, 1×MIC, and 2×MIC concentrations of palmatine decreased. These results suggest that palmatine inhibits intracellular ATP synthesis in methicillin-resistant Staphylococcus aureus, leading to energy metabolism imbalance. Ultimately, it inhibits bacterial growth by suppressing the bacterial basal metabolic pathway and blocking its proliferation.

[0100] (ix) Determination of the inhibitory effect of barmatin on MRSA biofilm formation

[0101] Single colonies were picked from ATCC 43300TSA plates and cultured in 4 mL of TSB medium at 37°C with shaking at 180 rpm until the logarithmic growth phase. 200 μL of the bacterial culture was inoculated into sterile 96-well plates, and a series of gradient concentrations of palmatine solution were added to achieve final concentrations of 2×MIC, 1×MIC, 1 / 2×MIC, and 1 / 4×MIC. The control group received no treatment. After incubation at 37°C for 24 h, the culture medium was discarded, and the plates were washed three times with 200 μL of sterile PBS buffer for approximately 30 seconds each time to remove airborne bacteria. 200 μL of 70% methanol was added for fixation for 30 min. The fixative was removed, and the 96-well plates were dried at 37°C. Biofilms were stained with 0.1% crystal violet solution for 5 min. The staining solution was removed, and the plates were rinsed three times with 200 μL of sterile PBS buffer, followed by drying at 37°C for 1 h. 200 μL of... The staining agent was dissolved in 33% acetic acid solution (for 15 minutes to ensure complete dissolution of the biofilm matrix), and the absorbance was measured at 570 nm using a multi-functional microplate reader.

[0102] The measurement results are as follows Figure 8As shown, the results indicate that the biofilm formation capacity of MRSA decreases in a dose-dependent manner with respect to drug concentration. When the concentration of palmatine is 1 / 2×MIC, the inhibition rate of MRSA biofilm formation after palmatine treatment reaches about 60%, which confirms that palmatine can effectively inhibit the formation of MRSA biofilm structure.

[0103] (x) Effects of barmatine on the mecA gene encoding PBP2a

[0104] (1) RNA extraction: Take the activated bacterial suspension and add different concentrations of prepared palmatine solution to make the final concentration of palmatine in the bacterial suspension 2×MIC, 1×MIC, 1 / 2×MIC, and 1 / 4×MIC, respectively. At the same time, a control group without palmatine solution was set up. The suspension was cultured in a constant temperature shaking incubator at 37℃ and 180rpm for 12h. The bacterial suspension was centrifuged at 4℃ and 6000rpm for 15min, and the bacterial pellet was collected and washed twice with DEPC water. The supernatant was removed by centrifugation at 8000rpm for 5min, and 20mg / mL lysozyme was added for 60min to enzymatically degrade the MRSA cell wall. RNA was extracted according to the RNA extraction kit (purchased from Tiangen Biotech (Beijing) Co., Ltd.). The RNA was aliquoted and stored in an ultra-low temperature environment at -80℃. The RNA purity and concentration were tested by an ultra-micro spectrophotometer and found to be up to standard before proceeding to the next step.

[0105] (2) Reverse transcription: Reverse transcription was performed using the MightyScript first-strand cDNA synthesis Master Mix (genomic DNA de-generated) kit from Sangon Biotech (Shanghai) Co., Ltd.

[0106] (3) Determination of relative expression levels

[0107] Real-time quantitative PCR was performed using the SGExcel FastSYBR qPCR premix kit from Sangon Biotech (Shanghai) Co., Ltd. cDNA was diluted 5–8 times as a template for detection. Primer sequences are shown in Table 1, and the real-time quantitative PCR reaction system is shown in Table 2.

[0108] Table 1 Primer Information

[0109] Gene name Primer-F Primer-R mecA AAAATCGATGGTAAAGGTTGGC AGTTCTGCAGTACCGGATTTGC

[0110] Table 2. Quantitative PCR amplification reaction system

[0111]

[0112]

[0113] The reverse transcription reaction was performed on a real-time PCR instrument according to the conditions in Table 3.

[0114] Table 3. Quantitative PCR Amplification Procedure

[0115]

[0116] Test results are as follows Figure 9 As shown, the results indicate that the relative expression level of the mecA gene in MRSA strains treated with different concentrations of palmatine showed a dose-dependent upregulation trend. This result suggests that palmatine can significantly upregulate the expression of the mecA gene encoding the PBP2a protein in MRSA through a regulatory network, and its mechanism of action may involve multiple levels, including de-transcriptional repression, stress response activation, and signaling pathway interference.

[0117] (xi) Determination of the hemolytic rate of erythrocytes by barmatin

[0118] It should be noted that the drug causes hemolysis of red blood cells because the drug's toxicity causes severe rupture of the cell membrane, releasing hemoglobin into the medium and turning the opaque cell suspension into a red, transparent hemoglobin solution. The effect of the drug on red blood cell hemolysis can be determined by detecting changes in the absorbance of the red blood cell solution.

[0119] (1) Preparation of red blood cell suspension: Take 1 mL of sterile defibrinated rabbit blood sample into 10 mL of sterile D-Hanks solution (pH = 7.2) and centrifuge (3000 rpm, 10 min) to obtain red blood cell precipitate; after taking the supernatant, wash with an equal volume of sterile D-Hanks solution (repeat 3 times, centrifuge at 3000 rpm, 10 min each time) until the supernatant is transparent after centrifugation; transfer 200 μL of dense red blood cell precipitate and resuspend it in 9800 μL of sterile D-Hanks solution to prepare a standard red blood cell suspension with a final concentration of 2%;

[0120] (2) Take the red blood cell suspension from step (1) and mix it with equal volumes of graded concentrations of bamatine solution (the final concentrations of bamatine are 1×MIC, 2×MIC, 4×MIC, and 8×MIC), and incubate it in a constant temperature incubator at 37℃ for 1 h; Triton X-100 solution is set as a positive control and physiological saline is set as a negative control, and incubate them simultaneously.

[0121] (3) After incubation, remove the samples, centrifuge at 3000 rpm for 10 min at 4℃, aspirate the supernatant, and add 100 μL to each well of a 96-well plate, with 3 replicates per group. Use a multi-functional microplate reader with OD5000. 530nm The corresponding absorbance was measured. Hemolytic activity was calculated using the following formula:

[0122] Hemolysis rate (%) = [(sample OD)] 530nm - Negative OD 530nm ) / (positive OD530nm - Negative OD 530nm )]×100%.

[0123] Hemolysis test data as follows Figure 10 As shown, the positive control group exhibited typical hemolytic effects, while no significant hemolytic reaction was detected in any of the palmatine treatment groups. The dose escalation study showed that within the concentration range of 1×MIC to 8×MIC, the hemolytic activity remained in the range of 0.45%–3.90% (1×MIC: 0.45%, 2×MIC: 1.38%, 4×MIC: 2.50%, 8×MIC: 3.90%), significantly lower than the clinical safety threshold (5%). This data indicates that palmatine has a good safety profile.

[0124] Example 2

[0125] This invention provides an in vivo test of the antibacterial effect of palmatine on MRSA.

[0126] (I) Experimental Grouping

[0127] Sixty KM mice (6-8 weeks old, weighing 18-22g) were acclimatized for one week and then randomly assigned to six experimental groups, with 10 mice in each group. The experimental groupings are shown in Table 4 below.

[0128] Table 4. Experimental Grouping

[0129] Group Name Quantity (pieces) Blank control group (normal group) 10 Model control group (model group) 10 Low-dose treatment group of Parmaline (low-dose group) 10 Bermatine medium-dose treatment group (medium-dose group) 10 High-dose treatment group of barmatine (high-dose group) 10 Vancomycin treatment group 10

[0130] (II) Establishment of bacteremia model and administration method

[0131] (1) Experimental mice were administered 100 μL of a 2×10⁻⁶ concentration via the tail vein. 9 Injection of a bacterial suspension (MRSA, MRSAATCC 43300, purchased from Shanghai Luwei Technology Co., Ltd.) at CFU / mL yielded a single dose of 2×10⁻⁶ bacteria. 8 CFU was injected into the blank control group, while an equal volume of sterile PBS buffer was injected.

[0132] (2) Twenty-four hours after bacterial injection, each treatment group was treated according to the body weight to drug volume ratio. The palmatine treatment group received palmatine solutions (500 μg / mL, 1000 μg / mL, and 2000 μg / mL, with physiological saline as the solvent) via tail vein injection, corresponding to doses of 2.5 mg / kg, 5 mg / kg, and 10 mg / kg body weight, respectively. The vancomycin group received a 1000 μg / mL solution (with physiological saline as the solvent) to achieve a dosage standard of 5 mg / kg body weight. The blank control group received continuous sterile PBS buffer treatment. During the efficacy observation phase, physiological changes in the subjects were systematically recorded every 2 hours, covering indicators such as activity level and feeding behavior. Individuals that died during the experiment underwent immediate tissue fixation, and the overall intervention period lasted 7 days.

[0133] (III) Detection of basic phenotype in mice

[0134] (1) Changes in mouse appearance

[0135] The changes in mice before and after infection in each group were observed as follows:

[0136] Before infection, mice exhibit healthy characteristics: their fur is soft and glossy, they maintain a stable intake of food and water, and their behavior is regular. After infection, mice show significant pathophysiological states: they hardly eat, their drinking frequency drops sharply, they move slowly, accompanied by a continuous decrease in body weight and their fur becomes frizzy and dull. Individuals in the endangered stage exhibit typical pathological characteristics: kyphosis, hemiplegic motor dysfunction, loss of voluntary movement ability, weak respiratory rhythm, and body surface temperature significantly lower than the physiological normal threshold.

[0137] (2) Changes in mouse body weight

[0138] Longitudinal analysis of body weight changes in mice before and after infection for 7 days was performed, and the results are shown in Table 5. The results showed that, compared with the normal group, the weight changes of mice in the other groups were significantly different (P<0.05), but there were no significant differences in weight changes among the vancomycin group, the medium- and high-dose palmatine groups.

[0139] Table 5. Effects of barmatin on body weight in MRSA-infected mouse models

[0140]

[0141] Note: *: P < 0.05 compared to the normal group; **: P < 0.01 compared to the normal group; ***: P < 0.001 compared to the normal group.

[0142] (3) Mouse survival rate analysis

[0143] Based on the recorded time and number of deaths for each group, survival rates were analyzed by plotting survival curves, as shown in the figure below. Figure 11 As shown in Table 6, the survival rates were as follows. The results showed that mice in the model group began to die 24 hours after infection, and the first deaths occurred in the low-dose palmatine treatment group on day 3. Survival analysis at the experimental endpoint (day 7) showed that the survival rate in the model group decreased to 50%, the low / medium-dose treatment groups maintained 70% and 80% survival levels respectively, and all other groups maintained 100% survival.

[0144] Table 6. Effect of barmatin on survival rate of MRSA-infected mice

[0145]

[0146] (iv) Detection of other indicators in mice

[0147] (1) Blood routine test

[0148] On day 7 after infection modeling, blood was drawn from the eyes of 3 mice in each group according to the experimental design, and the blood was collected into vacuum blood collection tubes. Then, a complete blood count was performed using a fully automated veterinary blood cell analyzer (BC-30Vet, purchased from Shenzhen Mindray Animal Medical Technology Co., Ltd.), and the results are shown in Table 7 below.

[0149] Table 7. Effects of palmatine on blood routine tests in MRSA-infected mice (n=3)

[0150]

[0151]

[0152] Table 7 shows that the model group exhibited clear severe anemia, with significantly lower hemoglobin, red blood cell count, and hematocrit compared to the normal group. Combined with decreased mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and hematocrit, this is consistent with microcytic hypochromic anemia. Among the treatment groups, the vancomycin group and the high-dose group showed the most significant improvement: the vancomycin group's HGB, RBC, and HCT were close to or exceeded normal levels, indicating complete correction of anemia; the high-dose group's HGB and RBC exceeded the normal range, suggesting that the drug may have overstimulated erythropoiesis. The medium-dose and low-dose groups showed near-normal indicators and good safety profiles. The model group exhibited significant acute bacterial inflammation characteristics: elevated WBC, a surge in neutrophil count (Gran% reaching 58.4%), and a significantly decreased lymphocyte percentage, consistent with a systemic inflammatory response caused by MRSA infection. Among the treatment groups, the vancomycin group showed the most significant anti-inflammatory effect, with significantly improved WBC and Gran% compared to the model group, and Lymph% recovering to 60.6%, indicating effective recovery of the immune status. Although the high-dose group showed near-normal WBC and neutrophil counts, the Gran% was still elevated, possibly reflecting the potential risk of immunosuppression accompanying the drug's anti-inflammatory effect. The low-dose group showed abnormally elevated WBC counts, but Gran# and Gran% were lower than the model group, suggesting possible initial drug-induced immune stimulation or mixed infection. The medium-dose group had WBC counts similar to the model group, but the Gran% remained high, indicating insufficient inflammation control. This suggests that palmatine has a certain ameliorative effect on anemia and inflammation caused by MRSA.

[0153] (2) Liver and kidney marker testing

[0154] On day 7 post-infection, the remaining mice in each group were sacrificed and samples were collected. Whole blood was collected by ocular blood sampling, with the single sample volume strictly controlled within the range of 0.5-0.8 mL. The upper plasma component was immediately separated by centrifugation at 3000 rpm for 5 min at 4 °C. The plasma was aliquoted into sterile cryovials, flash-frozen in liquid nitrogen, and then transferred to an ultra-low temperature freezer at -80 °C for long-term storage to avoid hemolysis that could lead to sampling failure.

[0155] Plasma samples were analyzed using reagent kits to detect liver function-related enzyme indicators (ALT and AST) and kidney function metabolites (BUN and CR). The kits were sourced from Nanjing Jiancheng Research Institute, and the corresponding kit models were ALT test kit C009-2-1, AST test kit C010-2-1, BUN test kit C013-2-1, and creatinine assay kit C011-2-1. The effects of MRSA infection on liver and kidney function were systematically evaluated by comparing the dynamic changes in serum biochemical parameters before and after infection. The results are shown in Table 8. Figure 12 As shown.

[0156] Table 8 Effects of palmatine on liver and kidney markers in MRSA-infected mice (n=3)

[0157]

[0158] From the above table 8 and Figure 12 It can be seen that ALT, AST, BUN, and CRE in the normal group were all within the healthy range, indicating normal liver and kidney function. In the model group, ALT, BUN, and CRE were elevated, indicating hepatocellular damage and impaired glomerular filtration function. In the high-dose palmatine group, ALT and AST recovered to near normal levels, while BUN and CRE decreased by 6.0% and 16.3%, respectively. The medium-dose palmatine group showed the second best effect. In the low-dose palmatine group, BUN and CRE increased instead of decreasing, suggesting that the low dose may have increased the burden on the kidneys. Although the vancomycin group improved kidney function, CRE and ALT were still weaker than in the high-dose group. The results indicate that palmatine has a certain protective effect on the liver and kidneys.

[0159] (3) Results of bacterial count culture in mouse blood

[0160] Blood was collected from mice via the eye, with 100 μL of whole blood sample taken from each group. The samples were then evenly spread onto PCA medium using a sterile spreader. Different concentration groups were established through serial dilution, with three replicates for each treatment group. The inoculated samples were incubated at 37°C for 24 h. Colony counting was performed immediately after incubation. The results are shown in Table 9.

[0161] Table 9. Effects of barmatin on blood bacterial counts in MRSA-infected mice.

[0162] Grouping Dosage (mg / kg) Sample size (individuals) Blood bacterial count (CFU / mL) normal group / 10 0±0*** Model group / 10 9207±1128 Barmatine 2.5 10 6321±688* Barmatine 5 10 5189±762** Barmatine 10 10 3746±583*** Vancomycin group 10 10 3468±774***

[0163] Note: *: P < 0.05 compared to the model group; **: P < 0.01 compared to the model group; ***: P < 0.001 compared to the model group.

[0164] Table 9 shows that the peripheral blood bacterial load in the model group was significantly higher than that in the blank control group, while the bacterial load in the vancomycin group and the palmatine treatment groups (low, medium, and high dose groups) showed a dose-dependent decreasing trend. Further comparison showed that the bacterial load level in the high-dose palmatine group was not significantly different from that in the vancomycin group, confirming that palmatine at this dose has a blood MRSA clearance capacity comparable to that of standard treatment drugs.

[0165] (4) Results of homogenate counting of important internal organs in mice

[0166] Fresh, excised organ tissues were minced and quantitatively transferred into homogenization tubes. An appropriate volume of pre-cooled physiological saline was added, and homogenization was performed under low-temperature conditions. After tissue disruption, 100 μL of the homogenate was evenly spread onto the surface of PCA medium. Different concentration sample groups were established using a series of dilution gradients, with three replicates for each experimental group. The inoculated medium was incubated at 37°C for 24 hours. After incubation, colony counting analysis was performed. The results are shown in Table 10.

[0167] Table 10 Infection levels of various organs

[0168]

[0169] Note: "0" represents <10 3 "1" represents 10 3 ~10 4 "2" represents 10 4 ~10 5 "3" represents 10 5 ~10 6

[0170] As shown in Table 10 above, the liver and spleen exhibited the highest bacterial load levels, with colony-forming units (CFU) 1-2 orders of magnitude higher than those in the heart, lungs, and kidneys. The bacterial load in each organ of the model group was significantly higher than that in other groups. Compared with the model group, the bacterial load in the low, medium, and high dose groups of palmatine and the vancomycin-positive control group was reduced by 1-2 orders of magnitude, confirming that palmatine can effectively clear the number of pathogens in the internal organs of MRSA-infected mice and has an anti-infective effect.

[0171] (5) Observation of histopathological sections of mouse lung tissue (HE staining)

[0172] 1) Freshly sourced materials are fixed with 4% paraformaldehyde for 24 hours.

[0173] 2) After rinsing the fixed tissue with tap water overnight, the tissue was sequentially treated with 50% ethanol for 1 hour, 70% ethanol for 1 hour, 80% ethanol for 1 hour, 95% ethanol for 30 minutes, 100% ethanol I for 30 minutes, and 100% ethanol II for 30 minutes to complete a gradient dehydration process. After dehydration, the tissue was immersed in a solution of 50% ethanol and 50% xylene for 30 minutes, followed immediately by immersion in pure xylene for 30 minutes. Once the tissue became transparent, paraffin infiltration began.

[0174] 3) Melt the paraffin wax in an oven beforehand. First, soak it in a mixture of 1 / 2 xylene and 1 / 2 paraffin wax for 1.5 hours, then transfer it to pure paraffin wax and soak for another 1.5 hours. Preheat the embedding device. Place the metal mold and its matching embedding box in a constant-temperature wax bath to achieve temperature equilibrium. Once the predetermined temperature is reached, move the metal mold below the wax injection port. Briefly press the wax plate to release an appropriate amount of liquid paraffin, controlling the injection volume so that the liquid level is slightly higher than the sample surface. Then, remove the embedding box from the preheating area and precisely position the sample in the center of the mold, ensuring the sample cross-section is parallel to the embedding plane during the operation.

[0175] 4) After the paraffin block cools, adjust it to expose the target tissue. Fix the paraffin block on the microtome and use the control interface to precisely calibrate the spatial relationship between the sample and the microtome blade. Perform continuous sectioning by rotating the sample feeder, setting the slice thickness parameter to 5μm. Gently transfer the cut paraffin slides into the slide spreader using a brush. Set the water temperature to 40℃. When the tissue slides are flat, without wrinkles or diffusion, slightly tilt the slides to remove water and allow them to air dry at room temperature.

[0176] 5) The slide samples were dewaxed twice with xylene solution, 5–10 min each time. They were then rehydrated using a gradient of ethanol (concentration gradient set at 100%, 95%, 85%, and 75%), maintaining each concentration for 3 min, followed by soaking in distilled water for 2 min. The samples were then transferred to hematoxylin staining solution for nuclear staining, and after staining for 5 min, the free staining material was washed off with deionized water. Differentiation solution was applied for 1 min, followed by rinsing twice with tap water for 5 min each time. The cytoplasm was then immersed in eosin staining solution for 2 min, and after removing the staining agent, accelerated dehydration was performed.

[0177] 6) Dehydration, clearing, and sealing: Immerse in 75% ethanol, 85% ethanol, 95% ethanol, and 100% ethanol (Ⅰ) for 10 seconds each; immerse in 100% ethanol (Ⅱ) for 1 minute; clear with xylene twice for 1 minute each time; and permanently seal with neutral optical resin.

[0178] 7) Microscopic examination, image acquisition and analysis.

[0179] The test results for each group of mice are as follows: Figure 13As shown, the alveolar structures in the normal group, vancomycin group, and high-dose palmatine group were clearly visible, appearing as uniformly sized, thin-walled cavities lined with a single layer of flattened epithelial cells. The nuclei were flattened, round, and deeply stained, adhering to the basement membrane. The alveolar cavities appeared as a hollow network, with occasional small amounts of pale pink proteinaceous fluid. The alveolar septa were rich in capillaries, with dilated lumens, flattened endothelial cells, and orange-red erythrocytes. Interstitial connective tissue was scarce, with scattered fibroblasts and elastic fibers, which were lightly stained. The bronchial mucosa consisted of pseudostratified ciliated columnar epithelium with neatly arranged nuclei and a deep pink brush-like border on the ciliated layer. The walls of the bronchioles were thin, with the smooth muscle layer arranged in a ring, and the cytoplasm was eosinophilic. The overall structure was clearly layered, without inflammatory cell infiltration or tissue destruction, reflecting the normal gas and blood exchange function of lung tissue. Compared with the normal group, the model group showed alveolar rupture, a small number of red blood cells in the alveolar cavities, moderate inflammatory cell infiltration, alveolar septal rupture, pale staining, necrosis, and a small amount of pigment deposition in the alveoli, and thickened alveolar walls. The low-dose palmatine group showed alveolar rupture, a large number of red blood cells in the alveolar cavities, moderate inflammatory cell infiltration, alveolar septal rupture, and microthrombus formation. The high-dose palmatine group showed mild inflammatory cell infiltration, alveolar wall thickening, and microthrombus formation.

[0180] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. Use of barmatine or its salts in the preparation of a medicament for treating anemia caused by methicillin-resistant Staphylococcus aureus infection.

2. The use according to claim 1, characterized in that, Parmaline or its salts have one or more of the following functions: (A2) Palmatine or its salts have the function of reducing the viral load of methicillin-resistant Staphylococcus aureus in the blood; (B2) Parmatin or its salts have the function of reducing the load of methicillin-resistant Staphylococcus aureus in organs.

3. The use according to claim 1 or 2, characterized in that, Drug dosage forms include tablets, powders, injections, oral liquids, sprays, patches, or ointments.

4. The use according to claim 1 or 2, characterized in that, Parmatine is a hydrochloride salt.

5. The use according to claim 1 or 2, characterized in that, Parmaline or its salts have one or more of the following functions: (A1) Barmatine or its salts have the function of increasing the permeability of the cell wall structure of methicillin-resistant Staphylococcus aureus; (B1) Barmatine or its salts have the function of damaging the cell membrane of methicillin-resistant Staphylococcus aureus; (C1) Barmatine or its salts have the function of disrupting the extracellular barrier structure and intracellular homeostasis system of methicillin-resistant Staphylococcus aureus; (D1) Barmatine or its salts have the function of inhibiting intracellular ATP synthesis in methicillin-resistant Staphylococcus aureus; (E1) Barmatine or its salts have the function of inhibiting the formation of biofilm structures by methicillin-resistant Staphylococcus aureus; (F1) Palmatine or its salts have the function of promoting mecA gene expression.

Images