Trametes hirsute Zjut HJ2301 and application thereof in preparation of galactooligosaccharide through solid state fermentation
Through the solid fermentation technology of Zjut HJ2301 of the thyrosus Zjut HJ2301, the use of wheat bran and other agricultural waste to efficiently produce extracellular β-galactosidase, solving the problems of high liquid fermentation costs and serious pollution, and achieving low-cost and environmentally friendly galactose production.
Patent Information
- Application Number
- CN202510833355.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-20
- Publication Date
- 2025-09-05
AI Technical Summary
The existing methods for producing galactose oligosaccharides in liquid fermentation are costly, energy consumption is high and contaminated. The extraction of intracellular β-galactosidases is complex, making it difficult to achieve efficient and low-cost industrial production.
The solid fermentation of the supra supra supra supra supra supra is used for solid fermentation, and agricultural waste such as wheat bran is used as carbon source to directly secrete extracellular β-galactosidase, avoid cell fragmentation steps, reduce production costs and reduce wastewater production.
A new strain that produces β-galactosidase efficiently has been realized, which reduces production costs, simplifies the enzyme extraction process, improves enzyme recovery rate, and reduces environmental pollution, and has the potential for industrial application.
Smart Images

Figure BDA0005459987010000071 
Figure HDA0005459987020000011 
Figure HDA0005459987020000012
Abstract
Description
(1) Technical field
[0001] The invention relates to Trametes trichomoniasis Zjut HJ2301 and application thereof in preparing galacto-oligosaccharides by solid-state fermentation. (2) Background technology
[0002] Galacto-oligosaccharides (GOS) are a well-known prebiotic that cannot be directly digested and absorbed by the human body. Instead, they are fermented and utilized by intestinal microorganisms to produce a series of health benefits, such as improving constipation, regulating intestinal flora, enhancing immunity, promoting mineral absorption, and improving allergic skin. Currently, GOS has been widely used in many fields such as food, pharmaceuticals, and agriculture. GOS is mainly composed of 2 to 10 galactose units and a terminal glucose unit. Its structural formula is (Galactose) n -Glucose. In addition, galactosyl disaccharide, which consists of two galactose units, is also considered a galacto-oligosaccharide and can be biosynthesized by β-galactosidase.
[0003] β-galactosidase is ubiquitous in various organisms, including plants, animals, and microorganisms. β-galactosidase used in industry is primarily derived from microorganisms, such as Aspergillus oryzae, Aspergillus niger, Escherichia coli, Bacillus circulans, and Kluyveromyces. Although β-galactosidase from different sources is widely used, fungal-derived β-galactosidase has always been dominant in the production of galacto-oligosaccharides. Compared to bacterial-derived β-galactosidase, fungal-produced β-galactosidase is mostly an extracellular enzyme, which is easier to extract, generally stable, and has high heat and acid resistance.
[0004] Currently, most fungi produce β-galactosidase through liquid fermentation, such as Aspergillus oryzae BLCY-006 (patent application CN201811596603.7) and Aspergillus oryzae BLB-21 (patent application CN200910018452.1). Liquid fermentation medium is expensive and usually requires the use of high-quality, high-purity raw materials, such as refined sugar and yeast extract. These raw materials are relatively expensive, thereby increasing production costs. In addition, a large amount of wastewater is generated during the process, which contains high levels of organic matter and microorganisms. Residues and other pollutants require strict environmental treatment, resulting in high wastewater treatment costs. Furthermore, liquid fermentation typically consumes significant amounts of electricity to maintain agitation and temperature control in the fermenter, increasing energy consumption. Furthermore, some strains that produce intracellular β-galactosidase, such as Kluyveromyces fragilis BLB-22 (patent application CN201110327007.0) and Penicillium expansum F3 (patent application CN200810014906.3), typically require mechanical, chemical, or enzymatic disruption to release the enzyme. This requires the use of expensive equipment and reagents, such as ultrasonic disrupters and high-pressure homogenizers, and is complex, time-consuming, and energy-intensive, increasing production costs.
[0005] Therefore, screening new β-galactosidase-producing fungi to synthesize oligosaccharides has important industrial application prospects. (3) Summary of the invention
[0006] The present invention aims to provide a Trametes trichothioides Zjut HJ2301 and its use in solid-state fermentation preparation of galacto-oligosaccharides. The new strain provided by the present invention not only enriches the source of β-galactosidase-producing strains with transglycosylation activity, but also can efficiently produce extracellular β-galactosidase from inexpensive agricultural waste (such as wheat bran and sugarcane bagasse) through solid-state fermentation (SSF), without the need for cell wall destruction to extract the enzyme, thereby reducing production costs and laying a foundation for the efficient synthesis of galacto-oligosaccharides using the β-galactosidase produced by the strain.
[0007] The technical solution adopted in the present invention is:
[0008] The present invention provides a new β-galactosidase-producing strain, Trametes hirsuta ZjutHJ2301, which is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M 2025474 and a deposit date of March 14, 2025. The address is: Wuhan University, Wuhan, China, Postal Code: 430072.
[0009] The Trametes trichomoniasis Zjut HJ2301 of the present invention is a fungus screened and isolated from soil. It is cultured on a plate culture medium at 37°C for 5 days. The colony is white and fluffy, with a dry surface and hyphae extending radially outward. The hyphae at the edge are sparse and the tips are transparent, and gradually become dense in the later stage.
[0010] The present invention also provides an application of the Trametes tricholoma Zjut HJ2301 in preparing oligogalactose by solid-state fermentation. The application method comprises the following steps: resuspending a product obtained by solid-state fermentation culture of the Trametes tricholoma Zjut HJ2301 in a pH 5-7 buffer solution and filtering the product; collecting the filtrate as a catalyst; using lactose as a substrate and a pH 5-7 buffer solution as a reaction medium; carrying out a conversion reaction at 25-40° C. and 100-300 rpm; and separating and purifying the conversion liquid to obtain oligogalactose.
[0011] Preferably, the culture medium for solid-state fermentation culture consists of a fermentation matrix and deionized water; the fermentation matrix consists of wheat bran, tryptone, KH2PO4 and MgSO4·7H2O; the mass ratio of wheat bran to tryptone is 1:0.005-0.25, the mass ratio of wheat bran to KH2PO4 is 1:0.001-0.025, and the mass ratio of wheat bran to MgSO4·7H2O is 1:0.001-0.02; and the volume of deionized water used is 1-3 mL / g based on the mass of the solid matrix.
[0012] Preferably, the mass ratio of wheat bran to tryptone is 1:0.01, the mass ratio of wheat bran to KH2PO4 is 1:0.002, and the mass ratio of wheat bran to MgSO4·7H2O is 1:0.001; and the volume of deionized water used is 2 mL / g based on the mass of the solid matrix.
[0013] Preferably, the conversion reaction is carried out at 37° C. and 200 rpm.
[0014] Preferably, the final concentration of lactose added is 100-500 g / L, preferably 300 g / L, based on the volume of the reaction medium; the amount of the catalyst is based on the enzyme activity of β-galactosidase, and the amount of β-galactosidase is 1-5 U / g based on the mass of lactose. 乳糖 , preferably 4U / g 乳糖 .
[0015] Preferably, the buffer solution is a 0.1 M sodium hydrogen phosphate-citrate buffer solution at pH 5.5.
[0016] Preferably, the product obtained after solid-state fermentation of Trametes trichomoniasis Zjut HJ2301 is added to a 0.1M sodium hydrogen phosphate-citrate buffer solution at pH 5.5, shake-cultured at 37° C. and 200 rpm for 1 hour, and then filtered using a cotton ball to obtain a crude enzyme solution.
[0017] Preferably, the crude enzyme solution is prepared as follows:
[0018] (1) Preparation of spore suspension: Trametes trichomoniasis Zjut HJ2301 was inoculated into a plate culture medium, cultured at 37°C for 5-7 days, sterile water was added, spores were gently scraped off with a sterile pipette tip, and the spore suspension was filtered through a sterilized cotton ball to obtain a spore suspension; the final concentration of the plate culture medium was: lactose 10 g / L, tryptone 5 g / L, KH2PO4 1 g / L, MgSO4·7H2O 0.5 g / L, and the solvent was deionized water;
[0019] (2) solid-state fermentation culture: the spore suspension of step (1) is inoculated in an amount of 0.1-0.5 mL / g (preferably 0.1 mL / g) into a solid-state fermentation medium, and statically cultured at 37° C. for 4-6 days to obtain a culture; the solid-state fermentation medium is composed of a fermentation matrix and deionized water, and the fermentation matrix is composed of wheat bran, tryptone, KH2PO4 and MgSO4·7H2O; the mass ratio of wheat bran to tryptone is 1:0.005-0.25 (preferably 1:0.01), the mass ratio of wheat bran to KH2PO4 is 1:0.001-0.025 (preferably 1:0.002), and the mass ratio of wheat bran to MgSO4·7H2O is 1:0.001-0.02 (preferably 1:0.001); the volume of deionized water is 1-3 mL / g (preferably 2 mL / g) based on the mass of the solid matrix;
[0020] (3) Crude enzyme solution: add 0.1M sodium hydrogen phosphate-citrate buffer at pH 5.5 to the culture obtained in step (2), shake culture at 37°C and 200 rpm for 1 hour, and then filter with a cotton ball to obtain the filtrate as the crude enzyme solution; the volume of the buffer solution is 1-10 mL / g (preferably 5 mL / g) based on the mass of the fermentation substrate in step (2).
[0021] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:
[0022] (1) The present invention provides a new strain of β-galactosidase-producing Trametes zjut HJ2301; the strain can efficiently produce extracellular β-galactosidase through solid-state fermentation, and the solid matrix (such as agricultural waste) is directly used as a carbon source, which reduces the cost of the culture medium and avoids the generation of a large amount of wastewater by liquid fermentation. In a low-moisture environment, the contamination of miscellaneous bacteria during the fermentation process can be reduced; compared with intracellular β-galactosidase, the extracellular β-galactosidase is directly secreted into the environment and extracted more simply, without the need for steps such as cell disruption, resulting in a higher enzyme recovery rate and higher stability. It can directly act on the substrate without the participation of living microorganisms and is safer.
[0023] (2) The new strain of the present invention can produce 23.79 U / g of β-galactosidase by solid-state fermentation of wheat bran at 36°C for 6 days. 干基 The yield of catalyzing lactose to produce oligosaccharides can reach 32%.
[0024] (3) In addition, no studies have reported that Trametes spp. is pathogenic to humans, animals, or plants, nor has it been reported to produce mycotoxins (such as aflatoxins and ochratoxins), and it belongs to the low- to medium-risk group of fungi. Therefore, this strain has the potential to be used for the industrial production of galacto-oligosaccharides. (IV) Description of the accompanying drawings
[0025] Figure 1 , TLC chart of the transformation products of strain Zjut HJ2301 screened in Example 1. Sample 1 in the figure is a galactose standard sample; sample 2 is a glucose standard sample; sample 3 is a lactose standard sample; sample 4 is a mixed standard sample of glucose, galactose, and lactose; sample 5 is a commercially available galacto-oligosaccharide product (G909325, Macklin); sample 6 is a sample of lactose conversion catalyzed by the crude enzyme solution of strain Zjut HJ2301; the concentration of the standard samples in the figure is 10 mg / mL.
[0026] Figure 2 , colony morphology of Trametes trichomoniasis Zjut HJ2301.
[0027] Figure 3 , Microscopic examination of the hyphae of Trametes zjut HJ2301.
[0028] Figure 4 , phylogenetic tree of Trametes zjut HJ2301.
[0029] Figure 5 , HPLC graphs of the transformation products of Trametes zjut HJ2301 strain and mixed standard samples; 1 is the glucose standard sample; 2 is the galactose standard sample; 3 is the lactose standard sample; 4 is the transformation liquid sample of Trametes zjut HJ2301 strain.
[0030] Figure 6 、 Figure 5 A partial enlarged view of the circled area of sample 4. (V) Specific implementation methods
[0031] The present invention is further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto:
[0032] The culture medium used in the embodiments of the present invention is as follows:
[0033] Screening plate medium (g / L): lactose 10, tryptone 5, KH2PO4 1, MgSO4·7H2O 0.5, X-gal (5-bromo-4-chloro-3-indole-β-D-galactopyranoside) 0.024, streptomycin 0.01, agar 20, pH 5.5, solvent is deionized water.
[0034] Plate culture medium (g / L): lactose 10, tryptone 5, KH2PO4 1, MgSO4·7H2O 0.5, agar 20, pH 5.5, solvent is deionized water.
[0035] Proliferation medium (g / L): lactose 10, tryptone 5, KH2PO4 1, MgSO4·7H2O 0.5, pH 5.5, solvent is deionized water.
[0036] Screening fermentation medium (g / L): lactose 10, yeast extract 10, tryptone 5, KH2PO4 1, MgSO4·7H2O0.5, pH 5.5, solvent is deionized water.
[0037] Solid-state fermentation medium preparation method: weigh 5 g of wheat bran, 0.05 g of tryptone, 0.01 g of KH2PO4, and 0.005 g of MgSO4·7H2O and add them into a 250 mL conical flask, and then add 10 mL of deionized water.
[0038] Example 1: Screening and Isolation of Strain Zjut HJ2001
[0039] (1) Initial screening
[0040] 1 g of soil sample collected from an orchard in Guangdong Province was weighed and added to a test tube containing 10 mL of sterile water. The sample was shaken for half an hour to mix thoroughly. The soil suspension was then diluted with sterile water to different concentration gradients (10 -1 , 10 -2 , 10 -3 ), 100 μL of the above dilutions were respectively applied to the screening plate culture medium, cultured at 37°C until colonies appeared, and then single colonies with blue hydrolysis circles were inoculated into the screening plate culture medium for separation and purification. The culture was carried out under the same conditions for 3-5 days to obtain pure culture, which was stored at 4°C.
[0041] (2) Rescreening
[0042] A small piece of the pure culture preserved in step (1) was cut and inoculated into a proliferation medium and activated in a shaker at 200 rpm and 37°C for 48 hours. Then, the inoculum was inoculated into a conical flask containing 100 mL of screening fermentation medium at a 2% (v / v) inoculum and fermented under the above conditions for 48 hours. After fermentation, the wet cells were collected by filtration. 1 g of the wet cells was added to 5 mL of sodium hydrogen phosphate-citrate buffer (0.1 M, pH 5.5) containing a final concentration of 300 g / L lactose. The cells were reacted at 200 rpm and 37°C for 48 hours. After centrifugation at 9000 rpm for 10 minutes, the supernatant was collected as the crude enzyme conversion solution containing oligogalactose.
[0043] Thin-layer chromatography (TLC) was performed on the crude enzyme conversion solutions of different strains to determine the transglycosylation activity. Glucose standard sample (10 mg / mL, solvent is 0.1 M, pH 5.5 sodium hydrogen phosphate-citric acid buffer), galactose standard sample (10 mg / mL, solvent is 0.1 M, pH 5.5 sodium hydrogen phosphate-citric acid buffer), lactose standard sample (10 mg / mL, solvent is 0.1 M, pH 5.5 sodium hydrogen phosphate-citric acid buffer), mixed standard sample of glucose + galactose + lactose (all at a concentration of 10 mg / mL, solvent is 0.1 M, pH 5.5 sodium hydrogen phosphate-citric acid buffer) and commercial oligosaccharide product (G909325, Macklin) were used as controls. TLC thin plate (Silica gel) was used to analyze the transglycosylation activity of the crude enzyme conversion solutions of different strains. After spotting (gel60, 1.05554.0001, Merck), the sample was developed with n-butanol:ethanol:water = 5:3:2 (v / v / v), and the chromatography was performed to 1 cm from the top. After being taken out and dried with a hair dryer, 10% (v / v) sulfuric acid was sprayed as a color developer and baked in a 120°C oven for 10 minutes. If a new oligosaccharide spot is generated below the lactose spot, it means that the β-galactosidase produced by this strain has transglycosylation activity; otherwise, transglycosylation activity is not present. Based on the size of the corresponding oligosaccharide product spot on the TLC plate, a β-galactosidase-producing strain with high transglycosylation activity was selected and designated as strain Zjut HJ2301. The corresponding TLC spot is as follows: Figure 1 As shown in sample 6.
[0044] Example 2: Identification of strain Zjut HJ2301
[0045] The strain Zjut HJ2301 screened in Example 1 was identified.
[0046] (1) Morphological characteristics
[0047] The strain Zjut HJ2301 was inoculated into a plate medium and cultured at 37°C for 5-7 days. The colony morphology was observed. The colony was white and fluffy, with a dry surface, sparse hyphae at the edge and transparent tips. It gradually became dense in the later stage. Figure 2 Microscopic examination showed that the hyphae extended radially outwards. Figure 3 .
[0048] (2) ITS sequence analysis
[0049] The ITS gene sequence of strain Zjut HJ2301 was completed by Beijing Qingke Biotechnology Co., Ltd. The ITS sequence length of Zjut HJ2301 strain was measured to be 621 bp, and the specific nucleotide sequence is shown in SEQ ID NO. 1. The obtained strain ITS sequence was aligned with Genebank sequence, and a phylogenetic tree was constructed using MEGA-X. The results are shown in Figure 4 The strain ZjutHJ2301 was identified as Trametes hirsuta, named Trametes hirsuta Zjut HJ2301, and deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: M2025474. The deposit date was March 14, 2025. The address is: Wuhan University, Wuhan, China, Postal Code: 430072.
[0050] SEQ ID NO.1
[0051] AAGGTTTCGTAGGTGAACCTGCGGAAGGATCATTAACGAGTTTTGAAATGGGTTGTTGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTAGGTTGGCGTGGGTTTCTAGCCTCCGGGCTGGGAGC ATTCTGCCGGCCTATGTACATTACAAACTCTAAAGTATCAGAATGTAAACGCGTCTAACGCATCTTAATACAACTTTCACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAG TGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCCATAAGTCCTTGTGATCTATGGGCTTGGATTTGGAGGCTTGCTGGCCCTAGCGGTCGGCTCCTCTTGAATG CATTACTTGATTCCGTGCGGATCGGCTCTCAGTGTGATAATTGTCTACGCTGTGACCGTGAAGCGTTTTGGCAAGCTTCTAACCGTCCATTAGGACAATCTTTCAACATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATAT
[0052] Example 3: Preparation of galacto-oligosaccharides by solid-state fermentation of Trametes trichomoniasis HJ2301
[0053] 1. Preparation of crude β-galactosidase enzyme solution
[0054] (1) Plate culture:
[0055] Trametes trichomoniasis Zjut HJ2301 was inoculated on a plate culture medium and cultured at 37°C for 5-7 days.
[0056] (2) Preparation of spore suspension:
[0057] Add 10 mL of sterile water to the plate of step (1), gently scrape off the spores with a sterile pipette tip, and filter through a sterilized cotton ball to obtain a spore suspension with a spore concentration of 1×10 6 pieces / mL.
[0058] (3) Solid-state fermentation culture:
[0059] The spore suspension was inoculated into a solid fermentation medium containing 5 g of fermentation substrate at a rate of 0.1 mL / g, and static culture was carried out in a 37° C. incubator for 4-6 days. After the fermentation was completed, 50 mL of 0.1 M, pH 5.5, disodium hydrogen phosphate-citrate buffer was added, and the culture was shaken at 37° C. and 200 rpm for 1 hour. The filtrate was then filtered through a cotton ball to collect the filtrate to obtain a crude β-galactosidase enzyme solution.
[0060] 2. Crude enzyme activity detection
[0061] Take 20 μL of the crude β-galactosidase solution prepared in step (3) in a 1.5 mL centrifuge tube, add 480 μL of 1 mg / mL oNPG solution (2-nitrophenyl-β-D-pyranogalactoside, solvent is 0.1M, pH 5.5 sodium hydrogen phosphate-citrate buffer), keep warm at 40°C for 10 minutes, add 0.5 mL of 0.15 M Na2CO3 aqueous solution to terminate the reaction, and after the reaction is completed, measure the sample absorbance at a wavelength of 420 nm, and calculate the enzyme activity according to the oNP standard curve. The enzyme activity was detected to be 23.79 U / g 干基 .
[0062] Definition of enzyme activity unit (U): Under the above conditions, the amount of enzyme required to catalyze the oNPG reaction for 1 min to produce 1 μmol of o-nitrophenol (oNP) is defined as 1 enzyme activity unit (U).
[0063] Preparation of oNP standard curve: Using 0.1M, pH 5.5 disodium hydrogen phosphate-citric acid buffer as solvent, aspirate 0.2 mg / mL oNP solution 0, 0.1, 0.2, 0.3, 0.4, 0.5 ml, respectively, and place them into 6 centrifuge tubes. Supplement with 0.1M, pH 5.5 disodium hydrogen phosphate-citric acid buffer to 1.0 mL, respectively, to prepare oNP solutions of different concentrations. Add the solution used to stop the reaction (1 mL, 0.15 mol / L Na2CO3), shake well, and measure the OD 420 The oNP standard curve was drawn with oNP concentration and OD value as the horizontal and vertical coordinates, and the fitting equation was: y = 1.53x + 0.0019R 2 =0.999, where y is OD 420nm ; x is the oNP concentration (μmol / mL).
[0064] 3. Preparation of galacto-oligosaccharides using crude β-galactosidase enzyme solution
[0065] Add lactose to 10 mL of 0.1 M sodium hydrogen phosphate-citrate buffer (pH 5.5) to make the concentration 300 g / L, then add the crude enzyme solution prepared in step 1 to make the enzyme dosage 4 U / g. 乳糖, transform at 200 rpm, 37 ° C for 36 hours, centrifuge at 4 ° C, 8000 rpm for 10 minutes, collect the supernatant, and obtain the transformation liquid containing oligomeric galactose.
[0066] Glucose standard sample (40 mg / mL), galactose standard sample (40 mg / mL), lactose standard sample (40 mg / mL) prepared in 0.1 M, pH 5.5 sodium hydrogen phosphate-citrate buffer, and the conversion solution containing oligogalactose prepared above were filtered through a 0.22 μm filter membrane, and the filtrate was subjected to HPLC analysis to determine that the yield of oligogalactose in the transglycosylation reaction could reach 32% (such as Figure 5 、 Figure 6 shown).
[0067] The yield of galacto-oligosaccharides was calculated by the following formula:
[0068] [GOS]=[Lactose] i -[Lactose] r -[Glucose]-[Galactose]
[0069]
[0070] Where: [GOS] is the concentration of galacto-oligosaccharide in the reaction product; [Lactose] i is the initial lactose concentration in the reaction product; [Lactose] r is the residual lactose concentration of the reaction product; [Glucose] is the glucose concentration in the reaction product; [Galactose] is the galactose concentration in the reaction product; Y GOS is the yield of galacto-oligosaccharide.
[0071] HPLC detection conditions: Waters 1525 high-performance liquid chromatograph, Waters 2414 differential refractive index detector. Chromatographic column: NH2P-50 4E 4.6 mm i.D. × 250 mm amino column; mobile phase: acetonitrile: water = 70:30 (v / v), flow rate: 1.0 mL / min; temperature: 30°C; injection volume: 10 μL.
[0072] Example 4: Effect of substrate concentration on the conversion of lactose to galacto-oligosaccharides by crude β-galactosidase enzyme solution
[0073] The lactose concentration in Example 3 was changed to 200 g / L, and other operations were the same. The yield of galacto-oligosaccharide was 20.4%.
[0074] Example 5: Effect of enzyme dosage on conversion of lactose to galacto-oligosaccharides by crude β-galactosidase enzyme solution
[0075] The 4U / g 乳糖 The enzyme dosage was changed to 2U / g 乳糖 , other operations were the same, and the yield of galacto-oligosaccharide was 24%.
[0076] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. Any technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.
Claims
1. Trametes hirsuta Zjut HJ2301, deposited in China Center for Type Culture Collection, CCTCC NO: M 2025474, deposited on March 14, 2025, Address: Wuhan University, Wuhan, China, Postal Code: 430072.
2. Use of the Trametes trichomoniasis Zjut HJ2301 according to claim 1 in the preparation of galacto-oligosaccharides by solid-state fermentation.
3. The use according to claim 2, characterized in that The application method comprises the following steps: resuspending a product obtained by solid-state fermentation culture of Trametes trichomoniasis Zjut HJ2301 in a pH 5-7 buffer solution and filtering the product; collecting the filtrate as a catalyst; using lactose as a substrate and a pH 5-7 buffer solution as a reaction medium; carrying out a conversion reaction at 25-40° C. and 100-300 rpm; and separating and purifying the conversion liquid to obtain oligosaccharides.
4. The use according to claim 3, characterized in that The culture medium for solid-state fermentation culture consists of a fermentation matrix and deionized water; the fermentation matrix consists of wheat bran, tryptone, KH2PO4 and MgSO4·7H2O; the mass ratio of wheat bran to tryptone is 1:0.005-0.25, the mass ratio of wheat bran to KH2PO4 is 1:0.001-0.025, and the mass ratio of wheat bran to MgSO4·7H2O is 1:0.001-0.02; and the volume of deionized water used is 1-3 mL / g based on the mass of the fermentation matrix.
5. The use according to claim 4, characterized in that The mass ratio of wheat bran to tryptone was 1:0.01, the mass ratio of wheat bran to KH2PO4 was 1:0.002, and the mass ratio of wheat bran to MgSO4·7H2O was 1:0.001; the volume of deionized water used was 2 mL / g based on the mass of the solid matrix.
6. The use according to claim 3, characterized in that The final concentration of lactose added is 100-500 g / L based on the volume of the reaction medium; the amount of the catalyst is based on the enzyme activity of β-galactosidase, and the amount of β-galactosidase is 1-5 U / g based on the mass of lactose. 乳糖 .
7. The use according to claim 3, characterized in that The conversion reaction was carried out at 37°C and 200 rpm.
8. The use according to claim 3, characterized in that The buffer solution is a 0.1 M sodium hydrogen phosphate-citric acid buffer solution at pH 5.
5.
9. The use according to claim 3, characterized in that The product obtained by solid-state fermentation of Trametes trichomoniasis Zjut HJ2301 was added to a 0.1 M sodium hydrogen phosphate-citrate buffer solution at pH 5.5, and cultured at 37° C. and 200 rpm for 1 hour, and then filtered using a cotton ball to obtain a crude enzyme solution.
10. The use according to claim 9, characterized in that The crude enzyme solution was prepared as follows: (1) Preparation of spore suspension: Trametes trichomoniasis HJ2301 was inoculated into a plate culture medium, cultured at 37°C for 5-7 days, sterile water was added, spores were gently scraped off with a sterile pipette tip, and the spore suspension was filtered through a sterilized cotton ball to obtain a spore suspension; the final concentration of the plate culture medium was: lactose 10 g / L, tryptone 5 g / L, KH2PO4 1 g / L, MgSO4·7H2O 0.5 g / L, and the solvent was deionized water; (2) solid-state fermentation culture: the spore suspension of step (1) is inoculated in an amount of 0.1-0.5 mL / g into a solid-state fermentation medium, and statically cultured at 37° C. for 4-6 days to obtain a culture; the solid-state fermentation medium is composed of a fermentation matrix and deionized water, and the fermentation matrix is composed of wheat bran, tryptone, KH2PO4 and MgSO4·7H2O; the mass ratio of wheat bran to tryptone is 1:0.005-0.25, the mass ratio of wheat bran to KH2PO4 is 1:0.001-0.025, and the mass ratio of wheat bran to MgSO4·7H2O is 1:0.001-0.02, and the volume of deionized water is 1-3 mL / g based on the mass of the solid matrix; (3) Crude enzyme solution: add 0.1M sodium hydrogen phosphate-citrate buffer at pH 5.5 to the culture obtained in step (2), shake culture at 37°C and 200 rpm for 1 hour, and then filter with a cotton ball to obtain the crude enzyme solution; the volume of the buffer solution is 1-10 mL / g based on the mass of the fermentation substrate in step (2).
Citation Information
Patent Citations
Expansion penicillium strain as well as culture method and use thereof
CN101250484B
Aspergillus oryzae and method for preparing high purity galacto-oligosaccharides by using same
CN101691538B
Yeast strain capable of high-yield production of beta-galactosidase, and its application
CN102851220B
Aspergillusoryzae BLCY-006 and application thereof to preparation of galactooligosaccharide
CN109439552A