Brown planthopper prevention and control method based on gene segment Nlug009443.1 and application of brown planthopper prevention and control method

Abstract

The invention relates to the technical field of agricultural pest control, in particular to a brown planthopper control method based on a gene segment Nlug009443.1 and application. According to the invention, a gene segment Nlug009443.1 (as shown in SEQ ID NO.1) which can cause the death of the brown planthopper after interference is screened, and the brown planthopper can be effectively killed by injecting the dsRNA (as shown in SEQ ID NO.4) of the gene segment. The method has good safety in the aspects of environmental ecology and food, and a new way is provided for establishing the RNA interference technology to control brown planthoppers.

Description

Technical Field

[0001] The present invention relates to the technical field of agricultural pest control, and in particular to a method and application of controlling brown planthoppers based on the gene fragment Nlug009443.1. Background Art

[0002] Brown planthopper[ Nilaparvata lugens Brown planthoppers (NLP) are pests belonging to the family Delphacidae, family Cicadomorpha, order Hemiptera. They have a monophyly, feeding and breeding exclusively on rice. They are a common rice planthopper and are currently the primary rice pest in many Asian countries. An outbreak of brown planthoppers can cause severe losses to rice production.

[0003] Chemical pesticides have long been the primary means of controlling brown planthoppers (NLP). However, with their overuse, problems such as pesticide resistance, environmental pollution, and damage to non-target organisms have become increasingly prominent, seriously impacting the sustainability of agricultural ecosystems. Therefore, the search for more efficient, safe, and environmentally friendly pest control technologies has become a key focus of current agricultural research. To address this issue, the development of targeted and sustainable biological control strategies has become an urgent task in combating NLP.

[0004] RNA interference (RNAi), an emerging molecular biology tool, demonstrates significant potential in agricultural pest control due to its high specificity, low toxicity, and broad application prospects. RNAi uses specific short double-stranded RNA (dsRNA) to target and degrade the mRNA of pest genes, thereby inhibiting the expression of specific genes and disrupting the physiological functions of the pests, achieving the goal of pest control. Compared with traditional chemical control methods, RNAi is highly targeted and can reduce negative impacts on the environment and non-target organisms.

[0005] In view of this, the present invention is proposed. Summary of the Invention

[0006] In order to solve the above technical problems, the present invention provides a method and application of controlling brown planthopper based on the gene fragment Nlug009443.1.

[0007] Specifically, the technical solutions provided by the present invention are as follows: In a first aspect, the present invention provides a method for controlling brown planthoppers, which kills brown planthoppers by interfering with a brown planthopper lethal gene fragment, wherein the brown planthopper lethal gene fragment is Nlug009443.1, and its nucleotide sequence is shown in SEQ ID NO.1.

[0008] Preferably, the present invention utilizes dsRNA to interfere with the lethal gene fragment of brown planthopper.

[0009] Preferably, the nucleotide sequence of the dsRNA of the present invention is shown as SEQ ID NO.4.

[0010] Preferably, the dsRNA of the present invention is administered by microinjection.

[0011] Preferably, the concentration of the microinjected dsRNA of the present invention is 150-350 μg / mL.

[0012] In a second aspect, the present invention provides a biological material containing the dsRNA as described in SEQ ID NO. 4 or a gene encoding the dsRNA.

[0013] Preferably, the biological material of the present invention is a nucleic acid sequence, a recombinant vector or a host cell.

[0014] In a third aspect, the present invention provides the use of the biological material in controlling brown planthoppers.

[0015] In a fourth aspect, the present invention provides use of the biological material in preparing a product for controlling brown planthoppers.

[0016] In a fifth aspect, the present invention provides a preparation for controlling brown planthoppers, which contains biological materials such as the nucleic acid sequence, recombinant vector or host cell, and can effectively kill brown planthoppers by injection. Beneficial effects

[0017] The present invention provides a method and application for controlling brown planthoppers based on the gene fragment Nlug009443.1. The present invention screens for the gene fragment Nlug009443.1 (shown in SEQ ID NO. 1), which, upon interference, kills brown planthoppers. The dsRNA (shown in SEQ ID NO. 4) derived from this gene fragment is then injected into the brown planthoppers, effectively killing them. This method offers excellent environmental and food safety, providing a new approach for controlling brown planthoppers using RNA interference technology. DETAILED DESCRIPTION

[0018] Gene co-expression networks have become an indispensable tool in the field of entomology, contributing to a systematic understanding of the biological characteristics and functions of insects, as well as their interactions with the environment and other organisms within ecosystems. They also provide new perspectives and methods for exploring the important role of insects in agriculture, medicine, and ecology. This study utilizes the transcriptome of the brown planthopper (Nilaparvata lugens) to screen target genes through gene co-expression network analysis. The study identified an important target gene (the Nilaparvata lugens lethal gene fragment Nlug009443.1) that, upon interference, can cause the death of the brown planthopper. The study also provides a dsRNA encoding this lethal gene fragment and a method for its synthesis, providing a sequence and data foundation for establishing new strategies for controlling pests using RNA interference technology.

[0019] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention are described clearly and completely below. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention.

[0020] The endpoints and any values ​​of the ranges disclosed in this specification are not limited to the exact ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be considered to be specifically disclosed herein.

[0021] In the description of this specification, the reference terms "one embodiment", "some embodiments", "specific implementation methods", or "some specific implementation methods" and the like mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the embodiments of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.

[0022] Unless otherwise specified, the materials and reagents used in the following examples are all commercially available. Experimental methods without specific conditions specified in the examples are generally performed under conventional conditions or the conditions recommended by the manufacturer.

[0023] The sequences involved in the following embodiments include: SEQ ID NO.1:

[0024] SEQ ID NO.2: GTAAGCCCATCGACAAAGGA。

[0025] SEQ ID NO.3: CAGGTTCAAGAACAGGCACA。

[0026] SEQ ID NO.4: ACCGGTGATATCCTTCGGACGCCAGTATCAGAAGATATGCTTGGTCGTGTATTCAACGGAAGTGGTAAGCCCATCGACAAAGGACCTCCCATTCTTGCCGAGGATTATCTCGACATTCAAGGTCAACCCATCAATCCTTGGTCGCGTATCTATCCCGAGGAAATGATCCAGACTGGAATTTCAGCCATCGACGTCATGAACTCGATTGCTCGTGGCCAGAAAATTCCCATCTTTTCAGCTGCCGGTCTACCTCACAACGAAATTGCTGCTCAAATCTGTAGACAGGCTGGTCTTGTCAAACTGCCAGGAAAGTCAGTTCTCGATGACTCTGAGGACAACTTTGCTATTGTATTCGCAGCCATGGGAGTCAACATGGAAACTGCTCGATTCTTCAAACAGGATTTCGAGGAGAATGGTTCTATGGAGAACGTGTGCCTGTTCTTGAACCTGGCGAACGACCCGACGATCGAGCGTATCATCACACCACGCCTGGCGCTGACGGCC。

[0027] SEQ ID NO.5: TAATACGACTCACTATAGGGGTAAGCCCATCGACAAAGGA。

[0028] SEQ ID NO.6: TAATACGACTCACTATAGGGCAGGTTCAAGAACAGGCACA。 Example 1

[0029] Cloning of the Nlug009443.1 gene fragment: Total RNA of the brown planthopper was extracted using the Trizol method.

[0030] RNA was reverse transcribed using the HiScript II Q Select RT SuperMix for qPCR kit produced by Vazyme.

[0031] The cDNA obtained by reverse transcription was diluted 10 times with RNase-free H2O and used in the subsequent PCR reaction. The PCR primer sequences are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0032] DNA fragments were recovered using the FastPure Gel DNA Extraction Mini Kit produced by Vazyme.

[0033] DNA clones were obtained by ligation using the pMD™19-T Vector Cloning Kit produced by Takara and transformation of competent E. coli DH5α cells. Example 2

[0034] dsRNA synthesis of Nlug009443.1 gene fragment: Enter the target gene sequence at https: / / www.flyrnai.org / cgi-bin / RNAi_find_primers.pl to design primers. Try to limit the product length to around 500 bp and add the T7 promoter sequence: 5'-TAATACGACTCACTATAGGG-3' to the 5' end. The primer sequences are shown in SEQ ID NO. 5 and SEQ ID NO. 6.

[0035] This example uses the Novagen T7 RNAi Transcription Kit. Example 3

[0036] Microinjection of dsRNA into brown planthoppers: (1) Preparation of the gel base for microinjection: Prepare 2% agarose gel and fully melt it under high temperature. Then, pour the melted agarose gel into a sterile culture dish, ensuring that its thickness is uniform and sufficient to cover the toothpick and capillary placed in it, so as to form a groove suitable for a specific age of brown planthopper. After the agarose is completely cooled and solidified, gently remove the toothpick and capillary, leaving a groove on the gel base that matches the insect body shape to provide a stable support for subsequent microinjection.

[0037] (2) Drawing capillary needles for injection: Use a P-97 Micropipette Puller microinjection needle puller for drawing. The material used is a microelectrode glass capillary (B10024F) produced by Chengdu Weitan Scientific Instruments. Set the drawing program parameters according to the experimental requirements: the heating temperature (Heat) is set to 650, the pulling force (Pull) is set to 300, the pulling speed (Vel) is set to 150, and the heating time (Time) is set to 150ms.

[0038] (3) Microinjection: Inject the dsRNA liquid into a capillary needle and fix it on the microinjector. Use a blade to cut the needle into the appropriate thickness and length according to the age of the brown planthopper. Use the joystick to control the mechanical arm of the injection instrument to insert the capillary needle into the middle of the thorax between the hind legs of the brown planthopper. Then inject the dsRNA. The brown planthopper's abdomen will be slightly swollen during the injection. In addition to injecting the dsRNA of the target gene, dsGFP is also injected as a control group. Each group is repeated for 50 heads, and the injection dsRNA concentration is about 150–350 μg / ml.

[0039] (4) Phenotypic observation: The injected brown planthopper nymphs were immediately transferred to glass test tubes containing fresh rice plants for rearing, and their mortality within 8 days was counted. The results are shown in Table 1.

[0040] Table 1

[0041] As shown in Table 1, the injection of dsRNA of Nlug009443.1 had a significant lethal effect on brown planthoppers.

[0042] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A method for controlling brown planthoppers, which kills brown planthoppers by interfering with the lethal gene fragment of brown planthoppers, characterized in that: The brown planthopper lethal gene fragment is Nlug009443.1, and its nucleotide sequence is shown in SEQ ID NO.

1.

2. The method for controlling brown planthopper according to claim 1, wherein: Use dsRNA to interfere with the lethal gene fragment of brown planthopper.

3. The method for controlling brown planthopper according to claim 2, characterized in that: The nucleotide sequence of the dsRNA is shown in SEQ ID NO.

4.

4. The method for controlling brown planthopper according to claim 2 or 3, characterized in that: dsRNA is delivered via microinjection.

5. The method for controlling brown planthopper according to claim 4, characterized in that: The concentration of microinjected dsRNA was 150-350 μg / mL.

6. Biomaterial, characterized in that It contains the dsRNA as described in SEQ ID NO. 4 or its encoding gene.

7. The biomaterial according to claim 6, characterized in that: The biological material is a nucleic acid sequence, a recombinant vector or a host cell.

8. Use of the biological material according to claim 6 or 7 in controlling brown planthopper.

9. Use of the biological material according to claim 6 or 7 in preparing a product for controlling brown planthopper.

10. A preparation for controlling brown planthopper, characterized in that: It contains the biomaterial according to claim 6 or 7.

Images