Plasmodiophora brassicae chitinase PbCHT1 gene and application thereof in resistance breeding of Plasmodiophora brassicae

Abstract

The invention discloses a plasmodiophora brassicae chitinase PbCHT1 gene and an application thereof in plasmodiophora brassicae resistance breeding. According to the present invention, the HIGS (host induced gene silencing) vector targeting PbCHT1 is successfully constructed, and two transgenic Arabidopsis thaliana families (CHT1-C-4 and CHT1-C-8) are screened out; phenotypic analysis shows that the resistance of the transgenic plant to plasmodiophora brassicae is obviously enhanced, disease indexes are respectively reduced by 35% and 51%, and the biomass of pathogenic bacteria and the transcription level of PbCHT1 are obviously reduced. The results prove that the PbCHT1 promotes the pathogenicity of plasmodiophora brassicae by regulating chitin metabolism, and the infection process can be effectively blocked by silencing the gene. The potential of the HIGS strategy of the targeted chitinase in prevention and control of the clubroot of the cruciferae crops is proved, and a new material is provided for disease-resistant breeding of the oilseed rape.

Description

Technical Field

[0001] The invention belongs to the field of biological agriculture and relates to a root knotweed chitinase PbCHT1 gene and application thereof in root knotweed resistance breeding. Background Art

[0002] Clubroot is a worldwide soil-borne disease caused by Plasmodiophora brassicae, which poses a serious threat to the production safety of cruciferous crops. Cruciferous crops include many important species such as rapeseed, radish, cabbage, cabbage, mustard, etc., which occupy a very important position in the field of economic crops. They are of great significance to the stable and safe supply of grain and oil, the promotion of the integration of the three industries, and the promotion of rural revitalization. At present, traces of clubroot have appeared in more than 80 countries and regions around the world, resulting in a yield loss of 10%-15% of cruciferous crops worldwide. In addition, clubroot not only affects crop yield, but also has an adverse effect on crop quality. For example, the oil content of seeds of infected plants is reduced by about 2%-6%.

[0003] The life cycle of root-knot fungus is relatively complex and can be generally divided into two stages. As a pathogen, it lives in the soil along with diseased debris (diseased leaves, diseased fruits, etc.), and when conditions are right, it will attack crops from the roots. The most typical symptom of root-knot disease is the formation of spindle-shaped masses on the roots of plants. These masses restrict the transport of water and nutrients, causing the above-ground parts of infected plants to wilt due to lack of water and eventually die. Moreover, root-knot fungus can survive in the soil for 20 years. Once arable land is contaminated by it, it will no longer be suitable for growing cruciferous crops. Therefore, root-knot disease is also called the "incurable disease" of cruciferous crops.

[0004] Chitinase is a pathogenesis-associated protein that plays a crucial role in plant defense against pathogens and insect pests and is also involved in plant responses to abiotic stresses. It is a glycosyl hydrolase that uses chitin as a substrate and plays a crucial role in plant growth and development, as well as in resisting stress. It is a key plant defense factor and is closely associated with plant disease resistance. Chitin is widely distributed in fungal cell walls, arthropod cuticles, peritrophic membranes, and mollusk shells. Chitinase can achieve pest and disease resistance by degrading chitin in the cell walls of fungal viruses and damaging the digestive membranes of insects and nematodes. Currently, the use of chitinase gene transfection and other methods for controlling fungal diseases has been extensively studied. At least 31 pathogenic fungi (including variants and specialized forms) can induce plant chitinase, and purified plant chitinase has demonstrated in vitro inhibitory activity against fungi such as Rhizoctonia solani. However, there are no reports on whether chitinase genes can be used to control root knot fungi.

[0005] Traditional methods for clubroot control in agricultural production have numerous shortcomings. For example, chemical control using lime only provides a temporary solution, failing to permanently cure clubroot and potentially leading to soil compaction and other problems. Pesticide application, due to soil dispersion, can significantly reduce its effectiveness and cause environmental pollution. Breeding resistant varieties to clubroot is considered one of the most cost-effective and environmentally friendly measures. International efforts to identify disease-resistant resources in the Brassicaceae family began as early as the 1990s. Due to limited resistance resources in Brassica napus, researchers have simultaneously screened Brassica rapa (aa), Brassica oleracea (cc), and Raphanus sativus (rr), aiming to transfer resistance to Brassica napus through breeding, interspecific hybridization, or synthetic synthesis. Currently, research on cr loci has primarily focused on the Brassica a, b, and c genomes and the Raphanus r genome, where resistance loci have been identified. However, clubroot fungi often grow in mixed populations in the field, are highly resilient, and can rapidly mutate. Long-term cultivation of a single resistant rapeseed variety can easily lead to a loss of resistance.

[0006] Most of the clubroot resistance genes discovered so far come from the Brassica A genome, and most of the resistance sites come from Brassica rapa. As of 2022, a total of 28 resistance sites have been located in the Brassica resistance source, of which C ra and Crr1a have been successfully cloned and their functions have been verified. For example, the collaborative team of Chen Yuhang and Zhou Jianmin from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, cloned the broad-spectrum clubroot resistance gene "Weiqing" (WTS). This gene encodes a protein that has never been reported. After being introduced into rapeseed, it not only showed good resistance, but also completely normal growth and development; rapeseed carrying WTS showed high resistance to multiple root-root fungi, including strains that showed high pathogenicity in existing resistant varieties, indicating that WTS is a broad-spectrum resistance gene. However, the number of known clubroot resistance genes is still small, and the mechanism research is relatively weak. In addition, new toxic strains have appeared in the field, resulting in the loss of resistance of existing clubroot resistance genes. Therefore, discovering highly efficient and broad-spectrum clubroot-resistant genes is a huge challenge facing clubroot-resistant breeding. At the same time, exploring the role of chitinase genes in the prevention and control of clubroot fungi also has certain research value. Summary of the Invention

[0007] The purpose of the present invention is to address the above-mentioned deficiencies in the prior art and to provide a plasmodium fumigatus chitinase PbCHT1 and its application.

[0008] Another object of the present invention is to provide dsRNA, RNAi vector and application of PbCHT1 gene.

[0009] Another object of the present invention is to provide a method for cultivating plants resistant to clubroot.

[0010] The purpose of the present invention can be achieved through the following technical solutions:

[0011] A root-knot chitinase PbCHT1, characterized by being encoded by the gene shown in SEQ ID NO.1.

[0012] The CDS sequence of the Plasmodium flavescentis chitinase PbCHT1 gene is shown in SEQ ID NO.1.

[0013] The invention relates to an application of negatively regulating the coding gene of the root knotweed fungus chitinase PbCHT1 in improving the resistance of plants to clubroot disease and / or cultivating plants resistant to clubroot disease.

[0014] Application of a substance for negatively regulating the gene encoding the root knotweed fungus chitinase PbCHT1 in improving plant resistance to clubroot disease and / or cultivating clubroot disease-resistant plants.

[0015] A dsRNA of the PbCHT1 gene, whose target sequence is shown as 365bp to 619bp in SEQ ID NO.1.

[0016] A host-induced gene silencing RNAi vector for silencing the PbCHT1 gene, wherein the RNAi vector expresses the dsRNA.

[0017] The RNAi vector is constructed by the following method:

[0018] (1) Based on the coding sequence (CDS) of the PbCHT1 gene obtained from the genome sequencing results of ZJ-1, 409 bp (365 bp to 773 bp in SEQ ID NO. 1) were selected as the silencing sequence and the multiple cloning site of the ds1301 vector to design the amplification primers for the gene. The design information of the primer sequence from 5' to 3' included the vector end homologous sequence, restriction site and gene specific sequence (CHT1-dsRNA-3-F1: cccgtgcagctgcggggtaccACGACCGGGTCAGCATCCAG, CHT1-dsRNA-3-R1: cgcgtacgtaaggttggatccGACCAGAACCCGAGCATGCAGAC). The forward sequence of the PbCHT1 gene was obtained by PCR amplification using JZ-1 cDNA as a template and CHT1-dsRNA-3-F1 and CHT1-dsRNA-3-R1 as primers;

[0019] (2) The ds1301 vector was double-digested with BamH1 and Kpn1, and the forward sequence of the PbCHT1 gene was directionally cloned into the linearized ds1301 vector using seamless cloning technology to obtain the forward PbCHT1 vector;

[0020] (3) Using JZ-1 cDNA as a template and CHT1-dsRNA-3-F2 and CHT1-dsRNA-3-R2 as primers, the reverse sequence of the PbCHT1 gene was obtained by PCR amplification: CHT1-dsRNA-3-F2: caattcaattcagtggagctcGACCAGAACCCGAGCATGCA, CHT1-dsRNA-3-R2: gcaggactctagacccactagtACGACCGGGTCAGCATCC;

[0021] (4) The forward PbCHT1 vector was linearized using two restriction endonucleases, Sac1 and Spe1, and the reverse sequence of the PbCHT1 gene was directionally cloned into the linearized forward PbCHT1 vector using seamless cloning technology. After identification, a host-induced gene silencing RNAi vector for silencing the PbCHT1 gene was obtained.

[0022] An engineered bacterium containing the RNAi vector.

[0023] Any one of the following applications of the dsRNA, the RNAi vector or the engineered bacteria:

[0024] 1) Increase plant resistance to clubroot;

[0025] 2) preparing products for improving plant resistance to clubroot;

[0026] 3) Cultivate plants with improved resistance to clubroot;

[0027] 4) preparing products for cultivating plants with improved resistance to clubroot;

[0028] 5) Improving plants with high resistance to clubroot or preparing products made from plants with high resistance to clubroot;

[0029] 7) Inhibit the growth and development of clubroot bacteria;

[0030] 8) preparing a product for inhibiting the growth and development of clubroot bacteria.

[0031] The plant is selected from Arabidopsis thaliana or rapeseed.

[0032] A method for cultivating clubroot-resistant plants comprises introducing the host-induced gene silencing RNAi vector into a target plant to obtain clubroot-resistant plants, wherein the clubroot-resistant plants have higher resistance to clubroot than the target plant, and the dsRNA targets the PbCHT1 gene.

[0033] Beneficial effects:

[0034] Transcriptome analysis revealed that the chitinase gene PbCHT1 of the root-knot fungus Plasmodiophora brassicae is highly expressed during the dormant spore (RS), germination (PZ), and secondary plasmodium development (IN) stages of the infection process, suggesting its potential involvement in pathogen cell wall remodeling or host infection. Based on this, we successfully constructed a HIGS (host-induced gene silencing) vector targeting PbCHT1 and screened two transgenic Arabidopsis lines (CHT1-C-4 and CHT1-C-8). Phenotypic analysis revealed that the transgenic plants exhibited significantly enhanced resistance to root-knot fungus, with disease indexes reduced by 35% and 51%, respectively, and significantly decreased pathogen biomass and PbCHT1 transcript levels. These results confirm that PbCHT1 promotes root-knot fungus pathogenicity by regulating chitin metabolism, and that silencing this gene effectively blocks the infection process. The present invention confirms the potential of the chitinase-targeting HIGS strategy in the prevention and control of clubroot disease in cruciferous crops, and provides new materials for disease-resistant rapeseed breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 , Transcriptome expression levels of PbCHT1 at different stages of rapeseed infection with Plasmodium fumigatus: resting spore stage (RS), resting spore germination stage (PZ), and secondary plasmodium development stage (IN).

[0036] Figure 2 , Construction and verification of the ds1301-PbCHT1 RNAi vector. A, Forward sequence amplification of the PbCHT1 gene; B, First restriction enzyme digestion of the ds1301 vector (BamH1 and Kpn1); C, PCR verification of the forward ds1301-PbCHT1 vector by E. coli colony formation; D, Forward sequence amplification of the PbCHT1 gene; E, Second restriction enzyme digestion of the ds1301 vector (Sac1 and Spe1); F, PCR verification of the reverse ds1301-PbCHT1 vector by E. coli colony formation. Figure 3 Identification and growth phenotypes of ds1301-PbCHT1 RNAi transgenic seedling lines. A, Genomic DNA-based PCR identification of two transgenic seedling lines, CHT1-C-4 and CHT1-C-8, with Col-0 serving as a negative control. The top gel image shows the forward sequence amplification of PbCHT1; the middle gel image shows the reverse sequence amplification of PbCHT1; the bottom gel image shows the reference gene ACTIN2. B, Phenotypes of transgenic lines and Col-0 grown in nutrient soil for 30-40 days. Scale bar, 2 cm.

[0037] Figure 4ds1301-PbCHT1 RNAi transgenic seedlings show enhanced resistance to clubroot fungus. A, Wild-type Arabidopsis thaliana Col-0, CHT1-C-4, and CHT1-C-8 were photographed 21 days after inoculation with clubroot fungus. Scale bar = 2 cm. B, mRNA extraction and qPCR analysis of PbCHT1 mRNA expression in diseased roots of Col-0, CHT1-C-4, and CHT1-C-8 21 days after inoculation with R. thaliana. C, DNA extraction and qPCR analysis of R. thaliana biomass in diseased roots of Col-0, CHT1-C-4, and CHT1-C-8 21 days after inoculation with R. thaliana. D, Disease index of Col-0, CHT1-C-4, and CHT1-C-8 21 days after inoculation with R. thaliana. The ordinate represents the percentage of seedlings with the corresponding disease level relative to the total number of seedlings inoculated in that family, and the abscissa represents the different families. Each family was inoculated with 31–32 Arabidopsis plants. Numbers at the top of the bars indicate relative disease index. Significant differences were analyzed using the Wilcoxon rank sum test. **p < 0.01, ***p < 0.001. DETAILED DESCRIPTION

[0038] Arabidopsis thaliana Col-0 was obtained from a laboratory-maintained plant. The pathogen, Ustilaginoidea virens, was derived from a root system infected with clubroot (Williams race 1) ZJ-1 in a rapeseed experimental field in Zhijiang, Hubei Province. The plasmid vector ds1301 is publicly available in [Host-induced gene silencing of fungal-specific genes of Ustilaginoidea virens confers effective resistance to rice false smut, doi:10.1111 / pbi.13756].

[0039] Example 1 PbCHT1 gene sequence amplification and ds1301 vector construction

[0040] Extraction of total RNA from root knotweed fungus: Clean the diseased root material of freshly diseased rapeseed, grind the tissue sample into powder in a mortar with liquid nitrogen, quickly transfer the frozen tissue powder (50-100 mg) into a 2 mL centrifuge tube, add 1 mL of RNA extraction solution TRIpure, and immediately shake vigorously to mix. The homogenized sample is placed on ice for 10 minutes; add 0.2 mL of chloroform to each 1 mL of TRIpure, cover the tube tightly, immediately shake vigorously to mix, and place it on ice for 10 minutes; centrifuge at 4°C with a centrifugal force of 12000 rpm / min for 10-20 minutes. After centrifugation, the mixture is divided into three layers: a lower red organic phenol chloroform layer, a middle layer, and an upper colorless water layer. RNA is present in The supernatant of the water layer was transferred to a clean 1.5 mL centrifuge tube, and an equal volume of isopropanol was added. The tube was mixed by inversion and placed in a -20 ° C refrigerator for 10-30 minutes, and centrifuged at 4 ° C 12000 rpm / min for 10-20 minutes, and the supernatant was discarded. 1 ml of 75% ethanol prepared with DEPC water was added to wash the precipitate, and the tube was centrifuged at 4 ° C 12000 r / min for 5 minutes. The supernatant was discarded. Do not lose the RNA precipitate. Repeat this step twice. Finally, the centrifuge tube was placed in a centrifuge and emptied for 1 minute. The remaining liquid was carefully aspirated with a pipette, and the RNA precipitate was allowed to stand at room temperature for 5-10 minutes to dry. 30-50 uL of DEPC water was added to each tube to fully dissolve the RNA. The obtained RNA was measured for concentration using Nanodrop 2000 and stored at -80 ° C to prevent degradation for future use.

[0041] Forward sequence amplification of the PbCHT1 gene: Extracted RNA was used to synthesize first-strand cDNA using a reverse transcription kit (TransGene). Total reaction system: Total RNA 1-4ug, Anchored Oligo(dT) 18Add 1 µl of Primer (0.5 μg / µl), 1 µl of gDNA Remover, 1 µl of EasyScript RT / RI Enzyme Mix, and 10 µl of 2× ES Reaction Mix. Add RNase-free water to a volume of 20 µl. Mix gently and incubate at 42°C for 30 minutes. Heat at 85°C for 5 seconds to inactivate EasyScript RT / RI. Using a synthetic P. rhizogenes cDNA as a template, primers for gene amplification were designed based on a 409-bp silencing sequence within the coding sequence (CDS) of the PbCHT1 gene derived from the ZJ-1 genome sequencing results and the multiple cloning site of the ds1301 vector. Primers were designed to include vector end homology sequences, restriction sites, and gene-specific sequences from 5' to 3' (CHT1-dsRNA-3-F1: cccgtgcagctgcggggtaccACGACCGGGTCAGCATCCAG, CHT1-dsRNA-3-R1: cgcgtacgtaaggttggatccGACCAGAACCCGAGCATGCAGAC). PCR amplification was performed using the high-fidelity DNA polymerase KOD One. The total PCR amplification volume (40 μl) consisted of 10 μM Primer F (1 μl), 10 μM Primer R (1 μl), 20 μl of 2× KOD One PCR Master Mix, 2 μl of cDNA, and 16 μl of ddH2O. Cycling conditions: initial denaturation at 98°C for 2 minutes; denaturation at 98°C for 10 seconds; annealing at 58°C for 5 seconds; extension at 68°C for 5 seconds / kb; final extension at 68°C for 30 seconds; storage at 8°C for 5 minutes, for 35 cycles. After the reaction, add 4.4 μL of 10× DNA loading buffer to the PCR product and mix thoroughly. Run the product on a 1% agarose gel supplemented with a nucleic acid dye at 130V for 20 minutes. Check the PCR product for correct size using a Tanon 1600 fully automated digital gel imager. Excise the gel and purify the fragment using a gel extraction kit.

[0042] First digestion of the ds1301 vector: Linearize the host-induced gene silencing vector with restriction endonucleases BamH1 and Kpn1. Prepare a 70µl digestion system consisting of 50µl of plasmid, 1µl of BamH1-HF, 1µl of Stu1-HF, 7µl of 10× rCutsmart buffer, and 11µl of ddH2O. Mix thoroughly and incubate in a 37°C waterbath for 2 hours. Then, add 7.7µl of 10× DNA loading buffer and mix thoroughly. Run the gel on a 1% agarose gel supplemented with a nucleic acid dye at 130V for 20 minutes. Verify the digested bands using a Tanon 1600 automated digital gel imager. Cut the desired band from the gel and purify using a gel recovery kit.

[0043] Forward PbCHT1 vector construction: Purify the target gene fragment from the gel and clone it into the linearized vector using seamless cloning. Prepare a 10-μl reaction mixture on ice: 2 μl of 5× CEⅡ buffer, 1 μl of ExnaseⅡ, 2 μl of linearized vector, 1 μl of insert, and 4 μl of ddH2O. Gently pipette to mix. Briefly centrifuge the reaction mixture to collect it at the bottom of a PCR tube. Incubate in a PCR machine at 37°C for 30 min. After the reaction, heat-shock the recombinant product to transform E. coli DH5α: Remove the competent DH5α from the -80°C freezer and thaw on ice. Add 10µl of the recombinant product to 30µl of competent cells, gently tap the tube to mix, and let it rest on ice for 30 minutes. Heat shock the tube in a 42°C water bath for 45 seconds, then immediately cool on ice for 2-3 minutes. Add 1ml of liquid LB medium (without antibiotics) and incubate at 37°C at 220 rpm for 1 hour. Centrifuge at 5000 rpm / min for 5 minutes and discard 800µl of the supernatant. Resuspend the cells in the remaining medium and spread evenly on an LB plate containing Kana resistance using a sterile spreader. Incubate the tube upside down at 37°C for 12-16 minutes. Once individual colonies emerge, select several for PCR analysis. Use a white pipette tip to pick up a small amount of bacteria and place them in 10ul of the prepared PCR Mix. The PCR primers used are ADH1-F (cgttgagtggccctgtttc) and WAXY-R (acaccttacagaaattagcatgtatgag).

[0044] The PCR mix consisted of 0.5 μL of 10 μM Vector Primer F, 0.5 μL of 10 μM Vector Primer R, 5 μL of 2× Rapid Taq Master Mix, and 4 μL of ddH₂O. Cycling conditions were as follows: initial denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds; annealing at 58°C for 15 seconds; extension at 72°C for 15 seconds / kb; final extension at 75°C for 5 minutes; and storage at 8°C for 5 minutes, for 35 cycles. PCR products were run on a 1% agarose gel supplemented with a nucleic acid dye at 130V for 20 minutes. The correct PCR band size was confirmed using a Tanon 1600 fully automated digital gel imager. Single colonies with correct PCR bands were selected and inoculated into 2 mL of liquid culture medium containing Kana antibiotics. After incubation at 37°C with a shaker at 220 rpm for 12 hours, a small aliquot of the culture medium was sent to QINGKE for sequencing to further verify the correctness of the recombinant plasmid. For the bacterial solution with correct sequencing, the remaining bacteria were collected and the plasmid was extracted according to the small amount extraction method of the plasmid.

[0045] PbCHT1 gene reverse sequence amplification: The steps are the same as the PbCHT1 gene forward sequence amplification method, except that the primer sequences used are different. The specific information is as follows: the design information of the reverse amplification primers from 5' to 3' contains the vector end homologous sequence, restriction site and gene specific sequence (CHT1-dsRNA-3-F2

[0046] :caattcaattcagtggagctcGACCAGAACCCGAGCATGCA, CHT1-dsRNA-3-R2:gcaggactctagacccactagtACGACCGGGTCAGCATCC), PCR amplification was performed using the high-fidelity DNA polymerase KOD One and gel recovery was performed.

[0047] Second enzyme digestion of ds1301 vector: In the method for constructing the forward PbCHT1 vector, the plasmid that has been sequenced correctly is linearized using two restriction endonucleases, Sac1 and Spe1. The other steps are the same as the first enzyme digestion of ds1301 vector.

[0048] Reverse PbCHT1 vector construction: The steps are the same as the forward PbCHT1 vector construction method. The colony PCR primers WAXY-F (caaattctaatccccaatccaaattg) and OCS-R (attagaatgaaccgaaaccggc) are different. The rest of the steps are the same.

[0049] By analyzing the transcriptome data of rapeseed inoculated with root knotweed, we found that PbCHT1 has high expression levels in the three stages of root knotweed infection: the dormant spore stage (RS), the dormant spore germination stage (PZ), and the secondary plasmodium development stage (IN). Figure 1 ), and speculated that PbCHT1 chitinase may play a certain role in the process of root-knot fungus infecting the host.

[0050] According to the CDS coding sequence of PbCHT1, the C-terminal 409 bp sequence (the sequence shown in 365 bp to 773 bp in SEQ ID NO.1) was selected as the silencing sequence. First, the forward target sequence of PbCHT1 ( Figure 2 A), the ds1301 vector was linearized with two restriction endonucleases, BamH1 and Kpn1 ( Figure 2 B), the amplified fragment and linearized vector were transformed into Escherichia coli DH5α by homologous recombination technology, and positive transformants were identified by colony PCR ( Figure 2 C). Then, the reverse target sequence of PbCHT1 was amplified by PCR using specific primers ( Figure 2 D) The plasmid successfully cloned in the first step was linearized with two restriction endonucleases, Sac1 and Spe1 ( Figure 2 E), the amplified fragment and linearized vector were transformed into Escherichia coli DH5α by homologous recombination technology, and positive transformants were identified by colony PCR ( Figure 2 F). At this point, the host-induced gene silencing vector of PbCHT1 was constructed.

[0051] Example 2 Agrobacterium-mediated genetic transformation of Arabidopsis thaliana

[0052] Seed disinfection and germination: In a 1.5ml centrifuge tube, submerge Col-0 Arabidopsis seeds in 1ml of 75% alcohol for 1 minute, discard the alcohol, rinse once with sterile ddH2O, and discard the water. Then, soak in 1ml of 10% 84 disinfectant (100µl 84 disinfectant + 900µl sterile ddH2O) for 5-10 minutes, then discard the disinfectant into the wastewater. Wash the seeds 3-5 times with 1ml of sterile ddH2O. Finally, use a pipette to sow the seeds on antibiotic-free 1 / 2MS medium. Place the culture dish in a constant temperature incubator at 22°C. After 7-14 days, select seedlings with consistent growth and transfer them to soil. 1 / 2MS medium (1L) contains: 2.22g MS, 0.5g MES, 15g sucrose, 14g agar, and adjust the pH to 5.8-5.9.

[0053] Plasmid transformation of Agrobacterium: Take out the competent GV3101 from the -80℃ refrigerator and thaw on ice; take 2ul of the correctly sequenced plasmid (ds1301-CHT1) and add it to 100ul of Agrobacterium GV3101 competent cells, and flick the side of the tube with your finger to thoroughly mix the plasmid and competent cells; add the mixed liquid to a clean and dried electroporation cup, and place the electroporation cup in a Bio-rad electroporator; select the program for electroporation transformation, then take out the electroporation cup and add 500ul of liquid LB culture medium (without antibiotics) to the cup, and transfer the mixed solution to a new 1.5ml centrifuge tube; place the centrifuge tube in a 28℃ shaker, shake at 220rpm for 1h, centrifuge at 5000rpm / min for 5min, and discard 400ul of supernatant. Resuspend the cells in the remaining culture medium and spread evenly using a sterile spreader onto an LB plate containing Kana (50 μg / ml) and Rif (50 μg / ml). Incubate inverted at 28°C for 48 hours. Once single colonies have grown, select several for PCR identification. Use a pipette tip to pick a small amount of cells and place them in 10 μl of the prepared PCR mix, which contains 0.5 μl of 10 μM Vector Primer F, 0.5 μl of 10 μM Vector Primer R, 5 μl of 2× Rapid Taq Master Mix, and 4 μl of ddH2O. Cycling conditions: Initial denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds; annealing at 58°C for 15 seconds; extension at 72°C for 15 seconds / kb; final extension at 75°C for 5 minutes; hold at 8°C for 5 minutes, for 35 cycles. PCR products were run on a 1% agarose gel containing a nucleic acid dye at 130V for 20 minutes. The PCR product band size was checked using a Tanon 1600 fully automated digital gel imager. Single colonies with correct PCR bands were selected. After PCR identification, a small amount of the colony was collected using a white pipette tip and transferred to a 10ml EP tube containing 2ml of LB medium containing Kana and Rif. Incubate overnight with shaking. Then, 1ml of the bacterial culture was added to 1ml of 50% glycerol and transferred to a 2ml seed tube. The tube was then stored at -20°C.

[0054] Arabidopsis flower dipping: After the Arabidopsis transplanted by the above method grows to bolting and flowering, the preserved glycerol bacteria are activated by drawing lines on LB plates containing dual resistance to Kana and Rif. After 2 days, a single colony is dipped with a white sterilized pipette tip and placed in 2ml of dual resistance liquid LB (Kana + Rif) for overnight shaking; then it is inoculated into a 200ml conical flask containing 50ml of dual resistance liquid LB (Kana + Rif) at a ratio of 1:100, placed in a 28°C shaker for expansion, and shaken at 220rpm / min to OD600 = about 0.8-1.2; 50ml centrifuge tubes are used to collect the Agrobacterium bacterial solution, centrifuged at 5000rpm / min for 5-10min, and the Agrobacterium cells are collected; the supernatant is discarded, and the cells are suspended in 50ml of 5% (W / V) sucrose solution, and 10μl of Silwet L-77 to a final concentration of 0.02%; before transformation, use scissors to cut off all fruit pods and white flowers on the Arabidopsis plants, immerse all Arabidopsis inflorescences in the Agrobacterium resuspension, gently shake for 15 seconds, drain the excess Agrobacterium liquid, and repeat this step after 1 hour; the Arabidopsis treated with Agrobacterium dipped flowers are moisturized and cultured in the dark for 16 hours, and then transferred to normal culture; after 7-10 days, repeat this method and dip the flowers again; when the Arabidopsis matures, use a 1.5ml centrifuge tube to collect T0 seeds, add several water-absorbing blue silica gel beads to the tube, and store in a seed storage cabinet.

[0055] Example 3 Screening and identification of transgenic Arabidopsis

[0056] Seed Disinfection and Germination: The T0 generation seeds harvested in Example 2 were disinfected with a 10% 84 solution. The procedure was the same as in Example 2, except that the transgenic seeds were finally sown using a pipette onto a 1 / 2 MS plate containing hygromycin (50 μg / ml). Two families, CHT1-C-4 and CHT1-C-8, were selected from the T1 generation for subsequent experiments.

[0057] Arabidopsis leaf genome extraction: Heat the CTAB extraction buffer in a 65°C water bath in advance; sample Col-0 and transgenic plant leaves, quickly plunge them into liquid nitrogen, and quickly grind them into powder in a mortar with liquid nitrogen (or crush the sample in a tissue grinder). Take an appropriate amount of tissue powder and add it to a 2mL centrifuge tube, add 700uL of preheated CTAB extraction buffer; vortex mix and place in a 65°C water bath for 20 minutes, shaking vigorously every 5 minutes; remove the centrifuge tube from the water bath and cool it to room temperature, add 350uL of chloroform and 350uL of chloroform, respectively. Vortex the Tris-saturated phenol solution to mix thoroughly; centrifuge at 12,000 r / min for 10 minutes at room temperature, transfer 700 uL of the supernatant to a new 1.5 mL centrifuge tube, add an equal volume of isopropanol, mix thoroughly by inverting, and place in a -20°C refrigerator for 20-30 minutes; centrifuge at 12,000 r / min for 10 minutes at room temperature; discard the supernatant, add 1 mL of 75% ethanol to wash the DNA precipitate, centrifuge at 12,000 r / min for 5 minutes, discard the supernatant, and repeat this step twice; centrifuge for 1 minute, aspirate the remaining ethanol with a pipette, wait for the precipitate to dry to a transparent state at room temperature, add 50 uL of TE buffer supplemented with RNase to fully dissolve the DNA, determine the concentration by Nanodrop, and store in a -20°C refrigerator for later use.

[0058] PCR Identification of Transgenic Arabidopsis: Using the extracted DNA as a template, three primer pairs were used to amplify the plasmids and confirm their successful introduction into Arabidopsis. The first primer pair consisted of genome-CHT1-3-F (CTGAAGATCTCGTTCACGCTGC) and WAXY-R (ACACCTTACAGAAATTAGCATGTATGAG); the second primer pair consisted of genome-CHT1-3-F (CTGAAGATCTCGTTCACGCTGC) and WAXY-F (ACACCTTACAGAAATTAGCATGTATGAG); and the third primer pair consisted of At-actin2-F (atttggatctgtgaacctccact) and At-actin2-R (tcatcagcctcagccattttttatg). The PCR system consisted of 0.5 μL of 10 μM Vector Primer F, 0.5 μL of 10 μM Vector Primer R, 5 μL of 2× Rapid Taq Master Mix, and 4 μL of ddH2O. Cycling conditions: initial denaturation, 95°C, 3 min; denaturation, 95°C, 15 sec; annealing, 58°C, 15 sec; extension, 72°C, 15 sec / kb; final extension, 75°C, 5 min; storage at 8°C, 5 min, cycle number 35. PCR products were run on a 1% agarose gel containing a nucleic acid dye at 130 V for 20 min. PCR product band size was checked using a Tanon 1600 fully automated digital gel imager.

[0059] PCR identification of the two families Figure 3 As shown in A, plasmid bands were detected only in the transgenic lines, but not in the control Col-0. However, ACTIN2 was amplified in CHT1-C-4, CHT1-C-8, and Col-0 plants, indicating that the extracted genome was of good quality. The transgenic plants and Col-0 were grown together in nutrient soil for 30-40 days, and the growth status of the transgenic lines and Col-0 seedlings was the same ( Figure 3 B) indicates that the introduction of the plasmid does not affect the growth and development of the plant.

[0060] Example 4 Inoculation of transgenic Arabidopsis with plasmodium

[0061] Preparation of crude extract of dormant spores of root-knot fungus JZ-1: Take out the swollen rapeseed root sample stored in a -30℃ refrigerator, wash it with running water, cut the root sample into small pieces with a kitchen knife for easy crushing, put it into a juicer, add appropriate amount of water and grind it. After it is fully ground, filter it with 8 layers of gauze to obtain the crude extract of dormant spores of root-knot fungus, then take 100ul of the crude extract and dilute it 1000 times with ddH2O, count the spores with a hemocytometer under a microscope, and calculate the concentration of the spore suspension.

[0062] Inoculation of Arabidopsis thaliana with root knot fungus: Dilute the crude spore extract to a concentration of 1×107 spores / ml. Screen positive Arabidopsis thaliana seedlings and wild-type Col-0 on 1 / 2 MS plates supplemented with hygromycin (50 μg / ml) for about 14 days in nutrient soil. Inoculate each plant with 1 ml of the crude extract by root irrigation. Calculate the disease index 21 days after inoculation.

[0063] Arabidopsis clubroot disease index (DI) is a statistical standard based on the degree of root swelling in rapeseed, divided into five levels: 0, no root symptoms; 1, small tumors on lateral roots but not on the taproot; 2, small tumors on both the taproot and lateral roots; 3, medium to large tumors distributed throughout the taproot; 4, root deformity, severe tumors on both the taproot and lateral roots, and complete enlargement of the taproot; 5, enlargement and rot of both the taproot and lateral roots, impaired plant growth. The disease index (DI) is calculated using the following formula: DI = (1n1 + 2n2 + 3n3 + 4n4 + 5n5) × 100 / 5Nt, where n1-n5 represent the number of seedlings corresponding to each level, and nt represents the total number of seedlings in the experiment.

[0064] After the T1 generation CHT1-C-4 and CHT1-C-8 families and the wild type Col-0 were inoculated with root knot fungi, the main root and lateral roots of Col-0 were almost completely swollen, but the main root of the transgenic family was not obviously swollen, and there were still many healthy lateral roots ( Figure 4 A), disease index statistics showed that both transgenic lines were more disease-resistant than the wild type Col-0 ( Figure 4 B), and the control effects of CHT1-C-4 and CHT1-C-8 reached 35% and 51%, respectively.

[0065] Example 5 Detection of relative biomass of root knot fungi in diseased roots and PbCHT1 silencing efficiency

[0066] Extraction of total DNA of root knot fungi from diseased roots of Arabidopsis thaliana: Four diseased roots from each family were mixed as a sample, and total DNA from the diseased roots of transgenic plants was extracted using the CTAB method. The specific steps were the same as the Arabidopsis leaf genome extraction method in 1.3.

[0067] Detection of Rhizobium biomass in diseased roots: The total DNA concentration of the extracted rapeseed and Rhizobium was diluted to 500 ng / ul as a template, and Arabidopsis ACTIN2 (qAtACTIN2-F: GCACCCTGTTCTTCTTACGGA, qAtACTIN2-R: GTGAGACACACCATCACCAGA) was used as an internal reference gene. q-PCR was used to detect the expression level of Rhizobium PbACTIN1 (qPbACTIN1-F: CACCGACTACCTGATGAA, qPbACTIN1-R: CAGCTTCTCCTTGATGTC) relative to Arabidopsis ACTIN2.

[0068] Extraction of total RNA from root knotweed fungi in diseased roots of Arabidopsis thaliana: Four diseased roots from each family were mixed as a sample, and total RNA from the diseased roots of transgenic plants was extracted using Trizol. The specific steps were the same as the total RNA extraction method for root knotweed fungi in 1.1.

[0069] PbCHT1 silencing efficiency assay: First-strand cDNA was synthesized from extracted RNA using a reverse transcription kit (TransGene). The reaction mixture consisted of 1-4 μg of total RNA, 1 μl of Anchored Oligo(dT)18 Primer (0.5 μg / μl), 1 μl of gDNA Remover, 1 μl of EasyScript RT / RI Enzyme Mix, 10 μl of 2× ES Reaction Mix, and RNase-free water to a final volume of 20 μl. Mix gently and incubate at 42°C for 30 minutes. Heat at 85°C for 5 seconds to inactivate the EasyScript RT / RI. Using the synthesized R. pylori cDNA as the template and R. pylori PbACTIN1 (qPbACTIN1-F: CACCGACTACCTGATGAA, qPbACTIN1-R: CAGCTTCTCCTTGATGTCACTIN2) as the internal reference gene, q-PCR was used to detect the expression level of R. pylori PbCHT1 (qPbCHT1-F: GGCGGAAGTCATCATGGACGA, qPbCHT1-R: CGTTCGCATCGTTCAGCAGGTA) relative to R. pylori PbACTIN1.

[0070] The results of qPCR showed that the relative biomass of root knotweed bacteria in the transgenic line was significantly lower than that in Col-0 ( Figure 4 C). In addition, qPCR analysis showed that the transcript of PbCHT1 was also significantly downregulated ( Figure 4D), indicating that host-induced gene silencing plays a role. In summary, silencing PbCHT1 can enhance Arabidopsis resistance to root knot fungus, suggesting that PbCHT1 plays a positive regulatory role during root knot fungus infection.

[0071] References

[0072] Zhang

Claims

1. A root knotweed chitinase PbCHT1, characterized in that Encoded by the gene shown in SEQ ID NO.

1.

2. The root knotweed chitinase PbCHT1 gene is characterized by: The CDS sequence is shown in SEQ ID NO.

1.

3. Use of the gene encoding the root knotweed chitinase PbCHT1 according to claim 2 for negative regulation in improving plant clubroot resistance and / or cultivating clubroot-resistant plants.

4. Use of a substance that negatively regulates the gene encoding the root knotweed chitinase PbCHT1 according to claim 2 in improving plant clubroot resistance and / or cultivating clubroot-resistant plants.

5. A dsRNA of the PbCHT1 gene according to claim 2, characterized in that: The target sequence is shown as 365bp to 773bp in SEQ ID NO.

1.

6. A host-induced gene silencing RNAi vector for silencing the PbCHT1 gene according to claim 2, characterized in that: The RNAi vector expresses the dsRNA according to claim 5.

7. An engineered bacterium containing the RNAi vector according to claim 6.

8. Any of the following uses of the dsRNA according to claim 5, the RNAi vector according to claim 6, or the engineered bacteria according to claim 7: 1) Increase plant resistance to clubroot; 2) preparing products for improving plant resistance to clubroot; 3) Cultivate plants with improved resistance to clubroot; 4) preparing products for cultivating plants with improved resistance to clubroot; 5) Improving plants with high resistance to clubroot or preparing products made from plants with high resistance to clubroot; 7) Inhibit the growth and development of clubroot bacteria; 8) preparing a product for inhibiting the growth and development of clubroot bacteria.

9. The use according to claim 8, characterized in that The plant is selected from Arabidopsis thaliana or rapeseed.

10. A method for cultivating plants resistant to clubroot, characterized in that: The method comprises introducing the host-induced gene silencing RNAi vector of claim 6 into a target plant to obtain a clubroot pathogen-resistant plant, wherein the clubroot pathogen-resistant plant has higher resistance to clubroot pathogen than the target plant, and the dsRNA targets the PbCHT1 gene of claim 2.

Images