Method for establishing American pumpkin genetic transformation system

Abstract

The invention provides a method for establishing an American pumpkin genetic transformation system. The method comprises the following steps: firstly, culturing to obtain an American pumpkin explant; carrying out dip dyeing on the explant by taking positive agrobacterium, and culturing the dip-dyed explant on a co-culture medium; washing the explant with sterile water, and transferring the explant to a recovery culture medium for culture; transferring the explants to a screening culture medium for culturing; and finally, transferring the explants to a screening rooting culture medium, and transplanting and planting seedlings after the explants are cultured into the seedlings, so as to obtain American pumpkin genetic transformation plants. Technical improvement is carried out from three dimensions of a regeneration system, a screening system and a rooting system to successfully obtain the first American pumpkin transgenic positive seedling in China; the genetic transformation efficiency is improved to 2.5% and is about 3 times that reported before, and the genetic transformation system of the American pumpkins is further improved.

Description

Technical Field

[0001] The invention belongs to the field of molecular breeding, and in particular relates to a method for establishing a genetic transformation system of American pumpkin. Background Art

[0002] Cucurbita pekinensis, a key member of the Cucurbitaceae family of cash crops, holds a key position in protected agriculture and rootstock breeding due to its outstanding stress resistance and broad ecological adaptability. Despite its significant agronomic value, this species faces significant bottlenecks in genetic transformation technology, resulting in a long-standing low transformation success rate. Currently, research in plant genetic engineering focuses primarily on Chinese and Indian pumpkins, while research on genetic transformation systems for Cucurbita pekinensis lags behind. Existing genetic transformation systems still require technological breakthroughs in two key areas: transformation efficiency and differentiation and regeneration capacity, which have become significant obstacles to molecular breeding progress.

[0003] Early international academic attention to genetic transformation technologies for Cucurbita serrata was relatively limited, and related research results were relatively scarce. In the application of genetic engineering technologies, different research teams have experimented with various approaches and achieved phased progress. Notably, the effectiveness of Agrobacterium-mediated transformation, a classic transformation method, varies significantly across experiments. Toppi et al. (1997) successfully established an Agrobacterium-mediated transgenic root cultivation system, achieving a root transformation rate of up to 97%. Tricoli et al. (1995) achieved the first genetic transformation of Cucurbita serrata using Agrobacterium-mediated transformation, obtaining transgenic plants, but the transformation efficiency was extremely low. In subsequent studies, Shah et al. (2008) successfully integrated the cold-tolerance gene cbf1 and the selectable marker gene nptII into the Cucurbita serrata genome. While stable expression of the target genes was achieved, the 0.7% transformation rate still limited the practical application of this technology.

[0004] To overcome the bottleneck in transformation efficiency, Nanasato et al. (2011) innovatively introduced whisker vortex technology. Experiments showed that treating cotyledonary tissue with a 1% whisker suspension effectively broke down the surface cell barrier, significantly enhancing Agrobacterium's infection of deeper cells, and raising the genetic transformation rate of Cucurbita to 2.7%. Building on this technological breakthrough, the team further integrated vacuum infiltration technology in 2013. By performing double vacuum infiltration on pretreated explants, they achieved a 9.2% transformation efficiency in Chinese pumpkin varieties. However, it is worth noting that for the specific species of Cucurbita oleracea, the highest transformation efficiency currently documented remains at 0.7%, highlighting the urgent need to optimize the genetic transformation system for this species.

[0005] In summary, although the genetic transformation systems of Chinese pumpkin and Indian pumpkin are relatively mature and have high genetic transformation efficiency, the genetic transformation of the American pumpkin species still faces multiple technical obstacles, and further optimization and improvement of the genetic transformation system of the American pumpkin is needed. Summary of the Invention

[0006] In view of this, the present invention successfully obtained the first transgenic positive seedling of American pumpkin in China by making technical improvements in three dimensions: regeneration system, screening system and rooting system.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions: A method for establishing a genetic transformation system for American pumpkin comprises the following steps: S1. Take pumpkin seeds and place them on germination medium for germination. After germination for 36-48 hours, cut off the distal 1 / 3 of the cotyledons and embryonic axis to obtain explants. S2. Take positive Agrobacterium and infect the above explants. Place the infected explants on co-cultivation medium and incubate in the dark at 23-28°C for 3-5 days. S3. After co-cultivation, the explants were rinsed with sterile water and then transferred to recovery medium for 5–7 days; S4. After the recovery culture is completed, the explants are transferred to the screening medium and subcultured every 8 to 12 days for a total of 3 to 4 times; S5. After the screening and culturing is completed, the explants are transferred to a screening rooting medium, and after being cultured into seedlings, they are transplanted and planted to obtain genetically transformed American pumpkin plants; The germination medium in step S1 is as follows: MS + 2-3 mg / L 6-BA + 0.25 mg / L ABA; In step S2, the co-culture medium is as follows: MS + 2-3 mg / L 6-BA + 0.25 mg / L ABA + 1.25 mM MES + 200 μM As + 250 μM LA; The recovery medium in step S3 is as follows: MS + 2-3 mg / L 6-BA + 0.5 mg / L ABA + 200 mg / mL TMT; The screening medium in step S4 is as follows: MS + 2-3 mg / L 6-BA + 0.5 mg / L ABA + 200 mg / mL TMT + 150 mg / L spe; The rooting medium in step S5 is as follows: MS+1.5-2.5 mg / L IBA+200 mg / mL TMT.

[0008] In some specific embodiments, preferably, the germination medium in step S1 is as follows: MS+3 mg / L 6-BA+0.25 mg / L ABA; The co-culture medium in step S2 was as follows: MS + 3 mg / L 6-BA + 0.25 mg / L ABA + 1.25 mM MES + 200 μM As + 250 μM LA; The recovery medium in step S3 is as follows: MS + 3 mg / L 6-BA + 0.5 mg / L ABA + 200 mg / mL TMT; The screening medium in step S4 is as follows: MS + 3 mg / L 6-BA + 0.5 mg / L ABA + 200 mg / mL TMT + 150 mg / L spe; The rooting medium in step S5 is as follows: MS+1.5 mg / L IBA+200 mg / mL TMT.

[0009] Furthermore, step S1 further includes soaking the pumpkin seeds in 55° C. warm water for 30 to 50 minutes before germination, shelling the pumpkin seeds, and then surface disinfecting them in 75% ethanol for 30 seconds, followed by soaking and disinfecting them in 0.25% NaClO for 15 minutes, and finally rinsing them with sterile water.

[0010] Furthermore, the positive Agrobacterium in step S2 contains CpeRPW02800 CRISPR / Cas9 vector with gene knockout function.

[0011] In some specific embodiments, preferably, the vector is a pASE403R vector.

[0012] In some specific embodiments, preferably, construct CpeRPW02800 The primers used for the CRISPR / Cas9 vector with gene knockout function are as follows: CpeRPW02800 -F:5'-ATTGTGATAAGCGGGGCTATTGC-3'; CpeRPW02800 -R:5'-AAACGCAATAGCCCCGCTTATCA-3'.

[0013] In some specific embodiments, preferably, when the positive Agrobacterium is inoculated into the explant in step S2, the explant is first resuspended in IM liquid culture medium to an OD of 600 is 0.2; The IM liquid culture medium is specifically as follows: MS+3 mg / L 6-BA+0.25 mg / L ABA+1.25 mM MES+200 μM As.

[0014] Compared with the prior art, the present invention has the following beneficial effects: This study successfully obtained the first transgenic positive American pumpkin seedlings in China by improving the regeneration system, screening system, and rooting system. (1) After optimizing the regeneration system, the average number of regenerated buds per explant increased significantly from 1.21 to 3.54, and the regeneration efficiency increased by nearly 3 times. (2) The screening system innovatively introduced a new antibiotic gradient combination, successfully obtaining the first transgenic positive American pumpkin seedlings in China, and the genetic transformation efficiency increased to 2.5%, which is about 3 times that reported by previous researchers. (3) The rooting system was found to have the best effect through IBA concentration gradient experiments, with the 1.5 mg / L treatment induced approximately twice the number of adventitious roots as the control group. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is the map of the pASE403R vector in Example 1.

[0016] Figure 2 This is the growth status of explants under different concentrations of 6-BA in Example 2.

[0017] Figure 3 This is the root growth status of American pumpkin under different concentrations of IBA in Example 2.

[0018] Figure 4 This is a diagram showing the editing results of the American pumpkin callus in Example 3.

[0019] Figure 5 This is a picture of the fluorescent organs of the positive plants of American pumpkin in Example 3. DETAILED DESCRIPTION

[0020] The present invention will be further described in detail below in conjunction with specific examples so that those skilled in the art can more clearly understand the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and all reagents and consumables are commercially available products.

[0021] The American pumpkin germplasm C38 used in this experiment was obtained from the Institute of Vegetable and Floriculture, Chinese Academy of Agricultural Sciences.

[0022] The meanings of related abbreviations are as follows:

[0023] Example 1 This embodiment provides CpeRPW02800 The steps for obtaining Agrobacterium containing a CRISPR / Cas9 vector with gene knockout function are as follows: 1. CpeRPW02800 Gene knockout target design Find the target Cucurbita serrata from the Cucurbitaceae Genome Database (http: / / www.cucurbitgenomics.org / ) CpeRPW02800 The DNA sequence of the gene (as shown in SEQ.NO.1) was imported into the Geneious software, and the target gene DNA sequence and the American pumpkin genome database were used to mark the exons of the target gene. Then, the sgRNA was designed by clicking the Find CRISPR Sites option in the Tools in the Geneious software: all sgRNA sequences containing both TargetN (20) and PAM sequence (NGG) on the target gene fragment were retrieved, and gRNA was selected according to the sgRNA design principles. The selection of sgRNA should follow the following principles as much as possible: SEQ.NO.1 is as follows: ATGGTGGACGGTCTGATAAGCGGGGCTATTGCGGGTGTTGTCGCCGAAGTGATGCTGAAAAAGTTGTTGAGTTCGACGGAAAGGGCGATTCGTTTCAAACGTGTGCGGGAAGATATCAGATACCGGTTACAGAATCTATGCTCTGAGATCAAACAGGTGAAGCATGGTGGGTTCCTCGATTTCCCA CAATACATGAAGAACGTGCAGCAACTGATAGATAAAGGGAAGAAACTGATTGCCAAGTGCGACGCTGTGGATCGAAGTATTCTCAGGTATCCCAAGGTCCCATATTACACCAAAAAGCTTCGCAAATTGGGTGATGAATTGGAAAGGACCAAAACCGATTTGACGTTCAAATTGATGTTACAAAACTCAACACGTTGA.

[0024] 1) The target sequence is GN (19) NGG or N (19) NGG. Try to avoid the situation where NGG is still followed by G.

[0025] 2) The GC content of the selected target sequence is between 40% and 60%.

[0026] 3) The target sequence should avoid repeated sequences and more than 7 tandem A bases.

[0027] 4) The target sequence is highly specific and is compared in the whole genome database to minimize off-target effects.

[0028] 5) The target site can be located on the plus or minus strand of DNA, and the base sequence should be from the 5' end to the 3' end.

[0029] 6) When designing vector primers, make sure to include only N20 and not the PAM sequence (NGG).

[0030] 2. Single target pASE403R- CpeRPW02800 Knockout CRISPR / Cas9 vector construction After designing a single sgRNA knockout site, use the pASE403R vector (see map for details). Figure 1 ) to construct a single gene editing vector.

[0031] The specific primer designs are as follows: CpeRPW02800-F:5'-ATTGTGATAAGCGGGGCTATTGC-3'; CpeRPW02800-R:5'-AAACGCAATAGCCCCGCTTATCA-3'.

[0032] The primer annealing system is shown in the following table:

[0033] Reaction conditions: Place in 1L of boiling water and cool naturally to room temperature.

[0034] The enzyme digestion and ligation system is shown in the following table:

[0035] The reaction procedure was as follows: 37°C for 5 h, 50°C for 5 min, and enzyme inactivation at 80°C for 10 min.

[0036] 3. E. coli Transformation, Plasmid Extraction, and Agrobacterium Transformation The plasmid completed by enzyme digestion and ligation in the previous step was transformed with E. coli, extracted, and transformed with Agrobacterium (for specific operation methods, please refer to "Application of Regeneration-Promoting Genes in Genetic Transformation and Gene Editing System of Pumpkin" by Zhang Jiangtao, Huazhong Agricultural University, 2023). Agrobacterium culture liquid that tests positive can be stored in a 4°C refrigerator for short-term use. For long-term use, add an equal volume of 50% sterilized glycerol, mix by inversion, and store in a -80°C refrigerator for later stable genetic transformation.

[0037] Example 2 This example provides a method for establishing a genetic transformation system for Cucurbita oleracea, as follows: S1 explant acquisition Select pumpkin seeds with full grains and uniform size, soak them in 55℃ warm water for more than 30 minutes, and then sterilize the seeds after shelling (place the seeds in 75% ethanol for surface disinfection for 30 seconds, then soak and disinfect in 0.25% NaClO for 15 minutes, and finally rinse with sterile water 6 times); sow the sterilized seeds on seed germination medium and perform germination culture in a dark environment (culture temperature is 28℃); after 40 hours of seed germination, when the seed coat begins to fall off and clear vascular bundle ridges appear on the cotyledons, cut off about 1 / 3 of the cotyledons at the distal end in an ultra-clean workbench, remove the embryonic axis, and separate the two cotyledons. A U-shaped wound will be formed at the proximal end of each cotyledon to obtain the explant.

[0038] Among them, the germination culture medium is specifically: MS+6-BA+0.25mg / L ABA. In order to explore the effect of 6-BA content on the explant culture results, different culture media were set up in sequence according to the concentration gradient of 0mg / L, 1mg / L, 2mg / L, 3mg / L, 4mg / L, 5mg / L, and 6mg / L for culture.

[0039] S2. Agrobacterium infection The positive Agrobacterium colonies in Example 1 were picked and placed in 1 mL of liquid LB medium containing 50 mg / L Kan and 25 mg / L rif and shaken at 28°C (200 rpm) for 24 hours. The shaken bacteria were transferred to 15 mL of liquid LB medium and cultured overnight at a ratio of 1:1000 until the OD 600 The agrobacterium was collected by centrifugation at 6000 r / min for 8 min and diluted and resuspended in IM liquid medium to an OD of 0.6-0.8. 600 The explants were placed in a conical flask containing the infection solution at a constant pressure of 0.2 and 0.1% As was added. After incubation in the dark on a shaker at 50 rpm for 1 hour, the culture solution was divided into two portions and placed in two Erlenmeyer flasks. The prepared explants were placed in one of the conical flasks containing the infection solution. The conical flask containing the explants and Agrobacterium suspension was sonicated for 10 seconds using an ultrasonic cleaner (KQ-500DE) at 100 W. During this time, the flask was gently shaken to prevent the explants from sinking to the bottom. The explants were then transferred to a 20 mL medical syringe, and 15 mL of the other Agrobacterium suspension was added. The air in the syringe was expelled, and the distal end of the syringe was sealed with a rubber cap. Agrobacterium infection was completed by slowly pulling the plunger from the 15 mL mark to the 20 mL mark and holding for 90 seconds, while gently shaking.

[0040] After vacuum operation, the Agrobacterium suspension was drained, and the explants were transferred to a culture dish with dry filter paper. The liquid on the surface of the explants was aspirated dry, and the explants were cultured in the dark at 23°C on the co-cultivation medium with filter paper for 4 days.

[0041] Among them, IM liquid medium is as follows: MS + 6-BA + 0.25 mg / L ABA + 1.25 mM MES + 200 μM As; The co-cultivation medium was as follows: MS + 6-BA + 0.25 mg / L ABA + 1.25 mM MES + 200 μM As + 250 μM LA. Similarly, a concentration gradient of 6-BA was established for the IM liquid medium and co-cultivation medium, and this concentration gradient corresponded to the 6-BA content in the germination medium in step S1.

[0042] S3. Recovery culture After co-cultivation, the explants were rinsed 8 times with sterile water, and the liquid attached to the surface was blotted off with sterilized absorbent paper. The explants were then transferred to the recovery medium and inserted into the medium at a slight angle. The explants were cultured on the recovery medium for 5 to 7 days.

[0043] The recovery medium is as follows: MS+6-BA+0.5 mg / L ABA+200 mg / mL TMT. A concentration gradient is also set for the 6-BA content, and the concentration gradient corresponds one-to-one to the 6-BA content in the germination medium in step S1.

[0044] The results of the explant culture under the aforementioned 6-BA concentration gradient setting are shown in Table 1. Figure 2 .

[0045] Table 1 Effects of different 6-BA concentrations on the regeneration ability of pumpkin

[0046] From Table 1, Figure 2 The results show that all treatment groups (0-6 mg / L) successfully induced regenerated shoots, but no statistically significant differences were observed between the different concentrations. The regeneration rates ranged from 55.54% to 61.02%. Notably, the 3 mg / L treatment group achieved the highest regeneration rate (61.02%), while the 6 mg / L treatment group exhibited the lowest regeneration efficiency (55.54%). The average number of regenerated shoots across the experimental groups ranged from 1.15 to 3.54, with the 3 mg / L treatment achieving the highest average number (3.54), approximately three times that of the control group (0 mg / L). Further analysis revealed that when the 6-BA concentration exceeded 3 mg / L, the number of regenerated shoots decreased, reaching the lowest value (1.15) in the 6 mg / L treatment group.

[0047] In summary, based on the multi-index comprehensive evaluation system (regeneration bud induction rate, average number of regenerated buds and physiological state of explants), 3 mg / L of 6-BA was the optimal concentration for subsequent studies.

[0048] S4. Screening and Culture After the recovery culture is completed, the explants are transferred to the screening medium and subcultured every 10 days for a total of 3 times. The regenerated shoots containing the transgenic plants are selected in the 3rd and 4th weeks on the screening medium.

[0049] The screening medium was as follows: MS + 3 mg / L 6-BA + 0.5 mg / L ABA + 200 mg / mL TMT + spe. To investigate the effect of spe content on explant culture results, different media were set up for culture in a concentration gradient of 0 mg / L, 50 mg / L, 100 mg / L, 150 mg / L, 200 mg / L, and 250 mg / L. The screening results of different spe concentrations are shown in Table 2.

[0050] Table 2 Screening results of SPE at different concentrations

[0051] Table 2 shows that, in a stable transformation experiment using germplasm C38, spectinomycin concentrations ranging from 0 mg / L to 250 mg / L showed excellent selection efficiency for Cucurbita serrata only at 150 mg / L. At this concentration, the genetic transformation efficiency was 2.5%, while at all other concentrations, the transformation efficiency was zero. Furthermore, the false-positive organ rates for each concentration gradient were 98.43%, 69.81%, 25.94%, 17.46%, and 4.68%, respectively. In summary, considering the genetic transformation efficiency and false-positive organ / plant rate across the various concentration gradients, 150 mg / L was ultimately selected as the optimal spectinomycin concentration for Cucurbita serrata genetics.

[0052] S5. Rooting and transplanting When the transgenic regenerated shoots reach 2-4 cm, they are transferred to tissue culture bottles containing rooting medium. After culture, transgenic plants that have well-rooted and grown to the bottle mouth are properly hardened and then transplanted to sterilized substrate. They are then grown in an artificial climate chamber to strengthen the seedlings. Afterwards, they are transplanted into the field or plastic pots and cultured until seed is harvested. These steps complete the genetic transformation of the American pumpkin.

[0053] The rooting medium is as follows: MS + IBA + 200mg / mL TMT. In order to explore the effect of IBA content on the explant culture results, different culture media were set up in accordance with the concentration gradient of 0mg / L, 0.5mg / L, 1mg / L, 1.5mg / L, 2mg / L, and 2.5mg / L for culture. The results of different IBA concentrations are shown in the figure. Figure 3 .

[0054] Depend on Figure 3The results show that the addition of IBA significantly increases the average root number of regenerated shoots. The lowest average root number is at an IBA concentration gradient of 0.5 mg / L, with an average root number of 4.7. When the IBA concentration reaches 1.5 mg / L, the average root number reaches 13, which is the highest. Further increasing the IBA concentration at this point will lead to a decrease in the average root number of regenerated shoots. In addition to the average root number, the average root diameter of adventitious roots is also important for regenerated shoots. Similar to the average root number, average root diameter is also an indicator of regenerated shoot health. A stronger root system indicates better regenerated shoot growth.

[0055] Furthermore, when the regenerated buds with strong root systems are transplanted from the tissue culture bottle to the soil, they are not easily broken and can adapt to the dry environment. The strong and developed root system can help the seedlings quickly absorb the required water and nutrients from the soil. Figure 3 As shown in D, after using IBA, the average root diameter of the regenerated buds was significantly improved. Among the six concentration gradients, the average root diameter ranged from 0.07cm to 0.21cm, of which the highest average root diameter was at 1.5mg / L and the lowest average root diameter was at 0mg / L. When the IBA concentration exceeded 1.5mg / L, continuing to increase the IBA concentration would cause the average root diameter of the adventitious roots to begin to decrease. In genetic transformation, the rooting rate is also an extremely important indicator. It can even be said that the rooting rate is the survival rate of the regenerated buds. Figure 3 As shown in Figure B, the addition of IBA significantly improved the rooting rate of regenerated shoots in pumpkin. The rooting rate ranged from 41.66% to 66.66% across the six IBA concentration gradients. The highest rooting rate was achieved at 1.5 mg / L, 2 mg / L, and 2.5 mg / L, with a rooting rate of 66.66%, approximately 1.5 times that of the 0 mg / L control (41.66%). Taking into account the average number of roots, average root diameter, and rooting rate of regenerated roots, 1.5 mg / L was selected as the most suitable IBA concentration for pumpkin.

[0056] Example 3 Furthermore, in this example, the editing status of the callus tissue obtained after co-cultivation, recovery culture, and screening culture in Example 2 is detected, and the specific steps are as follows: 1. DNA Extraction from Callus Use BioDev Plant Genomic DNA Mini-Quantity Rapid Extraction Kit: (1) Plant tissue fragmentation Place the tissue in a mortar and add an appropriate amount of liquid nitrogen to fully grind it into powder. Transfer the powder to a 1.5 mL centrifuge tube, add 100 μL of lysis buffer and 20 μL of RNase A to the centrifuge tube, quickly and thoroughly shake to mix, and incubate at 55°C for 45 minutes, inverting the centrifuge tube several times during the process.

[0057] (2) Add 10 μL of 3 M NaAc (pH 4.8) and 1.25 mL of binding buffer, shake thoroughly to mix, let stand for 1 min, centrifuge at 12,000 rpm for 30 s, and discard the waste liquid.

[0058] (3) Add 600 μL of washing buffer and centrifuge at 12000 rpm for 30 seconds. Repeat 1 to 2 times.

[0059] (4) Centrifuge the empty tube at 12000 r / min for 3 min to fully remove the rinse solution.

[0060] (5) Carefully remove the centrifugal adsorption column, place it in a clean 1.5 mL centrifuge tube, and add 50 μL of elution buffer; after standing for 1 minute, centrifuge at 12,000 rpm for 30 seconds, and the genomic DNA eluted into the centrifuge tube is obtained.

[0061] (6) Take 3-5 μL of the sample for electrophoresis to check the DNA extraction status.

[0062] 2. Hi-Tom Sequencing The DNA of the T0 generation of transgenic plants was extracted using the above method, and sequencing primers were designed according to the Hi-Tom sequencing requirements. Hi-Tom primers ( CpeRPW02800 -HF: 5'-ggagtgagtacggtgtgcCTGTTGGGTTATATTTTGGAGTTTGA-3'; CpeRPW02800 -HR:5'-gagttggatgctggatggTGATATCTTCCCGCACACGTTT-3'. ) amplification CpeRPW02800 Gene target site. After the reaction, perform electrophoresis on 1% agarose gel and observe the expected bands using a gel imager. If they meet the expected bands, send the sample for Hi-Tom sequencing. After automatically filtering out editing types with less than 1% reads, single editing types with less than 5%, and editing types where the edited region is not at the target site, the editing results are compared.

[0063] The results are as follows Figure 4 As shown, it was detected in callus tissue CpeRPW02800 The gene was successfully edited, with the following details: CpeRPW02800There are a total of 9 types of mutations. The first type: deletion of a T base (editing efficiency is 9.83%), the second type: insertion of a T base (editing efficiency is 4.83%), the third type: deletion of 11 bases GCGGGGCTATT (editing efficiency is 4.25%), the fourth type: deletion of two bases TA (editing efficiency is 3.92%), the fifth type: deletion of six bases GCTATT (editing efficiency is 3.04%), the sixth type: deletion of seven bases GGGCTAT (editing efficiency is 2.97%), the seventh type: deletion of three bases TAT ​​(editing efficiency is 2.97%), the eighth type: large fragment deletion of 34 bases TGGTGGACGGTCTGATAAGCGGGGCTATTGCGGG (2.94%), and the ninth type: deletion of an A base (editing efficiency is 2.94%).

[0064] Furthermore, using DsRed as a reporter gene, a stable transformation experiment was conducted using germplasm C38. This study successfully obtained a transgenic line stably expressing DsRed fluorescent protein through a genetic transformation system. Under the illumination of a handheld fluorescent protein observation lamp, the positive plants were able to emit red fluorescence. The leaves, tops, and stamens of the transformed lines were no different from those of the wild type (see the results). Figure 5 The results indicate that heterologous expression of DsRed protein in Cucurbita oleracea is genetically stable.

[0065] The raw materials not specifically described in the present invention are all existing materials that can be directly purchased from the market.

[0066] The above is only a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A method for establishing a genetic transformation system for American pumpkin, characterized in that: The following steps are involved: S1. Take pumpkin seeds and place them on germination medium for germination. After germination for 36-48 hours, cut off the distal 1 / 3 of the cotyledons and embryonic axis to obtain explants. S2. Take positive Agrobacterium and infect the above explants. Place the infected explants on co-cultivation medium and incubate in the dark at 23-28°C for 3-5 days. S3. After co-cultivation, the explants were rinsed with sterile water and then transferred to recovery medium for 5–7 days; S4. After the recovery culture is completed, the explants are transferred to the screening medium and subcultured every 8 to 12 days for a total of 3 to 4 times; S5. After the screening and culturing is completed, the explants are transferred to a screening rooting medium, and after being cultured into seedlings, they are transplanted and planted to obtain genetically transformed American pumpkin plants; The germination medium in step S1 is as follows: MS + 2-3 mg / L 6-BA + 0.25 mg / L ABA; In step S2, the co-culture medium is as follows: MS + 2-3 mg / L 6-BA + 0.25 mg / L ABA + 1.25 mM MES + 200 μM As + 250 μM LA; The recovery medium in step S3 is as follows: MS + 2-3 mg / L 6-BA + 0.5 mg / L ABA + 200 mg / mL TMT; The screening medium in step S4 is as follows: MS + 2-3 mg / L 6-BA + 0.5 mg / L ABA + 200 mg / mL TMT + 150 mg / L spe; The rooting medium in step S5 is as follows: MS+1.5-2.5 mg / L IBA+200 mg / mL TMT.

2. The method according to claim 1, characterized in that The germination medium in step S1 was as follows: MS + 3 mg / L 6-BA + 0.25 mg / L ABA; In step S2, the co-culture medium was as follows: MS + 3 mg / L 6-BA + 0.25 mg / L ABA + 1.25 mM MES + 200 μM As + 250 μM LA; The recovery medium in step S3 is as follows: MS + 3 mg / L 6-BA + 0.5 mg / L ABA + 200 mg / mL TMT; The screening medium in step S4 is as follows: MS + 3 mg / L 6-BA + 0.5 mg / L ABA + 200 mg / mL TMT + 150 mg / L spe; The rooting medium in step S5 is as follows: MS+1.5 mg / L IBA+200 mg / mL TMT.

3. The method according to claim 1, characterized in that Step S1 of the pumpkin seeds before germination also includes: soaking the pumpkin seeds in 55° C. warm water for 30-50 minutes, removing the shells, and disinfecting the surface of the pumpkin seeds in 75% ethanol for 30 seconds, then disinfecting the surface of the pumpkin seeds by soaking them in 0.25% NaClO for 15 minutes, and finally rinsing them with sterile water.

4. The method according to claim 1, wherein The positive Agrobacterium in step S2 contains CpeRPW02800 CRISPR / Cas9 vector for gene knockout function.

5. The method according to claim 4, characterized in that The vector is pASE403R vector.

6. The method according to claim 4, characterized in that Build CpeRPW02800 The primers used for the CRISPR / Cas9 vector with gene knockout function are as follows: CpeRPW02800 -F:5’-ATTGTGATAAGCGGGGCTATTGC-3’; CpeRPW02800 -R:5'-AAACGCAATAGCCCCGCTTATCA-3'.

7. The method according to claim 4, characterized in that When the positive Agrobacterium is inoculated into the explant in step S2, it is first resuspended in IM liquid medium to an OD of 600 is 0.2; The IM liquid culture medium is specifically as follows: MS+3 mg / L 6-BA+0.25 mg / L ABA+1.25 mM MES+200 μM As.

Images