Application of OsPUP5 gene or encoded protein thereof in regulation and control of plant type and / or grain type of rice
By regulating the expression level of the OsPUP5 gene or its encoding protein OsPUP5, the difficult problem of regulating rice plant and grain shape was solved, and precise improvement of plant height, leaf shape and grain shape was achieved, thereby improving rice yield and quality.
Patent Information
- Application Number
- CN202510837778.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-20
- Publication Date
- 2025-09-05
- Estimated Expiration
- 2045-06-20
AI Technical Summary
Existing technologies make it difficult to precisely regulate rice plant and grain shape, the mechanism of coordinated regulation between genes is unclear, and the improvement effect of traditional genetic engineering is limited.
By regulating the expression level of the OsPUP5 gene or its encoding protein OsPUP5, the OsPUP5 gene can be overexpressed or knocked out to control rice plant height, leaf shape and grain shape, including regulating panicle length, internode length, leaf length, leaf width, grain length, grain width and grain thickness.
It has achieved precise regulation of rice plant and grain shape, reduced plant height, leaf length and leaf width, increased grain length, and reduced grain width and thickness, providing theoretical support for rice breeding and improving yield and quality.
Smart Images

Figure HDA0005462358750000011 
Figure HDA0005462358750000012 
Figure HDA0005462358750000013
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to the application of the OsPUP5 gene or its encoded protein in regulating rice plant type and / or grain type. Background Art
[0002] As an important global food crop, rice's yield and quality have long been a focus of agricultural research. Plant and grain shape are key agronomic traits influencing rice yield and quality. An ideal rice plant shape optimizes light, space, and other resources, improving photosynthesis efficiency and ultimately increasing yield. A suitable grain shape not only affects the rice's appearance but also significantly impacts its processing quality and cooking and flavor.
[0003] Although current research has identified several genes involved in regulating rice plant and grain architecture, the regulation of rice plant and grain architecture is a complex network involving numerous genes and their interactions, and significant gaps remain in our understanding of this regulatory network. The functions of many key genes are not yet fully understood, and even less is known about the coordinated regulatory mechanisms between genes. This makes precise improvement of rice plant and grain architecture through traditional genetic engineering methods a significant challenge, making it difficult to achieve the desired results.
[0004] Research on the rice purine permease family (OsPUP) in regulating rice plant and grain shape is still in its exploratory phase. While this family has been shown to be involved in various physiological processes in rice, its specific mechanisms of action and current status in plant and grain shape research remain to be further explored. Summary of the Invention
[0005] In view of this, the object of the present invention is to provide the use of the OsPUP5 gene or its encoded protein in regulating rice plant type and / or grain type.
[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0007] The present invention provides the use of the OsPUP5 gene or the encoded protein OsPUP5 in regulating rice plant type.
[0008] The present invention also provides the use of the OsPUP5 gene or the encoded protein OsPUP5 in regulating rice grain shape.
[0009] Preferably, the plant type includes plant height and leaf type.
[0010] Preferably, the plant height is regulated by adjusting the ear length and the internode length.
[0011] Preferably, the leaves include flag leaves and second leaves.
[0012] Preferably, the leaf shape includes leaf length and leaf width.
[0013] Preferably, the particle shape includes particle length, particle width and particle thickness.
[0014] Preferably, the effect of reducing plant height is achieved by overexpressing the OsPUP5 gene or increasing the expression level of the encoded protein OsPUP5.
[0015] Preferably, the effect of reducing leaf length and leaf width is achieved by overexpressing the OsPUP5 gene or increasing the expression level of the encoded protein OsPUP5.
[0016] Preferably, the effects of increasing grain length, decreasing grain width and decreasing grain thickness are achieved by knocking out the OsPUP5 gene or reducing the expression of the encoded protein OsPUP5.
[0017] Beneficial effects of the present invention:
[0018] The present invention proposes for the first time that overexpressing the OsPUP5 gene or increasing the expression level of the encoded protein OsPUP5 will shorten the plant, shorten the panicle length of the main tiller, the length of the first, second, third and fourth nodes of the stem, and reduce the length of the internode cells and the length and width of the flag leaf and the second leaf, providing theoretical support for rice plant type breeding.
[0019] The present invention proposes for the first time that knocking out the OsPUP5 gene or reducing the expression of the encoding protein OsPUP5 will significantly increase grain length and significantly decrease grain width and thickness, providing theoretical support for rice grain type breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 The expression pattern of OsPUP5 in different tissues of wild-type plants. MR represents mature root, ST represents stem, LB represents leaf, LS represents sheath, and Panicle represents panicle. Bars represent standard deviations. Different letters above the bars indicate significant differences (P < 0.05).
[0021] Figure 2 GUS staining analysis of different tissues of pOsPUP5::GUS transgenic plants. A: coleoptile and seminal root; B: lateral root; C: stem cross section; D: leaf sheath cross section; E: leaf blade, pulvinus, ligule, and auricle; F: spikelet; G: stigma and ovary; H: anther. Note: Scale bar: 1 cm.
[0022] Figure 3Effects of different forms of cytokinins (CKs) on the transcriptional level of OsPUP5 in roots and shoots of wild-type plants. (A) Effects of different forms of CKs on the transcriptional level of OsPUP5 in roots of wild-type plants; (B) Effects of different forms of CKs on the transcriptional level of OsPUP5 in shoots of wild-type plants. Note: Three biological replicates were set up in the experiment. Error bars are standard deviations. Different letters indicate differences, and the same letters indicate no differences.
[0023] Figure 4 The subcellular localization of OsPUP5 protein, A shows the subcellular localization of OsPUP5 in tobacco leaves, and B shows the subcellular localization of OsPUP5 in rice protoplasts. Note: Bright field, bright field; Merged, superimposed field; Scale bar, 10 μm;
[0024] Figure 5 Phenotypic analysis of OsPUP5 overexpression lines, where A shows the comparison of plant morphology between the wild type and overexpression lines OE1 and OE2; B shows the expression level of OsPUP5 overexpression lines; C shows the statistical data of plant height; and D shows the statistical data of effective panicle number. Note: Three biological replicates were set for expression level detection, and 24 biological replicates were set for plant height and effective panicle number statistics. Error bars are standard deviations. Scale bar, 29 cm. ** indicates extremely significant differences (P < 0.01).
[0025] Figure 6 The stem node phenotype analysis of OsPUP5 overexpression lines, where A is the comparison of panicle length and stem node length between wild type and overexpression lines OE1 and OE2, where Panicle represents panicle, 1 st ln represents the first stem node, 2 nd ln represents the second stem node, 3 rd ln represents the third stem node, 4 th ln represents the fourth node from the bottom, B is the statistical data of spike length and node length; Note: The experiment was set up with 6 biological replicates, and the error bars are standard deviations; scale bar, 10 cm, * indicates significant difference (P < 0.05), and ** indicates extremely significant difference (P < 0.01);
[0026] Figure 7 Cell length analysis of the longitudinal section of the first stem node in OsPUP5-overexpressing plants. A is a histological section of the longitudinal section of the first stem node in an OsPUP5-overexpressing plant; B is a statistical chart of cell length in the longitudinal section of the first stem node in an OsPUP5-overexpressing plant. Note: The number of observed cells is 1000 (from random fields of view of sections of the first stem node in three different plants), and the error bars are standard deviations. Scale bar, 100 μm; * indicates a significant difference (P < 0.05), ** indicates an extremely significant difference (P < 0.01).
[0027] Figure 8The morphological analysis of the flag leaf and the second leaf in the OsPUP5 overexpression strains, where A is the comparison of the flag leaf morphology between the wild type and the overexpression strains; B is the statistical data of the flag leaf length; C is the statistical data of the flag leaf width; D is the comparison of the second leaf morphology between the wild type and the overexpression strains; E is the statistical data of the second leaf length; F is the statistical data of the second leaf width; Note: The experiment was set up with 6 biological replicates, and the error bars are standard deviations; scale bar, 10 cm; * indicates significant difference (P < 0.05), and ** indicates extremely significant difference (P < 0.01);
[0028] Figure 9 Figure 3. Analysis of panicle morphology of OsPUP5-overexpressing strains. A shows the comparison of panicle morphology between the wild type and the overexpressing strain; B shows the statistical data of primary stalks; C shows the statistical data of secondary stalks; D shows the statistical data of grain number per panicle; and E shows the statistical data of seed setting rate. Note: Six biological replicates were used in the experiment, and error bars represent standard deviations. Scale bar, 10 cm. * indicates significant difference (P < 0.05), and ** indicates extremely significant difference (P < 0.01).
[0029] Figure 10 Grain morphology analysis of OsPUP5 overexpression lines, where A is a comparison of grain morphology between the wild type and the overexpression lines; B is the statistical data of grain length; C is the statistical data of grain width; D is the statistical data of grain thickness; Note: Grain morphology statistics were set with 60 biological replicates; error bars are standard deviations; scale bar, 1 cm; ** indicates extremely significant differences (P < 0.01);
[0030] Figure 11 Phenotypic analysis of OsPUP5 knockout mutant plants, where A indicates the mutation type of OsPUP5, B is the comparison of wild-type and knockout mutant plant morphology; C is the statistical data of plant height, and D is the statistical data of effective panicle number; Note: The experiment was set up with 6 biological replicates, and the error bars are standard deviations; scale bar, 29 cm; * indicates significant difference (P < 0.05);
[0031] Figure 12 The stem node phenotype analysis of OsPUP5 knockout mutant strains, where A is the comparison of ear length and stem node length between wild type and knockout strains; B is the statistical data of ear length and stem node length, Panicle represents ear, 1 st ln represents the first stem node, 2 nd ln represents the second stem node, 3 rd ln represents the third stem node, 4 th ln represents the fourth node from the bottom. Note: The experiment was repeated 6 times, and the error bars are standard deviations. Scale bar, 10 cm.
[0032] Figure 13The morphological analysis of the flag leaf and second leaf of the OsPUP5 knockout strain, where A is the comparison of the flag leaf morphology between the wild type and the knockout mutant strain; B is the statistical data of the flag leaf length; C is the statistical data of the flag leaf width; D is the comparison of the second leaf morphology between the wild type and the knockout mutant strain; E is the statistical data of the second leaf length; F is the statistical data of the second leaf width; Note: The experiment was set up with 6 biological replicates, and the error bars are standard deviations; scale bar, 10 cm;
[0033] Figure 14 Figure 3 shows the panicle morphology of OsPUP5 knockout lines. A shows the comparison of panicle morphology between wild type and knockout lines; B shows the statistical data of primary stalks; C shows the statistical data of secondary stalks; D shows the statistical data of grain number per panicle; E shows the statistical data of seed setting rate. Note: Six biological replicates were set in this experiment. Error bars are standard deviations. Scale bar, 10 cm.
[0034] Figure 15 Figure 3 shows grain morphology analysis of OsPUP5 knockout strains, where A shows the comparison of grain morphology between the wild type and knockout strains; B shows the statistical data of grain length; C shows the statistical data of grain width; and D shows the statistical data of grain thickness. Note: Grain morphology statistics were performed with 60 biological replicates; error bars are standard deviations; scale bar, 1 cm; * indicates significant differences (P < 0.05); ** indicates extremely significant differences (P < 0.01).
[0035] Figure 16 Figure 3 is the expression analysis of CKs-related A-type response regulator genes in the last stem node of the OsPUP5-overexpressing line, where A is the expression level of A-type response regulator 1 (OsRR1); B is the expression level of A-type response regulator 2 (OsRR2); C is the expression level of A-type response regulator 4 (OsRR4); D is the expression level of A-type response regulator 6 (OsRR6); E is the expression level of A-type response regulator 7 (OsRR7); F is the expression level of A-type response regulator 9 / 10 (OsRR9 / OsRR10); Note: The experiment was set up with three biological replicates, and the error bars are standard deviations; * indicates significant differences (P < 0.05), and ** indicates extremely significant differences (P < 0.01);
[0036] Figure 17Figure 2 shows the quantitative analysis of CKs in the last stem node of the OsPUP5 overexpression line OE1 and the knockout line KO1, where A is the quantitative analysis related to N6-isopentenyl adenine (iP) in the OsPUP5 overexpression and knockout lines; B is the quantitative analysis related to trans-zeatin (tZ) in the OsPUP5 overexpression and knockout lines; C is the quantitative analysis related to cis-zeatin (cZ) in the OsPUP5 overexpression and knockout lines; D is the quantitative analysis related to dihydrozeatin (DHZ) in the OsPUP5 overexpression and knockout lines; E is the total amount of different active forms of cytokinins in the OsPUP5 overexpression and knockout lines; Note: The experiment was repeated three times, and the error bars are standard deviations; different lowercase letters in the figure indicate significant differences (P<0.05). DETAILED DESCRIPTION
[0037] The present invention provides the use of the OsPUP5 gene or the encoded protein OsPUP5 in regulating rice plant type and / or grain type.
[0038] In the present invention, the OsPUP5 gene is designated as LOC_Os09g38510, and its gene information can be found on the Rice Genome Annotation Project (RGAP) website (http: / / rice.uga.edu / ). OsPUP5 is located on chromosome 9 and is 2675 bp long, comprising two exons and one intron, with a CDS of 1167 bp. The CDS sequence of the OsPUP5 gene is shown in SEQ ID NO. 12, and the amino acid sequence of the encoded protein, OsPUP5, is shown in SEQ ID NO. 13.
[0039] In the present invention, the plant type preferably includes plant height and leaf shape. In the present invention, the OsPUP5 gene or the encoded protein OsPUP5 regulates plant height by adjusting panicle length and internode length. In the present invention, the leaves preferably include flag leaves and second leaves; the leaf type preferably includes leaf length and leaf width. In the present invention, the grain type preferably includes grain length, grain width, and grain thickness.
[0040] In the present invention, reducing plant height is preferably achieved by overexpressing the OsPUP5 gene or increasing the expression of the encoded OsPUP5 protein. Reducing plant height effectively resists lodging, thereby preventing the reduction in rice yield caused by lodging, and improves the efficiency of mechanical harvesting. In the present invention, when overexpressing the OsPUP5 gene, the expression vector used is preferably pCAMBIA2301-ACTIN1.
[0041] In the present invention, preferably, the leaf length and width are reduced by overexpressing the OsPUP5 gene or increasing the expression of the encoded protein OsPUP5. Reducing leaf length and width helps optimize the photosynthetic efficiency of the population, enhance stress resistance, increase planting density, and reduce the incidence of pests and diseases.
[0042] In the present invention, the OsPUP5 gene is preferably knocked out or the expression of the encoded protein OsPUP5 is reduced to achieve the effects of increasing grain length, decreasing grain width, and decreasing grain thickness. Increasing grain length and reducing grain width and thickness facilitates mechanized hybrid rice seed production by utilizing the differences in grain thickness between parental lines. Narrow grain shape reduces the rate of broken rice during milling and increases the rate of head-finished rice. Furthermore, slender grain shape is a key indicator of high-quality rice, which has a higher market value.
[0043] The application of the present invention is helpful for rice gene editing, molecular marker-assisted breeding, etc., and lays the foundation for the research and development of excellent rice traits.
[0044] This study proposes for the first time that OsPUP5 can specifically participate in the transport of iP-type cytokinins (CKs), affecting longitudinal internode cell elongation and grain development by regulating the spatial distribution of CKs. Its function is tissue-specific and may affect the overall CKs homeostasis through root-crown signaling. The experimental results of the present invention show that the increase in CKs content in the last internode of the overexpression strain has a negative impact on cell elongation, resulting in a defective internode length shortening. This may be because OsPUP5 affects other hormone pathways or inhibits the expression of genes related to cell growth and development, resulting in negative feedback regulation. In summary, the cell membrane-localized protein OsPUP5 regulates the homeostasis of local CKs by actively transporting CKs or competitively inhibiting the efflux of CKs.
[0045] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0046] In the following examples, unless otherwise specified, all methods are conventional.
[0047] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.
[0048] The data obtained in the experiments in the following examples are expressed as mean ± SE. Statistical analysis and analysis of variance were performed using DPS 7.05. P < 0.05 indicates a significant difference, marked as * in the figures; P < 0.01 indicates a very significant difference, marked as ** in the figures. t-tests were performed using GraphPad Prism (8.01). Figures marked with different lowercase letters indicate significant differences. GraphPad Prism (8.01) software was used for plotting.
[0049] The rice plant material in the following examples is the japonica rice variety Zhonghua 11 (ZH11). The rice materials were all grown in a suitable field environment.
[0050] Escherichia coli (DH5α) and Agrobacterium tumefaciens (AGL1) in the following examples were purchased from Shanghai Weidi Biotechnology Co., Ltd. Overexpression vectors were constructed using pCAMBIA2301-ACTIN1, gene knockout vectors were constructed using pCHCRISPR / Cas9, GUS vectors were constructed using pCAMBIA2391Z, and subcellular localization vectors were constructed using pCAMBIA2300-35S-GFP and pCAMBIA2300-35S-RFP.
[0051] The rice growth conditions in the following embodiments are as follows: for strains that need to be cultured with nutrient solution, select seeds in good condition and place them in a plastic cup filled with water at 37°C to soak until germination. Use seeds with the same degree of whitening and arrange them in different areas on a 96-well plate without a bottom, which is regarded as the 0th day of culture. After adding the same amount of water to the culture box, place it in an incubator with uniform light source for culture. On the fourth day, replace the water in the culture box with Kimura B nutrient solution, and update the Kimura B nutrient solution every other day. The laboratory has a separate culture room, and the incubator is set to a normal temperature of 28°C. The light intensity is 540μmol / m 2 s, and the relative humidity was 70%. The field growth conditions were suitable for rice survival, and the field trial was carried out normally.
[0052] Example 1
[0053] The tissue expression pattern of OsPUP5 in different tissues of wild-type rice Zhonghua 11 (ZH11) was analyzed by qRT-PCR. The method is as follows:
[0054] 1.1 Extraction of total RNA from rice
[0055] (1) After the mortar is cooled in liquid nitrogen, an appropriate amount of rice sample and liquid nitrogen are placed in the mortar and quickly ground into a whitish and fine powder visible to the naked eye.
[0056] (2) Transfer the sample powder to a 2 mL RNase-free centrifuge tube that has been cooled in liquid nitrogen and labeled. Add 1 mL of Trizol (Invitrogen) and perform the next step in a fume hood. Lower the centrifuge temperature to 4°C in advance, add 0.3 mL of chloroform to the tube, mix thoroughly using a laboratory vortexer, and then centrifuge at 12,000 rpm for 10 min.
[0057] (3) Prepare a new 1.5 mL RNase-free centrifuge tube and transfer 0.4 mL of the supernatant to the new tube. Add 0.4 mL of isopropanol to the tube, shake to mix, and place it at room temperature or on ice for 30 minutes. Centrifuge the sample at 12,000 rpm / min for 10 minutes at 4°C.
[0058] (4) Remove the supernatant and wash the precipitate with 1 mL of 75% ethanol prepared with DEPC-H2O. After this step, place the sample back into the centrifuge and centrifuge for 5 minutes under the same operating parameters as before to remove excess washing solution.
[0059] (5) After removing the supernatant and drying the precipitate at room temperature, dissolve it in 50 μL DEPC-H2O. Once the precipitate is completely dissolved, place the sample in a -80°C refrigerator for long-term storage.
[0060] 1.2. Reverse transcription PCR (RT-PCR)
[0061] The reverse transcription kit HiScript IIQ Select RT SuperMix for qRT-PCR (+gDNAwiper) from Novozymes was used, and the specific operation was performed according to the following steps.
[0062] (1) Remove the sample RNA from -80℃ and place it in an ice box to wait for it to thaw naturally. Calculate the amount in advance, prepare the reaction system, and gently mix the system with a pipette. Once a homogenous system is achieved, place it in a PCR instrument and incubate at 42℃ for 2 minutes. This step is to remove genomic gDNA.
[0063] (2) Prepare the reverse transcription solution system by adding 4 μL of 5×HiScriptⅡqRT SuperMixⅡ directly to 16 μL of the solution obtained in step (1) and mix thoroughly.
[0064] (3) The mixed system was subjected to reverse transcription reaction procedures at 50°C for 15 min and 85°C for 5 sec.
[0065] 1.3 cDNA quality testing
[0066] Prepare the PCR reaction mix and set the desired PCR protocol. After stopping the reaction, verify the cDNA by agarose gel electrophoresis. If bright bands are observed, the cDNA is suitable for subsequent experiments, such as qRT-PCR. Dilute each cDNA tube with 80 μL of ddH2O, mix thoroughly, and store in the appropriate compartment of the refrigerator at -20°C.
[0067] 1.4 Quantitative Real-time PCR (qRT-PCR)
[0068] In qRT-PCR, UBIQUITIN2 was used as an internal control for expression analysis in all samples, and subsequent data were processed using the Comparative Ct method. In the qRT-PCR reaction, the primer pair for qRT-OsPUP5 was CTGGTTCCATGACCCCATGA (SEQ ID NO. 1) and CCAACCATGTAGGAGCCGAA (SEQ ID NO. 2), and the primer pair for the internal control UBIQUITIN2 was GAGCCTCTGTTCGTCAAGTA (SEQ ID NO. 3) and ACTCGATGGTCCATTAAACC (SEQ ID NO. 4).
[0069] Three replicates were used for sample loading, and qRT-PCR reaction was performed according to the program of 95°C, 15 min; 95°C, 10 sec; 60°C extension 30 sec; and 35 to 40 cycles.
[0070] The experiment was repeated three times, and the results are as follows Figure 1 As shown, OsPUP5 is expressed to varying degrees in mature roots, stems, leaves, sheaths, and panicles of different lengths (1-2 cm, 3-4 cm, 4-5 cm, 10 cm, and 15 cm). The relative expression of OsPUP5 is highest in mature roots and lowest in stems. Furthermore, its expression level is not uniform within the panicle.
[0071] Example 2
[0072] A GUS expression vector driven by the promoter region 2000 bp upstream of the OsPUP5 start codon ATG was constructed and transformed into wild-type rice ZH11 as follows:
[0073] First, the OsPUP5 promoter sequence was found on the NCBI website and GUS primers TACGCCAAGCTTGGCTGCAGTCTGGCTGTTCATGGGTTTA (SEQ ID NO. 5) and CCGGGGATCCGTCGACCTGCCGCCGCCGCCGTCGGT (SEQ ID NO. 6) were designed. PCR amplification was performed using rice ZH11 genomic DNA as a template. The GUS vector was constructed using pCAMBIA2391Z. After the reaction, the results were analyzed by agarose gel electrophoresis and the target fragment was recovered from the gel. Enzyme digestion and homologous recombination were then performed.
[0074] GUS staining was performed on tissues including the coleoptile, rootlet, stem, leaf sheath, leaf blade, pulvinus, ligule, auricle, spikelet, stigma, ovary, and anther of the transgenic plants using a GUS staining kit (Coolaber Bio). High-power microscopes were used for observation. When observing under the microscope, the magnification was adjusted until the image was completely clear. If blue areas were observed, photos were taken for preservation. GUS expression sites are those areas that appear blue.
[0075] The results are as follows Figure 2 As shown, OsPUP5 is expressed in various tissues.
[0076] Example 3
[0077] Analysis of OsPUP5 response to cytokinins (CKs)
[0078] N6-isopentenyl adenine (iP), trans-zeatin (tZ), and cis-zeatin (cZ) are three active CKs that can be endogenously synthesized in rice. To investigate whether OsPUP5 responds to CKs, the expression of OsPUP5 in wild-type ZH11 treated with different CKs was analyzed. The specific methods were as follows:
[0079] Wild-type (ZH11) plants grown in hydroponics at room temperature for 10 days were treated with exogenous CKs. Kimura B nutrient solution was used in the control culture box, and the solutions added to the other three culture boxes were based on Kimura B nutrient solution, with the addition of three exogenous hormones iP, tZ, and cZ, ensuring that the hormone treatment concentration in each box was 1 μM. To ensure that only the roots of the seedlings were treated, the volume of the solution in the culture box only accounted for 2 / 3 of the box volume. After the seedling roots were treated for 4 hours, samples of the aboveground and underground parts were taken (three biological replicates per group) and analyzed using qRT-PCR.
[0080] The results are as follows Figure 3 As shown in Figure 3, cZ significantly downregulated the mRNA abundance of OsPUP5 in roots compared with the control group with only nutrient solution in the hydroponic box ( Figure 3 A in the figure), while iP significantly induced the expression of OsPUP5 in the aerial part ( Figure 3 B) in.
[0081] Example 4
[0082] OsPUP5 is localized to the cell membrane
[0083] The subcellular localization of proteins is crucial for their function. To analyze the subcellular localization of OsPUP5, we tagged it with green fluorescent protein (GFP) and constructed the OsPUP5 subcellular localization vector GFP-OsPUP5 as follows:
[0084] Primers for subcellular localization were designed based on the OsPUP5 CDS sequence: CAAGGAGCTCGGATCCATGGAGAGGAACCAGCACCG (SEQ ID NO. 7) and GCAGGTCGACTCTAGATCAATTTGTG GATGCTTTCT (SEQ ID NO. 8). PCR amplification was performed using rice ZH11 cDNA as a template. The subcellular localization vector was constructed using restriction endonucleases BamHI and XbaI to digest the pCAMBIA2300-35S-GFP vector, followed by homologous recombination. The colocalization marker, OsPUP4-RFP, was provided by Professor Xiao Yunhua of Hunan Agricultural University.
[0085] The corresponding vectors were introduced into tobacco epidermal cells and rice protoplasts for analysis. GFP-OsPUP5 was first transformed into tobacco epidermal cells by Agrobacterium, and the fluorescence signal was detected using a confocal laser scanning microscope. Figure 4 As shown, the fluorescence signal of OsPUP5 was uniformly distributed in the cell membrane area, which preliminarily confirmed that OsPUP5 was located in the cell membrane ( Figure 4 To further verify this result, GFP-OsPUP5 was fused with the known red fluorescent protein RFP-OsPUP4, a cell membrane marker protein, and co-expressed in rice protoplasts. The results showed that the green fluorescence signal of the OsPUP5 fusion protein was highly consistent with the red fluorescence signal of the OsPUP4 fusion protein ( Figure 4 The results in Figure 3 (B) indicate that OsPUP5 is localized to the cell membrane, which is consistent with the protein prediction.
[0086] Example 5
[0087] Effects of OsPUP5 overexpression on rice growth and development
[0088] 1. Overexpression of OsPUP5 affects rice plant height
[0089] To investigate the regulatory function of the OsPUP5 gene in rice growth and development, transgenic plants overexpressing OsPUP5 driven by the strong promoter ACTIN1 were generated in a wild-type (ZH11) background. After pure line screening using G418 and positive identification, two positive overexpression lines were selected for further study. These two OsPUP5 overexpression lines, abbreviated as OE1 and OE2, were analyzed by qRT-PCR (same as in Example 1) to determine OsPUP5 transcription levels in the overexpression lines. The specific method for constructing the OsPUP5 overexpression vector is as follows:
[0090] First, the CDS sequence was searched on the RGAP website and primers CCGGGGATCCTCTAGAATGGAGAGGAACCAGCACCG (SEQ ID NO. 9) and AAAGCAGGGCATGCCTGCAGTCAATTTGTGGATGCTTTCT (SEQ ID NO. 10) were designed to construct the OsPUP5 overexpression vector. OsPUP5-OE was amplified by PCR using rice ZH11 cDNA as a template. The results were analyzed by agarose gel electrophoresis and the target fragment was recovered from the gel. The vector pCAMBIA2301-ACTIN1 was digested with restriction enzymes Xba I and Pst I, followed by homologous recombination.
[0091] The method for screening pure lines of overexpressing plants is as follows: prepare a clean culture dish and cover it with filter paper. Soak the seeds that need to be screened in advance and let them germinate naturally. Mark the culture dishes with numbers, select no less than 30 completely white seeds in each culture dish, and pour in a 100 mg / L concentration of G418 solution to completely cover the seeds. After preparation, set the constant temperature to 30°C and wait for the temperature to stabilize, transfer the culture dish to a constant temperature space, and wait for it to grow. It is necessary to observe whether the solution in the culture dish is completely evaporated every day to prevent the seeds from drying out due to lack of solution. Wait for about 1 week, count the seedling rate, and use the standard of pure lines for screening when all the seeds in the culture dish have seedled.
[0092] The results are as follows Figure 5 As shown, the wild type (WT) overexpressed both OE1 and OE2. The expression level of OE1 increased by 1033.6 times compared with WT, and OE2 overexpressed by 954.4 times ( Figure 5 Measuring plant height and effective panicle number at maturity under normal field growth conditions showed that compared with wild-type plants (WT), plant height of OE1 decreased by 29.63% and plant height of OE2 decreased by 31.28%. The plant heights of the two overexpression lines, OE1 and OE2, were significantly reduced compared with WT, while the effective panicle number did not change significantly.
[0093] 2. Shortened panicle and internode lengths in rice lead to shorter plant heights in OsPUP5-overexpressing lines
[0094] To explore the possible reasons why OsPUP5 overexpression causes plant dwarfing, the length of some stem nodes of mature wild-type plants and two overexpression lines was measured. Figure 6 As shown in the figure, the lengths of the main tiller of OE1 and OE2, including the spike length, the first to last node, the second to last node, the third to last node, and the fourth to last node, were significantly lower than those of WT.
[0095] 3. Overexpression of OsPUP5 shortens the cells in the second stem node and causes the internode length to shorten
[0096] In order to analyze the possible reasons for the shortening of stem nodes at the cellular level, the first stem node of the wild type and overexpression lines was longitudinally sectioned and analyzed using paraffin section test technology. The length of cells in the longitudinal sections of the first stem node of ZH11 and overexpression lines (OE1 and OE2) was measured. The results are as follows Figure 7 As shown in the figure, compared with WT, the cell length in the last stem node of the overexpression lines was significantly reduced, indicating that OsPUP5 overexpression would lead to shortened internode cell length in rice plants.
[0097] 4 Overexpression of OsPUP5 affects the length and width of the flag leaf and the second leaf in rice
[0098] Functional leaves of rice are crucial for photosynthesis during rice growth and development, so the length and width of the flag leaf and the second leaf from the bottom of the main tiller of OsPUP5 overexpression lines OE1 and OE2 growing normally in the field were measured. Figure 8 As shown in the data, compared with WT, the length and width of the flag leaf, the length and width of the second leaf of the OsPUP5-overexpressing plants were significantly reduced, indicating that overexpression of OsPUP5 can significantly affect the flag leaf and the second leaf of rice, indicating that overexpression of the OsPUP5 gene can affect the morphological changes of functional leaves in rice.
[0099] 5. Overexpression of OsPUP5 affects rice seed setting rate
[0100] The main panicle traits of OsPUP5 overexpressing lines OE1 and OE2 were measured at maturity. Figure 9 As shown in the figure, there were no significant differences in primary and secondary branches, or number of grains per ear in OE1 compared to WT, but the seed set rate was significantly decreased. While OE2 showed a decrease in primary branches compared to WT, there were no significant differences in secondary branches or number of grains per ear, and the seed set rate was also significantly decreased, similar to OE1.
[0101] 6. Overexpression of OsPUP5 affects rice grain size
[0102] To investigate the effects of OsPUP5 overexpression on grain morphology and weight, the length, width, thickness, and 1000-grain weight of the grains of OsPUP5 overexpressing lines OE1 and OE2 were measured. Figure 10 As shown in the figure, compared with the WT, the grain length of the two overexpression lines OE1 and OE2 did not differ significantly. However, the grain width and thickness of the two overexpression lines showed extremely significant decreases. Compared with the WT, the grain width of OE1 decreased by 7.34% and the grain thickness decreased by 7.78%, while the grain width of OE2 decreased by 6.74% and the grain thickness decreased by 7.99%.
[0103] Example 6
[0104] Effects of OsPUP5 gene knockout on rice growth and development
[0105] 1. Knockout of OsPUP5 does not affect rice plant height
[0106] 2. Using the design website CRISPR-GE (http: / / skl.scau.edu.cn / ), after determining the coding region sequence of the OsPUP5 gene, the sgRNA sequence was designed using the website. The sgRNA sequence was GAGAGGAACCAGCACCGCGA (SEQ ID NO. 11). Two different types of OsPUP5 gene knockout and mutant strains were created using CRISPR / Cas9 technology, referred to as KO1 and KO2. The KO1 mutant had a frameshift mutation caused by the insertion of a C base at position 21 of the coding region, while the KO2 mutant had a frameshift mutation caused by the deletion of a G base at position 20 of the coding region (see Figure 11 A), wherein the method for constructing a CRISPR / Cas9 knockout mutant vector of OsPUP5 is:
[0107] The plant height and effective panicle number of rice are closely related to yield. By measuring the plant height and effective panicle number of two gene knockout materials under normal field growth conditions, it was found that the results were significantly different from those of the overexpression lines (see Figure 11 B~ Figure 11 (D) Compared with WT, the plant height of the KO1 mutant did not change significantly, but the number of effective panicles was significantly reduced, while the plant height and effective panicle number of the KO2 mutant did not change significantly, indicating that knocking out OsPUP5 has little effect on rice plant height.
[0108] 3. There was no significant change in the spike length and internode length of plants with OsPUP5 knockout
[0109] The internode length of rice plays a decisive role in plant height. To further verify that the plant height of KO1 and KO2 did not change significantly compared with WT, the length of the main tiller of the two mutant plants was further measured, including the length of the first internode, the second internode, the third internode, and the fourth internode. Figure 12 As shown, the panicle length and internode length of KO1 and KO2 were not significantly changed compared with WT, which confirmed that knockout of OsPUP5 had no significant effect on plant height.
[0110] 4. Knockout of OsPUP5 does not affect the length and width of the flag leaf and the second leaf in rice
[0111] The photosynthesis of rice plant functional leaves plays a very important role in rice grain setting, filling maturity and grain weight, so the length and width of the flag leaf and the second leaf of the knockout mutant rice plants WT, KO1 and KO2 were measured. Figure 13 As shown in the figure, the length and width of the flag leaf and the second leaf of the two knockout mutants were not significantly changed compared with the WT, indicating that knockout of OsPUP5 had no significant effect on the length and width of the flag leaf and the second leaf of rice plants.
[0112] 5. Knockout of OsPUP5 does not affect rice seed setting rate
[0113] To further explore whether knocking out OsPUP5 affects ear traits, the primary and secondary branches, number of grains per ear, and seed setting rate of WT and knockout lines were measured. Figure 14 As shown in the figure, there were no significant differences in primary branches, secondary branches, number of grains per ear and seed setting rate between KO1, KO2 and WT.
[0114] 6. Knockout of OsPUP5 affects rice grain shape
[0115] The grain length, width and thickness of knockout mutants KO1 and KO2 were further measured. Figure 15 As shown in the results, compared with the WT, the grain lengths of the knockout mutants KO1 and KO2 increased significantly by 5.38% and 5.17%, respectively, while the grain width and thickness decreased significantly. Compared with the WT, the grain width of KO1 decreased by 2.64% and the grain thickness decreased by 4.31%. Compared with the WT, the grain width of KO2 decreased by 2.35% and the grain thickness decreased by 3.29%.
[0116] Example 7
[0117] Overexpression of OsPUP5 leads to increased expression of CKs-responsive genes in the last node
[0118] To further verify whether the shortening of stem nodes in OsPUP5-overexpressing materials is related to changes in CKs, the expression levels of CKs-related A-type response regulators (OsRR1, OsRR2, OsRR4, OsRR6, OsRR7, OsRR9 / OsRR10) in the last stem node of WT and OsPUP5-overexpressing rice lines OE1 and OE2 (obtained in Example 5) were detected. Figure 16 As shown in the data, the expression levels of OsRR1, OsRR2, OsRR4, OsRR6, OsRR7, and OsRR9 / OsRR10 in the topmost stem node of the OsPUP5 overexpressing material were significantly upregulated compared with the WT, indicating that overexpression of OsPUP5 caused changes in the expression of CKs-responsive genes in rice.
[0119] Example 8
[0120] OsPUP5 affects the CKs content in the last stem node
[0121] To investigate whether OsPUP5 is involved in CK trafficking or signal transduction in rice plants, the levels of relevant CK forms were measured in the uppermost nodes of wild-type ZH11 (WT), OE1 (obtained in Example 5), and KO1 (obtained in Example 6). Liquid chromatography-tandem mass spectrometry (LC-MS / MS) revealed that the levels of 14 relevant CK forms, as listed in Table 1, were quantified in the uppermost nodes of WT, OE1, and KO1 rice plants.
[0122] analyze Figure 17 Comparisons with WT revealed no significant changes in the contents of iP, iPR, and iP7G in the first-to-last node of OE1 plants. However, the contents of iPRMP, tZ, tZR, tZRMP, cZ, cZR, tZ9G, cZROG, DHZ7G, and DHZROG all increased significantly, while the content of 2MeScZR decreased significantly. Overall, compared with WT, overexpression of OsPUP5 increased the total content of CKs in the first-to-last node. Changes in the content of various CK forms within the first-to-last node of rice can enhance or inhibit their functions. Compared with the content measured in the first-to-last node of WT, the contents of tZ, tZR, tZRMP, cZ, cZR, and DHZ7G in the first-to-last node of KO1 plants remained unchanged, while the contents of iP, iPR, iP7G, iPRMP, 2MeScZR, tZ9G, cZROG, and DHZROG all increased significantly. Overall, knockout of OsPUP5 caused the total content of CKs in the last node to be lower than that in WT, showing a trend opposite to that of CKs in the last node of OE1.
[0123] Table 1. Compounds detected in the bottom stem node of rice
[0124] Serial number English name Abbreviation Chinese name 1 N6-isopentenyladenine IP N6-Isopentenyl adenine 2 N6-Isopentenyl-adenine-7-glucoside iP7G Isopentenyl adenine-7-glucoside 3 N6-isopentenyladenosine IPR Isopentenyl adenosine 4 N-6-iso-pentenyladenosine-5'-monophosphate iPRMP N-6-Isopentenyl adenosine 5'-monophosphate 5 trans-Zeatin tZ trans-zeatin 6 trans-Zeatin-9-glucoside tZG trans-zeatin-9-glucoside 7 trans-Zeatinriboside ZGar Zeatin riboside 8 9-Ribosyl-trans-zeatin5'-monophosphate tZRMP trans-zeatin-9-glucoside-5'-monophosphate 9 cis-Zeatin cZ cis-zeatin 10 cis-Zeatinriboside ZGar cis-zeatin-D-riboside 11 cis-Zeatin-O-glucosideriboside oeLh cis-Zea mays-O-glycoside 12 2-Methylthio-cis-zeatinriboside 2MeScZR 2-Methylthio cis-zeatin riboside 13 Dihydrozeatin-7-glucoside DHZ7G Dihydrozeatin-7-glucoside 14 Dihydrozeatin-O-glucosideriboside DHZROG Dihydrozemidine-O-glycoside
[0125] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. Application of the OsPUP5 gene or the encoded protein OsPUP5 in regulating rice plant type.
2. Application of OsPUP5 gene or encoded protein OsPUP5 in regulating rice grain shape.
3. The use according to claim 1, characterized in that The plant type includes plant height and leaf type.
4. The use according to claim 3, characterized in that The plant height is regulated by adjusting the ear length and internode length.
5. The use according to claim 3, characterized in that Leaves include flag leaves and second leaves.
6. The use according to claim 3, characterized in that The leaf shape includes leaf length and leaf width.
7. The use according to claim 2, characterized in that The particle shape includes particle length, particle width and particle thickness.
8. The use according to claim 3, characterized in that The effect of reducing plant height can be achieved by overexpressing the OsPUP5 gene or increasing the expression level of the encoding protein OsPUP5.
9. The use according to claim 6, characterized in that Overexpression of the OsPUP5 gene or increasing the expression of the encoding protein OsPUP5 can reduce leaf length and width.
10. The use according to claim 7, characterized in that By knocking out the OsPUP5 gene or reducing the expression of the encoding protein OsPUP5, the grain length is increased, the grain width and the grain thickness are reduced.
Citation Information
Patent Citations
Gene capable of simultaneously regulating and controlling grain weight and resistance of rice grain shape and application of encoded protein of gene
CN111826393A