Application of OsUBX57 gene in regulating rice yield
By knocking out or overexpressing the OsUBX57 gene and using CRISPR-Cas9 technology to regulate rice grain shape, the problem of ineffective regulation of rice grain shape development was solved, and rice yield was increased.
Patent Information
- Application Number
- CN202511096294.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-06
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2045-08-06
AI Technical Summary
There is no research in the prior art on the role of the UBX protein family in regulating rice grain shape development, and important traits affecting rice yield have not been effectively regulated.
By knocking out or overexpressing the OsUBX57 gene, CRISPR-Cas9 technology is used to regulate the expression of the OsUBX57 gene in rice, thereby increasing or inhibiting rice grain length, grain width and 1000-grain weight. Gene regulation is achieved using shRNA, siRNA, small molecule compounds or base editors.
After knocking out the OsUBX57 gene, rice grain length became longer, grain width became wider, and 1000-grain weight increased, showing the characteristics of one cause with multiple effects. The traits were restored after functional complementation, indicating that OsUBX57 negatively regulates rice grain growth and development.
Smart Images

Figure CN120591332B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular biology, and particularly relates to use of the OsUBX57 gene in regulating rice yield. Background Art
[0002] Currently, the three main indicators for measuring rice yield are the number of panicles per unit area, the number of grains per panicle, and seed weight. Seed size is the primary factor determining seed weight, and seed size is determined by four factors: length, width, thickness, and grain filling. Rice grain shape directly affects rice yield and quality. Studies have shown that rice grain shape is a quantitative trait controlled by multiple genes. Current research indicates that rice grain shape is primarily regulated through the ubiquitin-proteasome signaling pathway, the G protein signaling pathway, the mitogen-activated protein kinase (MAPK) signaling pathway, plant hormone regulation, and transcription factor regulation pathways.
[0003] The UBX domain is an 80-amino acid residue module found primarily at the carboxyl terminus of most eukaryotic proteins. Databases show that most UBX domain-containing proteins belong to one of four conserved families: human Y33, FAF1, p47, and Rep8 proteins (Alexander et al., 2001). UBX domain proteins were first discovered in humans in the Y33k protein, which is involved in the UBA (ubiquitin conjugation) process (Hofmann & Bucher, 1996). Homologs of the FAF1 protein have been detected in all eukaryotic genomes (Becker et al., 1997). FAF1 has been identified as a member of the death-inducing signaling complex (Fas). It binds to AAA family valerian-containing proteins (VCPs) through its C-terminal UBX domain and recruits polyubiquitinated substrates through its N-terminal UBA domain, thereby regulating protein degradation in the ubiquitin-proteasome and apoptosis (Song et al., 2005). p47, the best-characterized UBX domain-containing protein isolated from mice, serves as a cofactor for the AAA-ATPase p97, regulating post-mitotic reorganization of the Golgi apparatus (Kondo et al., 1997). Rep8, a transmembrane protein localized to the ER membrane, influences human reproductive development (Yamabe et al., 1997). It interacts with p97 through its C-terminal UBX domain, leading to efficient protein degradation (Madsen et al., 2011). UBX domain-containing proteins have a protein fold type that is highly overlapping with ubiquitin. Studies on Y33 (Hofmann & Bucher., 1996), FAF1 (Song et al., 2005), p47 (Kondo et al., 1997), and Rep8 (Madsen et al., 2011) have shown that UBX domain proteins are involved in ubiquitin-related processes in organisms. However, because they lack the critical Lys motif, UBX domain proteins cannot directly bind to substrate proteins like ubiquitin (Alexander et al., 2001).
[0004] P97 is a highly conserved AAA protein, also known as valerin-containing protein (VCP) (Song et al., 2005). It is currently recognized as a core component of the ubiquitin-proteasome, acting as a molecular chaperone to direct protein substrates to the 26S proteasome for degradation (Raasi et al., 2007). It is involved in a wide range of cellular activities, including cell cycle regulation, transcriptional activation, organelle membrane fusion, apoptosis, and DNA repair (Woodman et al., 2003). UBX domain proteins form the largest family of p97 cofactors (Patrik et al., 2011). Genes reported to interact with p97 include UBX1, UBX2, UBX3, UBX4, UBXD1, UBXD9, PUX1, PUX10, and SAKS1. In Saccharomyces cerevisiae, the loss of UBX1 and UBX2 leads to cellular metabolic disorders, primarily impaired lipid droplet metabolism and endoplasmic reticulum degradation (ERAD) (Zhang et al., 2017). UBX2 is dynamically localized in the endoplasmic reticulum (ER) and lipid droplets (LDs). In the ERAD pathway, UBX2 binds ubiquitinated substrates through its UBA domain and interacts with the Cdc48-Ufd1-Npl4 complex, participating in protein degradation (Neuber et al., 2005). Both UBX2 deficiency and excess result in abnormal LD morphology in cells, while injection of mammalian UBX8 into UBX2-deficient cells can complement these LD defects (Wang et al., 2012). UBX3 was the first UBX domain protein discovered to participate in clathrin-mediated endocytosis (ME). UBX3 deficiency results in impaired uptake of the methionine transporter Mup1, suggesting a crucial function for UBX3 in endocytosis (Farrell et al., 2015). UBX4 stabilizes the ERAD pathway in cells by regulating the Cdc48-Ufd1-Npl4 complex but does not affect the binding of UBX2 to the Cdc48-Ufd1-Npl4 complex, suggesting that multiple complexes may participate in the ERAD pathway (Alberts et al., 2009). Overexpression of UBXD1 in cells leads to the dissociation of the Ufd1-VCp complex, resulting in decreased ERAD function (Nagahama et al., 2009). UBXD1 recognizes depolarized mitochondria through its C-terminal UBX domain and then recruits p97 to autophagic mitochondria through its N-terminal PUB domain, thereby clearing damaged mitochondria (Bento et al., 2017).UBXD9 forms a hexamer and interacts with p97 hexamers to form a heterododecamer, which in turn dissociates p97 into heterohexamers, heterotetramers (Arumughan et al., 2016), and heterodimers (Banchenko et al., 2019), ultimately dissociating UBXD9 from p97 monomers (Riehl et al., 2021). PUX1 functions as a negative regulator of AtCDC8 (p97 / VCP). Increased levels of AtCDC48 have been detected in pux1 mutants, stimulating cell division rates in plants (Rancourt et al., 2004). PUX10 is an LD protein containing a UBA domain and a UBX domain. The UBA domain recognizes polyubiquitin motifs in cells, which are primarily composed of LD proteins and K48-linked ubiquitin. The UBX domain recruits CDC48, which directs polyubiquitinated substrates to the 26S proteasome for degradation (Kretzschmar et al., 2018). SASK1 is a negative regulator of the ERAD pathway. Its UBA domain recognizes and binds polyubiquitinated substrates, while its UBX domain binds to p97, inhibiting the degradation of cytoplasmic p97-dependent substrates and protecting polyubiquitin chain substrates from processing by ubiquitin factors (Lalonde et al., 2010). SASK1 is a key cofactor in the deubiquitination process in vivo.
[0005] Rice grain size is also an important trait affecting rice yield. The ubiquitin-proteasome signaling pathway is one of the important pathways regulating rice grain shape and is involved in one of the indispensable life activities of rice. However, there are currently no relevant research reports on the UBX protein family regulating rice grain shape development. Summary of the Invention
[0006] In view of the above-mentioned deficiencies in the prior art, the present invention provides a use of the OsUBX57 gene in regulating rice yield.
[0007] To achieve the above-mentioned purpose, the technical solution adopted by the present invention to solve the technical problem is:
[0008] The present invention aims to provide the use of the OsUBX57 gene in regulating rice yield.
[0009] Furthermore, after knocking out the OsUBX57 gene, the grain length, grain width and 1000-grain weight of rice were all improved.
[0010] Another object of the present invention is to provide a method for improving rice yield by using an OsUBX57 gene knockout agent.
[0011] Furthermore, the OsUBX57 gene knockout reagent can increase rice grain length, grain width and 1000-grain weight.
[0012] Furthermore, OsUBX57 gene knockout reagents include shRNA, siRNA, small molecule compounds or base editors.
[0013] Another object of the present invention is to provide a method for increasing rice grain length, grain width and 1000-grain weight by inhibiting the expression of the OsUBX57 gene in rice.
[0014] Another object of the present invention is to provide use of the OsUBX57 gene in screening and / or identifying rice quality.
[0015] Another object of the present invention is to provide a use of knocking out the OsUBX57 gene in breeding transgenic rice varieties with high grain length, high grain width and high 1000-grain weight.
[0016] Beneficial effects of the present invention:
[0017] The present invention discovered the regulatory role of the OsUBX57 gene in rice yield. Specifically, knocking out the OsUBX57 gene increased grain length and width, and increased 1000-grain weight, demonstrating a single factor with multiple effects. Functional restoration of the OsUBX57 knockout material revealed reduced grain length, width, and 1000-grain weight in the mutant. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 The subcellular localization maps of OsUBX57 protein; a-c are the subcellular localization maps of 35S::GFP plasmid in Nicotiana benthamiana; d-f are the subcellular localization maps of 35S::OsUBX57-GFP plasmid in Nicotiana benthamiana; g-i are the subcellular localization maps of ProUbi::GFP plasmid in rice protoplasts; j-l are the subcellular localization maps of ProUbi::OsUBX57-GFP plasmid in rice protoplasts; the scale bars in a-f are 40 μm, and the scale bars in g-l are 20 μm;
[0019] Figure 2 This is the target site map of the OsUBX57 gene knockout material;
[0020] Figure 3 Figures 1 and 2 show the plant and ear types of Nipponbare and the OsUBX57 knockout material (osubx57). Figure A shows the plant and ear types of NIP; Figures B and C show the plant and ear types of the OsUBX57 knockout material (osubx57). The vertical scale in the plant type diagram is 20 cm, and the horizontal scale in the ear type diagram is 2 cm.
[0021] Figure 4The grain patterns of Nipponbare and the OsUBX57 gene knockout material osubx57 are shown in Figure 1. A is the horizontal grain pattern; B is the vertical grain pattern. The scale in the figure is 2 cm.
[0022] Figure 5 Figures 2 and 3 show the agronomic traits survey results of Nipponbare and the OsUBX57 gene knockout material osubx57; A shows the grain length test results; B shows the grain width test results; C shows the 1000-grain weight test results; D shows the plant height test results; E shows the fruit set rate test results; F shows the main ear length test results; G shows the tiller number test results; and H shows the OsUBX57 gene expression test results.
[0023] Figure 6 Figures 1 and 2 show the plant and ear types of Nipponbare and OE-OsUBX57 overexpressing materials. Figure A shows the plant and ear types of NIP. Figures B to E show the plant and ear types of OE-OsUBX57 overexpressing materials. The vertical scale in the plant type diagram is 20 cm, and the horizontal scale in the ear type diagram is 2 cm.
[0024] Figure 7 Figures 2 and 3 show the results of agronomic trait surveys of Nipponbare and OE-OsUBX57 overexpressing materials; A shows the results of grain length testing; B shows the results of grain width testing; C shows the results of 1000-grain weight testing; D shows the results of plant height testing; E shows the results of fruit set rate testing; F shows the results of main ear length testing; G shows the results of tiller number testing; and H shows the results of OsUBX57 gene expression testing.
[0025] Figure 8 For Nipponharu, osubx57 and osubx57-1 com Agronomic traits survey results of the supplementary materials; A is the grain width test results; B is the grain length test results;
[0026] Figure 9 These are the results of the investigation on the filling rates of Nipponbare and osubx57-1 materials; A is the rice grain morphology; B is the fresh weight; and C is the dry weight. DETAILED DESCRIPTION
[0027] The specific embodiments of the present invention are described below to facilitate understanding of the present invention by those skilled in the art. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, as long as various changes are within the spirit and scope of the present invention as defined and determined by the appended claims, these changes are obvious, and all inventions and creations utilizing the concepts of the present invention are protected.
[0028] The rice materials used in this experiment were the japonica rice variety Nipponbare, as well as transgenic materials using Nipponbare as the receptor for OsUBX57 knockout (osubx57) and OsUXB57 overexpression (OE-OsUBX57). These materials were planted in the experimental fields of South China Agricultural University for teaching and research, and were cultivated and managed according to conventional methods.
[0029] Example 1 Subcellular localization analysis
[0030] Basic information about the OsUBX57 gene is available from the Rice Genome Annotation Project website (https: / / rice.uga.edu / ), under LOC_Os04g57520. The OsUBX57 gene is located on rice chromosome 4. The genomic sequence of the gene is 6596 base pairs long, contains 10 exons, and has a CDS length of 1380 base pairs. The SMATR website (http: / / smart.embl-heidelberg.de / ) predicts that OsUBX57 encodes a protein containing an UBX domain and belongs to the UBX family. UBX family proteins have functions similar to ubiquitin, and the ubiquitin-proteasome pathway is one of the pathways involved in regulating rice grain size.
[0031] Mature proteins must be located in specific organelles to perform their functions. To accurately understand the function of the UBX protein encoded by OsUBX57 in rice cells, we conducted subcellular localization experiments on OsUBX57 using transient expression techniques in Nicotiana benthamiana and rice protoplasts. The specific process is as follows:
[0032] First, a 35S::OsUBX57-GFP fusion expression vector was constructed and then transformed into Agrobacterium. 35S::GFP was used as the control group and the 35S::OsUBX57-GFP fusion expression vector was used as the experimental group. Agrobacterium resuspensions containing 35S::GFP and 35S::OsUBX57-GFP fusion expression vectors were injected into Nicotiana benthamiana leaves, respectively. Samples were taken from tobacco leaves 48-72 hours after injection, and the luminescent sites of green fluorescent protein were observed under a laser confocal microscope. The results are shown in Figure 2. Figure 1 .
[0033] like Figure 1 As shown, OsUBX57 is expressed in the nucleus. Subsequently, a PUBi::OsUBX57-GFP fusion expression vector was constructed, and PUBi::GFP was used as a blank control, while the PUBi::OsUBX57-GFP fusion expression vector was used as an experimental control. Both were transformed into rice protoplasts. The experimental results were consistent with the subcellular localization results in Nicotiana benthamiana, indicating that the OsUBX57 protein was localized in the nucleus.
[0034] Example 2 Effect of OsUBX57 gene on rice yield
[0035] 1. To investigate the effects of OsUBX57 on agronomic traits of rice, CRISPR-Cas9 technology was used to knock out the OsUBX57 gene in Nipponbare. The target site was located in the first exon (GACGGAGGCGGAGAAGGAGT, SEQ ID NO. 1).
[0036] In the early stages of this experiment, OsUBX57 was cultured to the T3 generation, and two homozygous target populations without T-DNA insertions were screened by PCR sequencing. They lacked a G base (GACG-AGGCGGAGAAGGAGT, SEQ ID NO. 2) and a C base (GA-GGAGGCGGAGAAGGAGT, SEQ ID NO. 3) at the target site, respectively. Both are frameshift mutations and will lead to premature termination of protein translation, causing OsUBX57 to lose its original gene function ( Figure 2 Total RNA was extracted from leaves of osubx57-1 and osubx57-2, reverse transcribed into cDNA, and the expression level of OsUBX57 in rice was detected using RT-qPCR technology ( Figure 5 The results showed that after knocking out OsUBX57 using CRISPR-Cas9 technology, OsUBX57 lost its original function in rice. Then, the grain length, grain width and 1000-grain weight of Nipponbare and OsUBX57 populations were investigated. Figures 3-5 .
[0037] like Figures 3-5 As shown, knocking out OsUBX57 in Nipponbare resulted in longer grain length, wider grain width, and increased 1000-grain weight of rice. The agronomic traits of plant height, fruit set rate, main panicle length, and tiller number were also investigated, showing decreased plant height, decreased fruit set rate, and decreased main panicle length, while there was no significant change in tiller number. This suggests that OsUBX57 may negatively regulate rice grain size and participate in multiple regulatory pathways, affecting multiple agronomic traits of rice.
[0038] 2. To further verify that OsUBX57 has a certain negative regulatory effect on rice grain shape, a UBi::OsUBX57 vector was constructed and sent to Wuhan Boyuan Biological Co., Ltd. for transformation. PCR sequencing was used to identify and screen the transgenic materials (OE-OsUBX57) of the T0 generation, and agronomic traits were examined. Five strains with more obvious grain shape performance were selected for multi-generation cultivation. The grain length, grain width, and 1000-grain weight of the Nipponbare and OE-OsUBX57 populations were then investigated. The results are shown in Figure 2. Figure 6 and Figure 7 .
[0039] like Figure 6 and Figure 7 As shown, only OE-OsUBX57-12 exhibited a grain shape characteristic that was opposite to that of the OsUBX57 population, with shorter grain length, narrower grain width, and reduced 1000-grain weight. Compared to Nipponbare, most other lines showed no change or even showed the same pattern as the OsUBX57 population. Furthermore, the agronomic traits of plant height, seed set rate, main ear length, and tiller number showed the same trends as those of the OsUBX57 population.
[0040] Total RNA was extracted from leaves of the OE-OsUBX57 population and reverse transcribed into cDNA. The expression level of OsUBX57 in rice was detected using RT-qPCR technology ( Figure 7 The results showed that overexpression of OsUBX57 in rice affected changes in rice grains, but the effects on rice grains were unpredictable. Increased OsUBX57 expression did not result in shorter grain length, narrower grain width, or reduced 1000-grain weight.
[0041] 3. To further verify that OsUBX57 negatively regulates rice grain shape, osuxb57-1 was constructed. com The functional complement vector was used as the recipient of the osuxb57-1 mutant and sent to Wuhan Boyuan Biological Co., Ltd. for transformation. The T0 generation transgenic seedlings were cultivated and the rice grain morphology at maturity was investigated. The results are shown in Figure 8 .
[0042] like Figure 8 As shown, after transforming the OsUBX57 mutant with the OsUBX57 functional complementation plasmid, osuxb57-1 com The transgenic rice seedlings exhibited shorter grain length, narrower grain width, and decreased 1000-grain weight, which, to a certain extent, restored the phenotypes caused by the OsUBX57 knockout. This suggests that the OsUBX57 gene is involved in rice grain growth and development and negatively regulates it.
[0043] Example 3 OsUBX57 regulates rice filling rate
[0044] In addition to being affected by the size of the hulls, the size of rice grains is also affected by the filling rate. In order to explore whether OsUBX57 affects the size of rice grains by regulating the filling rate of rice, the filling rates of Nipponbare and osuxb57-1 strains were investigated. The panicles of the above groups were marked with a paint pen during the flowering period of rice, and samples were taken at 3d, 6d, 9d, 15d, 21d, and 30d after flowering. The rice grains were shelled and the fresh weight and dry weight of the rice grains were weighed using a 1 / 1000 balance. The results are shown in Table 1. Figure 9 .
[0045] like Figure 9 As shown in Figure 2, 3 days before flowering, there was no difference in fresh weight and dry weight between Nipponbare and osuxb57-1. However, after 3 days, the material accumulation rate of osuxb57-1 accelerated and reached the maximum at 9 days, and from Figure 9 As shown in Figure B, Nipponbare reaches its maximum grain filling rate and begins to lose water at 21 days, while osuxb57-1 is still in the grain filling stage, with both fresh and dry weights increasing at 30 days. This suggests that OsUBX57 affects the grain filling rate of rice grains and that the osuxb57-1 mutant can produce longer and larger seeds by accelerating the grain filling rate and extending the filling period.
[0046] Finally, it should be noted that the above specific implementation methods are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail with reference to examples, those skilled in the art should understand that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.
Claims
1. Use of knocking out the OsUBX57 gene to increase rice grain length, grain width and 1000-grain weight, characterized in that: The gene number of the OsUBX57 gene in the Rice Genome Annotation Project is LOC_Os04g57520.
2. A method for increasing rice grain length, grain width and thousand-grain weight, characterized in that: The OsUBX57 gene of claim 1 is knocked out in rice.
3. Use of the knockout gene OsUBX57 according to claim 1 in breeding transgenic rice varieties with high grain length, high grain width and high 1000-grain weight.
Citation Information
Patent Citations
Method for increasing thousand seed weight of rice seeds
CN117925705A
Plants having modified growth characteristics and method for making the same
US20070118931A1