Small molecule detection method based on Cas13a atypical activation and application thereof

Abstract

The invention relates to a small molecule detection method based on Cas13a atypical activation and application thereof. The method comprises the following steps: preparing a reaction system containing Cas13a protein, modified crRNA (ap-crRNA) and an RNA reporter molecule; contacting the sample with the reaction system; and after the target small molecule is combined with the RNA aptamer sequence in the ap-crRNA, detecting the cutting state of the RNA reporter molecule so as to determine whether the target small molecule exists in the sample or not or determine the concentration of the target small molecule. According to the invention, the RINCA activity of Cas13a is directly regulated and controlled by utilizing the combination of a target small molecule and a spacer (RNA aptamer sequence) in ap-crRNA, and an intermediate step of converting a small molecule signal into a nucleic acid signal is not needed, so that the detection process is simplified.

Description

Technical Field

[0001] The present invention relates to the field of biosensor technology, and in particular to a small molecule detection method based on atypical activation of Cas13a and its application. Background Art

[0002] Aptamers, as biorecognition elements, are widely used in biosensing and molecular diagnostics. Their in vitro evolutionary preparation process is independent of target immunogenicity, making them more universally applicable than recognition elements such as antibodies, enzymes, and nucleic acids. Aptamers, based on these molecules, have been successfully applied to small molecule and protein detection, and even in liquid biopsies. However, the high sensitivity of these diverse assays often relies on additional methods such as enzyme-linked reactions, nucleic acid polymerase chain reaction amplification, and enzyme-catalyzed electrochemical reactions following aptamer recognition. The lack of naturally integrated target recognition, signal conversion, and amplification mechanisms, such as enzyme / substrate complexes and CRISPR-Cas RNPs (ribonucleoproteins), hinders the widespread and efficient application of aptamers in more streamlined formats. The CRISPR-Cas system, particularly Cas13a and Cas12a, which exhibit collateral cleavage activity, offers a new avenue for molecular detection. After the crRNA recognizes the target RNA, the HEPN domain of the Cas13a protein in the Cas13a / crRNA ribonucleoprotein (RNP) complex is activated, generating trans-cleavage activity that can cleave free RNA reporter molecules in the reaction system to achieve signal output. This mechanism has been successfully applied to nucleic acid detection. However, when the CRISPR-Cas system is applied to the detection of non-nucleic acid small molecules or proteins, it is usually necessary to convert the recognition signal of the target molecule into a nucleic acid intermediate, which is then recognized by the CRISPR-Cas system. This step is cumbersome and not very versatile. Therefore, how to construct a small molecule detection method based on the CRISPR-Cas system that is simple in structure, easy to operate, and universal is a technical problem that needs to be solved urgently in this field. Summary of the Invention

[0003] The object of the present invention is to provide a small molecule detection method based on the atypical activation of Cas13a to achieve direct, rapid, sensitive and specific detection of small molecules.

[0004] The technical solution adopted by the present invention to solve its technical problem is:

[0005] A small molecule detection method based on atypical activation of Cas13a, the method comprising the following steps:

[0006] S1. Preparing a reaction system comprising a Cas13a protein, a modified crRNA (ap-crRNA), and an RNA reporter; the ap-crRNA comprises a direct repeat sequence compatible with the Cas13a protein and a spacer sequence comprising an RNA aptamer sequence for the target small molecule;

[0007] The Cas13a protein is LwCas13a composed of the amino acid sequence shown in SEQ ID NO: 1, or LbuCas13a composed of the amino acid sequence shown in SEQ ID NO: 2;

[0008] S2. contacting the sample with the reaction system;

[0009] S3. After the target small molecule binds to the RNA aptamer sequence in the ap-crRNA, the conformation of the ap-crRNA changes, thereby regulating the atypical activation of the Cas13a protein that is independent of the target RNA;

[0010] S4. Detecting the cleavage status of the RNA reporter molecule to determine whether the target small molecule exists in the sample or its concentration.

[0011] Cas13a is used in nucleic acid detection primarily based on its canonical activation principle: in the absence of target RNA, the HEPN catalytic region of the Cas13a protein lacks RNase activity; only when the crRNA-spacer binds to the target RNA does Cas13a acquire RNase activity; upon activation, the "incidental cleavage activity" cleaves the RNA reporter molecule (5'Fluorophore-3'Quencher) in the reaction system, generating a fluorescent signal, thereby detecting the target RNA molecule in the sample. The inventors discovered in their research that the Cas13a protein exhibits a certain amount of RNase activity in the presence of certain crRNAs, even in the absence of target RNA. This phenomenon is known as "RNA target-independent non-canonical activation (RINCA)." This RINCA activity is closely related to the secondary structure of the crRNA, especially its spacer sequence.

[0012] This invention leverages the RINCA activation mechanism and, for the first time, designs the complete sequence of an RNA aptamer or its core functional sequence as a spacer for ap-crRNA. This enables ap-crRNA to simultaneously trigger conformational changes in Cas13a in response to target small molecules (ligands) in solution, thereby altering Cas13a's nuclease activity (trans-cleavage activity). This invention establishes a quantitative relationship between the concentration of the target small molecule and the trans-cleavage activity of Cas13a, successfully achieving direct sensing of small molecule targets by the Cas13a RNP.

[0013] Core Principle: This invention is based on the RINCA phenomenon of the Cas13a protein discovered by the applicant. Specifically, in the absence of a complementary RNA target in the traditional sense, certain crRNAs themselves can partially activate the HEPN domain of the Cas13a protein, causing it to trans-cleave free RNA (such as an RNA reporter) in the system. Studies have shown that this RINCA activity is closely related to the secondary structure of the spacer sequence in the crRNA.

[0014] The present invention cleverly uses an RNA aptamer sequence (complete sequence or its core functional sequence) that can specifically recognize target small molecules as the spacer sequence of crRNA, forming an "aptamer-type crRNA", namely ap-crRNA. When the target small molecule is present and binds to the aptamer in the ap-crRNA, it will induce a conformational change in the aptamer, namely the ap-crRNA spacer region. This conformational change will further affect the RINCA activity of the Cas13a protein (it may be enhanced or weakened, depending on the effect of the specific structure formed after the aptamer-ligand binding on Cas13a activation). By monitoring the changes in the cleavage rate of the fluorescent RNA reporter molecule in the system, quantitative or qualitative detection of the target small molecule can be achieved.

[0015] The Cas13a protein of the present invention can be Cas13a derived from Leptotrichia wadei (LwCas13a) or Cas13a derived from Leptotrichia buccalis (LbuCas13a), or other Cas13a homologous proteins or mutants having similar RINCA activity.

[0016] Preferably, the RNA reporter molecule is a FRET probe with a fluorescent group and a quencher group, for example, an RNA molecule labeled with a fluorescent group (such as FAM) at the 5' end and a quencher group (such as BHQ1) at the 3' end. The detection step is performed by detecting changes in the fluorescence signal.

[0017] Preferably, the target small molecule is an antibiotic (such as kanamycin), a nucleotide (such as ATP), a metabolite, a toxin, or any other small molecule capable of designing or screening for a specific RNA aptamer. More preferably, the target small molecule is kanamycin, the spacer sequence of the ap-crRNA comprises a kanamycin RNA aptamer sequence, and the ap-crRNA sequence is as shown in SEQ ID NO: 3. More preferably, the target small molecule is ATP, the spacer sequence of the ap-crRNA comprises an ATP RNA aptamer sequence, and the ap-crRNA sequence is as shown in SEQ ID NO: 4.

[0018] Preferably, the conformational change of the ap-crRNA results in enhanced or weakened atypical activation of the Cas13a protein, depending on the selected RNA aptamer sequence and the characteristics of the target small molecule.

[0019] Preferably, when the target small molecule is kanamycin, the reaction system comprises: 25 nM ap-crRNA (Kan_long), 15 nM LwCas13a or LbuCas13a, 500 nM U5 fluorescent probe, 1 μL of the sample to be tested, and the buffer required for the reaction;

[0020] When the target small molecule is ATP, the reaction system comprises: 25 nM ap-crRNA (ATP_3), 15 nM LwCas13a or LbuCas13a, 500 nM U5 fluorescent probe, 1 μL of the sample to be tested, and the buffer required for the reaction.

[0021] Preferably, the buffer required for the reaction contains 40 mM Tris-HCl (pH 7.5), 9 mM MgCl2, 1 mM DTT, and 5 U RNase Inhibitor.

[0022] A composition or kit for detecting a target small molecule in a sample, comprising:

[0023] a. Cas13a protein, wherein the Cas13a protein is LwCas13a consisting of the amino acid sequence shown in SEQ ID NO: 1, or LbuCas13a consisting of the amino acid sequence shown in SEQ ID NO: 2;

[0024] b. A modified crRNA (ap-crRNA) comprising a direct repeat sequence compatible with the Cas13a protein and a spacer sequence comprising an RNA aptamer sequence for the target small molecule;

[0025] c. RNA reporter molecules.

[0026] The composition or kit also includes a reaction buffer and other auxiliary reagents.

[0027] Preferably, the RNA reporter molecule is a FRET probe having a fluorescent group and a quencher group.

[0028] A modified crRNA (ap-crRNA), wherein the ap-crRNA comprises a direct repeat sequence compatible with the Cas13a protein and a spacer sequence, wherein the spacer sequence incorporates an RNA aptamer sequence for a target small molecule;

[0029] Among them, when the target small molecule binds to the RNA aptamer sequence, it causes the ap-crRNA conformation to change, thereby regulating the non-typical activation of the Cas13a protein bound thereto that is independent of the target RNA.

[0030] Preferably, the ap-crRNA sequence is shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0031] The beneficial effects of the present invention are:

[0032] The present invention utilizes the binding of target small molecules to the spacer (RNA aptamer sequence) in ap-crRNA to directly regulate the RINCA activity of Cas13a, eliminating the need for the intermediate step of converting small molecule signals into nucleic acid signals, thereby simplifying the detection process. By replacing the RNA aptamer sequence portion of the spacer sequence (spacer) in ap-crRNA, the target small molecule specificity of the detection platform can be changed, making it a universal small molecule sensing platform. The reaction system components are simple, and the detection process can be completed in a single step in a homogeneous solution, making it easy to operate and automate.

[0033] In this invention, the Cas13a protein itself integrates the functions of target recognition (indirectly achieved through the aptamer portion of the ap-crRNA), signal conversion (small molecule binding leads to conformational changes in the ap-crRNA, which in turn leads to changes in Cas13a activity), and signal amplification (Cas13a's trans-cleavage activity). Experimental results demonstrate that the platform constructed in this invention has good detection sensitivity and specificity for specific small molecules, such as kanamycin and ATP. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1Comparison of the trans-cleavage activity of typical LwCas13a activation and RINCA activation. A: LwCas13a / crRNA (miR-21 22nt) RNP has trans-cleavage activity only in the presence of target ssRNA. B: LwCas13a / crRNA (miR-125 22nt) RNP exhibits RINCA activity in the absence of target RNA. Figure 2 This is a comparison of the trans-cleavage activity of typical activation of LbuCas13a and RINCA activation. Its performance is similar to that of LwCas13a. A: LbuCas13a / crRNA (miR-21 22nt) RNP has trans-cleavage activity only in the presence of target ssRNA. B: LbuCas13a / crRNA (miR-125 22nt) RNP exhibits RINCA activity in the absence of target RNA, and the activity is more significant than that of LwCas13a. Figure 3 These are two different methods to verify the correlation between RINCA capability and spacer structure; Figure 4 The RINCA ability of crRNA is related to its spacer secondary structure; A: Analysis of the ability of multiple miR-21 and miR-125-derived crRNAs to activate the trans-cleavage activity of LwCas13a via RINCA, B: Prediction of the secondary structure of the spacer sequences of each crRNA in A, C: The G10U single-site mutation linearizes the crRNA (miR-125 22nt) spacer, D: The G10U mutation causes the crRNA (miR-125 22nt) to lose its RINCA ability; Figure 5 The ability of two ap-crRNA RINCA aptamers with kanamycin as spacer to activate the trans-cleavage activity of LwCas13a was evaluated. A: ap-crRNA (Kan_short) failed to activate the trans-cleavage activity of LwCas13a in a RINCA manner and did not respond to changes in the concentration of kanamycin in the solution. B: ap-crRNA (Kan_long) showed significant RINCA activity, and this activity changed when the kanamycin concentration changed, specifically showing that the activity decreased with increasing kanamycin concentration. Figure 6The RINCA activity and changes of LwCas13a / ap-crRNA RNP constructed with different ATP RNA aptamers in the presence or absence of ATP, where A, B, and C are ap-crRNA (ATP_1), ap-crRNA (ATP_2), and ap-crRNA (ATP_3), respectively. It can be seen that ap-crRNA (ATP_3) has a significant response to ATP in the solution; Figure 7 This is a kanamycin detection platform based on ap-crRNA (Kan_long). (A) The spacer sequence and structure of ap-crRNA (Kan_long). (B) The LwCas13a / ap-crRNA (Kan_long) RNP has strong trans-cleavage activity, which is inhibited by increasing kanamycin concentration. Figure 8 This is an ATP detection platform based on ap-crRNA (ATP_3). (A) The spacer sequence and structure of ap-crRNA (ATP_3). (B) The trans-cleavage activity of LwCas13a / ap-crRNA (ATP_3) increases with increasing ATP concentration, with a dynamic range of approximately 1-10 mM. (C) The system's LOD for ATP response is 0.88 mM (calculated by the 3*SD / Slop method). Figure 9 The specificity of the ATP detection platform is shown in Figure 2. A: Non-ATP aptamer crRNA does not respond to ATP. B: The platform does not significantly enhance the signal of other small molecules with similar structures. Figure 10 The expression and purification process of Cas13a protein, A: IPTG-induced expression, B: Initial purification of His- and SUMO-tagged Cas13a by nickel column, C: SUMO protease removal of the amino-terminal tag, D: SDS-PAGE results after purification by positive ion exchange column;

[0035] Figure 11 is a legend to Table 1, where blue, red, and orange represent the T7 promoter, direct repeat sequence, and target-specific sequence. DETAILED DESCRIPTION

[0036] The technical solution of the present invention is further described in detail below through specific examples. It should be understood that the implementation of the present invention is not limited to the following examples, and any form of modification and / or change made to the present invention will fall within the scope of protection of the present invention.

[0037] In the present invention, unless otherwise specified, all parts and percentages are by weight, and the equipment and raw materials used are commercially available or commonly used in the art. The methods in the following examples are all conventional methods in the art unless otherwise specified.

[0038] Unless otherwise specified, the reagents used in the following examples can be purchased from conventional biochemical reagent stores.

[0039] Example 1 1. Expression and Purification of Cas13a Protein

[0040] The pC013-LwCas13a (Addgene #90097) and pC0072-LbuCas13a (Addgene #115267) expression plasmids were transformed into competent E. coli BL21 (DE3) cells. An initial culture (5 mL) was grown overnight in LB broth and used to inoculate 1 L of TB broth. The cells were grown at 37°C and 200 rpm until the OD600 reached 0.5–0.6. Protein expression was then induced with 500 μM IPTG for 16 hours at 18°C. Cell pellets were harvested by centrifugation at 5200 g for 15 minutes at 4°C and stored at −80°C for further purification.

[0041] Cell pellets were thawed on ice and resuspended in lysis buffer (20 mM Tris-HCl, 500 mM NaCl, 1 mM DTT, pH 8.0) supplemented with lysozyme, a protease inhibitor cocktail, and benzonase. After sonication and centrifugation, the clear supernatant was filtered through a 0.22 μm pore size filter and applied to a HisTrap HP column. The column was washed with lysis buffer (3 column volumes) and eluted using a stepwise elution procedure using 1% and 5% IMAC elution buffer (20 mM Tris-HCl, 500 mM NaCl, 1 M imidazole, pH 8.0). Fractions containing Cas13a were pooled, concentrated, and dialyzed into SUMO digestion buffer (20 mM Tris-HCl, 250 mM NaCl, 1 mM DTT, 0.15% Igepal (NP-40), pH 8.0). Proteins were then digested with SUMO protease overnight at 4°C. The digested mixture was further purified by ion exchange chromatography (IEC). The protein was loaded onto a 5 mL HiTrap SP Sepharose FF column, washed with IEC buffer A (20 mM Tris-HCl, 1 mM DTT, 5% glycerol, pH 8.0), and eluted with a linear salt gradient of 10 column volumes from 250 mM to 2 M NaCl using IEC buffer B (20 mM Tris-HCl, 2 M NaCl, 1 mM DTT, 5% glycerol, pH 8.0). The peak fractions were collected and analyzed by SDS-PAGE for the presence and purity of Cas13a. Figure 10 shown. Figure 10 A shows that IPTG successfully induced the expression of a large amount of Cas13a protein (arrows mark the approximate location of the protein). Figure 10 B shows that after purification by His-tag purification column, relatively pure tagged Cas13a protein can be obtained. The eluted protein is collected and digested with SUMO digestion enzyme ( Figure 10 C) and purified by positive ion exchange column to finally obtain the Cas13a protein product ( Figure 10 D).

[0042] 2. Preparation of ap-crRNA and target RNA

[0043] The U5 single-stranded RNA fluorescent probe (SEQ ID NO: 19) and target RNA (SEQ ID NO: 20 and 21) were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The crRNA used in the present invention was synthesized using the HiScribe T7 Quick HighYield RNA (NEB) synthesis kit. Briefly, the template was a nucleotide sequence containing a variable spacer sequence ( Figure 11 Marked in orange), the unchanging Cas13a direct repeat sequence ( Figure 11 Marked in red in the figure) and the T7 promoter sequence ( Figure 11 Single-stranded DNA (marked in blue in Figure 1) was used (sequence also see Table 1). To synthesize crRNA, the single-stranded DNA template was annealed with a T7 primer (SEQ ID No. 5) (final double-stranded concentration of 10 μM) in a 10 μL reaction containing 1X Taq polymerase buffer. The resulting product (10 μL) was mixed with T7 polymerase (2 μL) and NTPs (10 μL) in a total reaction volume of 39 μL (the remaining 17 μL was made up with nuclease-free ddH2O) and incubated at 37°C for 4 hours. Residual DNA template was then digested with DNase I (1 μL). The synthesized crRNA was purified using an RNA purification kit (Tiangen Biochemical Technology, DP412), and the purified crRNA concentration was measured and stored at -20°C.

[0044] The DNA and RNA sequences used in the present invention are listed in Table 1, respectively.

[0045] Table 1 DNA and RNA sequences (color indicated in Figure 11 )

[0046] DNA sequence name DNA sequence 5' to 3' SEQ ID No. T7-3G primer GAAATTAATACGACTCACTATAGGG 5 LwCas13a crRNA (miR-21 22nt) (crRNAwith miR-21 22nt derived spacer)template TAGCTTATCAGACTGATGTTGAGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC 6 LwCas13a crRNA (miR-21 28nt) (crRNAwith miR-21 28nt derived spacer)template GTCGGGTAGCTTATCAGACTGATGTTGAGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC 7 LwCas13a crRNA (miR-125 22nt) (crRNAwith miR-125 22nt derived spacer)template ACAGGTGAGGTTCTTGGGAGCCGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC 8 LwCas13a crRNA (miR-125 22nt G10U)template ACAGGTGAGGTTATTGGGAGCCGTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC 9 LwCas13a crRNA (miR-125 25nt) (crRNAwith miR-125 25nt derived spacer)template GUCACAGGTGAGGTTCTTGGGAGCCGTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC 10 LwCas13a crRNA (miR-125 28nt) (crRNAwith miR-125 28nt derived spacer)template AGGGUCACAGGTGAGGTTCTTGGGAGCCGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC 11 LwCas13a ap-crRNA (ATP_1) (crRNA withATP aptamer_1 as spacer) template GTCGCACCACACACACACCACTACGTGCGACGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC 12 LwCas13a ap-crRNA (ATP_2) (crRNA withATP aptamer_2 as spacer) template GGGTTGCTGGCACCGAAGTGCCACAGTTTCTTCCCAACCCGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC 13 LwCas13a ap-crRNA (ATP_3) (crRNA withATP aptamer_3 as spacer) template CGGATGACTCTCCACAGCACACGCCAAGCGTCTCATCCGGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC 14 LwCas13a ap-crRNA (Kana_short) (crRNAwith kanamycin aptamer_short sequenceas spacer) template GAGAATTCGGTACCGAGCTCCCGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC 15 LwCas13a ap-crRNA (Kana_long) (crRNAwith kanamycin aptamer_long sequenceas spacer) template ACCCCTATAGGGCGAGAATTCGGTACCGAGCTCCCGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC 16 LbuCas13a crRNA (miR-21 22nt) (crRNAwith miR-21 22nt derived spacer)template TAGCTTATCAGACTGATGTTGAGTTTGTTCCCCTTCATTTTTGGGGTGGTCTACCCTATAGTGAGTCGTATTAATTTC 17 LbuCas13a crRNA (miR-125 22nt) (crRNAwith miR-125 22nt derived spacer)template ACAGGTGAGGTTCTTGGGAGCCGTTTTAGTCCCCTTCATTTTTGGGGTGGTCTACCCTATAGTGAGTCGTATTAATTTC 18 RNA synthesis 5' to 3' RNA sequence U5 reporter / substrate FAM-UUUU-BHQ1 19 miR-21 target RNA UAGCUUAUCAGACUGAUGUUGA 20 miR-125 target RNA ACAGGUGAGGUUCUUGGGAGCC 21 ATP aptamer_1 sequence GUCGCACGUAGGUGGUGGGCGAC 22 ATP aptamer_2 sequence GGGUUGGGAAAGAACUGUGGCACUUCGGUGCCAGCAACCC 23 ATP aptamer_3 sequence CGGAUGAGACGCUUGGCGUGUGCUGUGGAGAGUCAUCCG 24 Kanamycin aptamer_short sequence GGGAGCUCGGUACCGAAUUCUC 25 Kanamycin aptamer_long sequence GGGAGCUCGGUACCGAAUUCUCGCCCUAUAGGGGU 26 LwCas13a crRNA (miR-21 22nt) . GAUUUAGACUACCCAAAAACGAAGGGGACUAAAACUCAACAUCAGUCUGAUAAGCUA 27 LwCas13a crRNA (miR-21 28nt) . GAUUUAGACUACCCAAAAACGAAGGGGACUAAAACUCAACAUCAGUCUGAUAAGCUACCCGAC 28 LwCas13a crRNA (miR-125 22nt) . GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGGCUCCCAAGAACCUCACCUGU 29 LwCas13a crRNA (miR-125 22nt G10U) GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGGCUCCCAAUAACCUCACCUGU 30 LwCas13a crRNA (miR-125 25nt) GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGGCUCCCAAGAACCUCACCUGUGAC 31 LwCas13a crRNA (miR-125 28nt) GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGGCUCCCAAGAACCUCACCUGUGACCCU 32 LwCas13a ap-crRNA (ATP_1) GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGUCGCACGUAGUGGUGUGUGUGUGGUGCGAC 33 LwCas13a ap-crRNA (ATP_2) GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGGGUUGGGAAGAAACUGUGGCACUUCGGUGCCAGCAACCC 34 LwCas13a ap-crRNA (ATP_3) GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACCGGAUGAGACGCUUGGCGUGUGCUGUGGAGAGUCAUCCG 4 LwCas13a ap-crRNA (Kanamycin_short) GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGGGAGCUCGGUACCGAAUUCUC 35 LwCas13a ap-crRNA (Kanamycin_long) GAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACGGGAGCUCGGUACCGAAUUCUCGCCCUAUAGGGGU 3 LbuCas13a crRNA (miR-21 22nt) UAGACCACCCCAAAAAUGAAGGGGACUAAAACUCAACAUCAGUCTGAUAAGCUA 36 LbuCas13a crRNA (miR-125 22nt) UAGACCACCCCAAAAAUGAAGGGGACUAAAACGGCUCCCAAGAACCUCACCUGU 37

[0047] 3. Cas13a trans-cleavage activity detection system

[0048] Cas13a trans-cleavage activity was assessed in 384-well plates using a Biotek Synergy Neo2 fluorescence reader.

[0049] The reaction system (10 μL) included 25 nM crRNA, 15 nM Cas13a and 125 or 500 nM U5 fluorescent probe, 0 or 50 nM target RNA, and small molecules at different concentrations (see Table 2 for the concentrations involved in each reaction), using Cas13a nuclease assay buffer (40 mM Tris-HCl, 9 mM MgCl2, 1 mM DTT, 5 U RNase inhibitor, pH 7.5).

[0050] Table 2

[0051] All components were mixed on ice and then transferred to a fluorescence reader (Synergy Neo2) preheated to 37°C for time-course fluorescence measurement. FAM fluorescence was measured at an excitation wavelength of 485 nm and an emission wavelength of 520 nm.

[0052] Example 2: Verification of RINCA activity of Cas13a and its relationship with crRNA structure

[0053] 1. Verification of RINCA activity of Cas13a

[0054] Using laboratory-prepared LwCas13a, LbuCas13a proteins and crRNA, the trans-cleavage activity under typical and RINCA (target RNA-independent) activation was evaluated using a FRET reporter molecule (FAM-U5-BHQ).

[0055] LwCas13a and LbuCas13a proteins were used and combined with different crRNAs (such as crRNA (miR-21 22nt) and crRNA (miR-125 22nt)).

[0056] The CRISPR-Cas13a reaction system primarily consists of Cas13a protein (15 nM), crRNA (25 nM), 0 or 50 nM target ssRNA, and the required reaction buffer (40 mM Tris-HCl (pH 7.5), 1 mM DTT, 5 U RNase Inhibitor, 125 nM reporter, and 9 mM MgCl2). After crRNA recognizes and complements the target RNA, Cas13a activates RNase activity, cleaving the quenched reporter (5'FAM-UUUUU-3'BHQ1) previously added to the system and restoring its fluorescence signal. The Cas13a / crRNA / target system served as the experimental group; Cas13a and Cas13a / crRNA served as the control group. These reactions were monitored in real-time fluorescence using a microplate reader.

[0057] Figure 1 - Figure 2 This indicates that the constructed CRISPR-Cas13a system can effectively detect target molecules and reach a plateau within a few minutes, meeting the basic requirements for its use as an RNA detection platform. The LwCas13a / crRNA (miR-21 22nt) RNP strictly adheres to the typical Cas13a activation pattern and is active only in the presence of its target RNA (miR-21, SEQ ID No. 20) ( Figure 1A). However, the LwCas13a / crRNA (miR-125 22nt) binary RNP showed a certain amount of activity in the absence of target RNA ( Figure 1 Figure 2B, red curve), although the amount was less than that of the ternary LwCas13a / crRNA (miR-125 22nt) / target RNA (miR-125, SEQ ID No. 21) RNP (Figure B, green curve). Similarly, the LbuCas13a protein also exhibited similar RINCA mode activity, with LbuCas13a / crRNA (miR-21 22nt) RNP showing only limited RINCA ability, while LbuCas13a / crRNA (miR-125 22nt) showed considerable RINCA trans-cleavage of Cas13a ( Figure 2 ).

[0058] These results indicate that, in addition to classical cis-cleavage and trans-cleavage, the binary RNP formed by Cas13a and certain crRNAs also exhibits trans-cleavage activity on surrounding free RNA. This Cas13a activity is called "RINCA" (non-classical activation of Cas13a induced by crRNA alone and independent of target RNA).

[0059] 2. Verification of the relationship between Cas13a RINCA activity and crRNA secondary structure

[0060] Based on the previous results, it is speculated that the RINCA activity of Cas13a is related to the secondary structure of the crRNA spacer. To verify this speculation, some sequences with a high tendency to form secondary structures were selected as spacer sequences to generate str-crRNA (structured crRNA), and their RINCA potential was evaluated using the trans-cleavage activity assay of LwCas13a ( Figure 3 ).

[0061] In a specific embodiment, 25-nt and 28-nt spacer sequences were constructed, which were derived from the adjacent sequences of previously tested mature miRNAs. The results showed that all crRNAs derived from miR-125 (SEQ ID No. 29, 31 and 32) could activate LwCas13a by RINCA. Figure 4 A, green curve), while all crRNAs derived from miR-21 (SEQ ID No. 27 and 28) could not ( Figure 4A, red curve). The spacer sequences of the above crRNAs were analyzed using the Vienna RNA Website. The results showed that all spacer sequences derived from miR-125 have a strong tendency to form secondary structures, which is different from the spacer sequences derived from miR-21 (all of which are linear structures) ( Figure 4 B). It is speculated that the spacer sequence with a specific structural conformation may be similar to the spacer-target duplex, interacting with the NUC blade, thereby triggering the RNase activation of Cas13. In fact, a G10U mutation can cause the crRNA (miR-125, 22nt) (SEQ ID No. 30) structure to be destroyed (becoming linear, Figure 4 C). This mutation can completely eliminate the RINCA ability of crRNA (miR-125, 22nt) ( Figure 4 D). These results suggest that the RINCA ability of Cas13a is closely related to the crRNA spacer structure.

[0062] By constructing spacer sequences (str-crRNA) with specific secondary structural tendencies or introducing point mutations into the spacer sequence (e.g., G10U mutations that disrupt secondary structure), this method revealed that RINCA activity is closely related to the secondary structure of the spacer sequence. These results lay the foundation for the subsequent integration of RNA aptamers into the spacer region and the use of its conformational changes to regulate RINCA activity.

[0063] Example 3: Effective conformational changes in crRNA can trigger changes in Cas13a / crRNA RNP RINCA activity

[0064] The previous examples have verified that the RINCA activity of Cas13a is related to the secondary structure of the crRNA spacer. On this basis, the scope can be expanded to further speculate that the effective conformational change of crRNA can also trigger the change of Cas13a / crRNA RNPRINCA activity. To verify this speculation, the RNA aptamer sequence (all or part of the functional sequence) was designed to be placed in the spacer region of crRNA to form ap-crRNA (aptamer-crRNA) ( Figure 3 Through this design, we can analyze whether Cas13a / ap-crRNA RNP has RINCA activity; on the other hand, when adding ligand molecules (ligand) to induce spacer (aptamer) structural changes, we can observe whether its effect on Cas13a RNP RINCA activity can be observed. The specific method is as follows:

[0065] In Experiment 1, two ap-crRNAs (kanamycin_short, SEQ ID No. 35) and (kanamycin_long, SEQ ID No. 3)) were constructed using two previously reported kanamycin RNA aptamer sequences (SEQ ID Nos. 25 and 26) as crRNA spacer sequences, using their full or partial functional sequences. Their RINCA potential and ligand response were assessed using a LwCas13a trans-cleavage assay. The reaction system (10 µL) consisted of 25 nM crRNA, 15 nM LwCas13a, 125 nM U5 fluorescent probe, 0 or 1 mM kanamycin, and the required reaction buffer (40 mM Tris-HCl (pH 7.5), 9 mM MgCl2, 1 mM DTT, and 5 U RNase Inhibitor). The reactions were plated in a 384-well plate and monitored in real-time fluorescence on a microplate reader. The results showed that the LwCas13a / ap-crRNA (Kan_short) binary RNP had no significant RINCA activity, and after adding a certain amount of Kanamycin, the activity did not change significantly ( Figure 5 A). However, the LwCas13a / ap-crRNA (Kan_long) binary RNP exhibited significant trans-cleavage activity, and this activity changed significantly (weakened) when the concentration of kanamycin increased ( Figure 5 B). This example shows that ap-crRNA (Kan_long) itself can activate LwCas13a to produce RINCA activity, and this activity is affected by the concentration of kanamycin (kanamycin can induce effective conformational changes in ap-crRNA (Kan_long)).

[0066] In Experiment 2, referring to the three reported ATP RNA aptamers (SEQ ID No. 22, 23 and 24), three ap-crRNAs (ap-crRNA_1, SEQ ID No. 33; ap-crRNA_2, SEQ ID No. 34; ap-crRNA_3, SEQ ID No. 4) were designed and added to the reaction system (similar to the Kanamycin reaction system, see Table 2 for details) to observe the RINCA activity of LwCas13a / ap-crRNA RNP and its changes in the presence or absence of ligand (ATP: 0 or 10 mM). Figure 6As shown, the three LwCas13a / ap-crRNA RNPs themselves have little or no RINCA activity. However, when 10 mM ATP is added to the system, the RINCA activity of all three RNPs is enhanced. In particular, the activity of the LwCas13a / ap-crRNA(ATP_3) RNP composed of ap-crRNA(ATP_3) is significantly enhanced in the presence of ATP, indicating that ATP induces a significant and effective conformational change in ap-crRNA(ATP_3).

[0067] These experimental results demonstrate that the RINCA activity of Cas13a / crRNA RNP is closely related to the structural properties of the spacer sequence. Furthermore, effective conformational changes in crRNA (or, more accurately, Cas13a / crRNA RNP) can also trigger changes in Cas13a RINCA activity. This discovery lays the foundation for the subsequent application of Cas13a / ap-crRNA RNP in small molecule detection.

[0068] Application Examples

[0069] In Example 3, the present inventors used LwCas13a to evaluate the RINCA activity of Cas13a / ap-crRNA (Kanamycin) and Cas13a / ap-crRNA (ATP) in response to kanamycin or ATP. The experimental setup generally followed the standard Cas13a trans-cleavage reaction method, except that kanamycin or ATP replaced the target nucleic acid. In the kanamycin-responsiveness experiment, two ap-crRNAs carrying kanamycin RNA aptamers were used: LwCas13a ap-crRNA (Kan_short) and LwCas13a ap-crRNA (Kan_long) (sequences are shown in Table 1). Of the two ap-crRNAs tested, ap-crRNA (Kan_long) performed best and was subsequently used to construct a detection platform for kanamycin molecules. In the ATP-responsiveness experiment, three ap-crRNAs carrying ATP RNA aptamers were used: LwCas13a ap-crRNA (ATP_1), LwCas13a ap-crRNA (ATP_2), and LwCas13a ap-crRNA (ATP_3) (sequences are shown in Table 1). Of the three ap-crRNAs tested, ap-crRNA (ATP_3) performed the best and was subsequently used to construct an ATP molecule detection platform.

[0070] In all experiments, LwaCas13a crRNA (miR-21 22nt) (SEQ ID No. 27) was used as a negative control that did not respond to the ligand.

[0071] Application Example 1: Kanamycin Detection Platform Based on ap-crRNA

[0072] We selected ap-crRNA (Kan_long) to construct a kanamycin detection platform. A reaction system was established containing 25 nM crRNA, 15 nM LwCas13a, 500 nM U5 fluorescent probe, varying concentrations of kanamycin (0, 0.01, 0.1, and 1 mM), and the required reaction buffer (40 mM Tris-HCl (pH 7.5), 9 mM MgCl2, 1 mM DTT, and 5 U RNase Inhibitor). The crRNA (miR-21 22nt) was used as a control group, and the ap-crRNA (Kan_long) was used as an experimental group. The reaction was plated in a 384-well plate and monitored in real-time fluorescence using a microplate reader.

[0073] The results are as follows Figure 7 As shown in the figure, LwaCas13a / crRNA (miR-21 22nt) RNP itself has no RINCA potential and does not respond to different concentrations of Kanamycin; however, LwaCas13a / ap-crRNA (Kan_long) RNP exhibits significant RINCA activity, and its trans-cleavage activity (increase rate of fluorescence signal) gradually decreases with increasing kanamycin concentration. LwaCas13a / ap-crRNA (Kan_long) RNP exhibits excellent detection sensitivity and can detect at least 0.1mM Kanamycin ( Figure 7 B).

[0074] Application Example 2: ATP Detection Platform Based on ap-crRNA

[0075] We selected ap-crRNA (ATP_3) to construct an ATP molecule detection platform. A reaction system was established, containing 25 nM crRNA, 15 nM LwCas13a, 500 nM U5 fluorescent probe, various concentrations of ATP (0, 0.1, 1, 3, 5, 7, and 10 mM), and the required reaction buffer (40 mM Tris-HCl (pH 7.5), 9 mM MgCl2, 1 mM DTT, and 5 U RNase Inhibitor). Using crRNA (miR-21 22nt) and crRNA (miR-125 22nt) as controls and ap-crRNA (ATP_3) as an experimental group, the reactions were plated in a 384-well plate and monitored in real-time fluorescence using a microplate reader.

[0076] The results are as follows Figure 8 As shown, the LwCas13a / ap-crRNA(ATP_3) RNP itself has a weak RINCA activity, but this activity gradually increases with increasing ATP concentration. Its dynamic response range to ATP is 1-10 mM, and its limit of detection (LOD) is calculated to be 0.88 mM (calculated by the 3*SD / Slop method).

[0077] In order to verify that the enhancement of trans-cleavage activity is the result of ATP aptamer specific binding to ATP, two non-aptamer crRNAs, crRNA (miR-21 22nt) and crRNA (miR-125 22nt), were used as control groups to observe whether they had a positive response to the increase in ATP concentration. Figure 9 As shown in A, the RNP assembled with crRNA using a non-ATP aptamer showed no response under ATP stimulation. On the other hand, other small molecules with similar structures (AMP, GTP, CTP, UTP, 3 mM each) were added to the reaction system instead of ATP to observe whether the RINCA activity of LwCas13a / ap-crRNA (ATP_3) RNP would change as when the same concentration of ATP was added. The results are shown in Figure 9 As shown in Figure B, when this ATP detection platform was used to detect other small molecules with similar structures, there was no obvious signal enhancement compared with the control group, indicating that the platform is highly specific for ATP.

[0078] The above two application examples show that the present invention constructs ap-crRNA by using the RNA aptamer sequence or part of the functional sequence as the spacer region of crRNA, and successfully utilizes the conformational change of ap-crRNA caused by the binding of the target small molecule to the aptamer to regulate the atypical activation (RINCA) of the Cas13a protein, thereby generating a detectable signal by cutting the RNA reporter molecule, thereby achieving direct, sensitive and specific detection of small molecules such as kanamycin and ATP. For any small molecule, as long as a corresponding RNA aptamer with high specificity is found or synthesized, its sequence or part of the functional sequence is used as the crRNA spacer sequence to make the corresponding ap-crRNA, it can be combined with Cas13a / ap-crRNA RNP to sense the concentration change of the target small molecule. This strategy has good versatility and can theoretically be expanded to the detection of a variety of different small molecules by replacing different RNA aptamer sequences.

[0079] It should be understood by those skilled in the art that the present invention is not limited to the above-mentioned embodiments, and any modifications, equivalent replacements or improvements made according to the main spirit of the present invention shall be included in the scope of protection of the present invention. For example, Cas13a protein can be replaced by other Cas13 subtypes or engineered Cas13 proteins with RINCA activity; the types and detection methods of RNA reporter molecules can also be diversified, such as electrochemical reporter molecules, colorimetric reporter molecules, etc.; the source and sequence of RNA aptamers can also be selected and optimized according to the different target small molecules.

Claims

1. A small molecule detection method based on atypical activation of Cas13a, characterized in that, The method comprises the following steps: S1. Preparing a reaction system comprising a Cas13a protein, a modified crRNA (ap-crRNA), and an RNA reporter molecule; the ap-crRNA comprises a direct repeat sequence compatible with the Cas13a protein and a spacer sequence comprising an RNA aptamer sequence for the target small molecule; The Cas13a protein is LwCas13a composed of the amino acid sequence shown in SEQ ID NO: 1, or LbuCas13a composed of the amino acid sequence shown in SEQ ID NO: 2; S2. contacting the sample with the reaction system; S3. After the target small molecule binds to the RNA aptamer sequence in the ap-crRNA, the conformation of the ap-crRNA changes, thereby regulating the atypical activation of the Cas13a protein that is independent of the target RNA; S4. Detecting the cleavage status of the RNA reporter molecule to determine whether the target small molecule exists in the sample or its concentration.

2. The method according to claim 1, characterized in that The RNA reporter molecule is a FRET probe with a fluorescent group and a quenching group, and the detection step is performed by detecting changes in the fluorescent signal.

3. The method according to claim 1, characterized in that The conformational change of the ap-crRNA causes the atypical activation of the Cas13a protein to be enhanced or weakened.

4. The method according to claim 1, wherein The target small molecule is kanamycin, the spacer sequence of the ap-crRNA comprises a kanamycin RNA aptamer sequence, and the ap-crRNA sequence is shown in SEQ ID NO:

3.

5. The method according to claim 1, wherein The target small molecule is ATP, the spacer sequence of the ap-crRNA comprises an ATP RNA aptamer sequence, and the ap-crRNA sequence is shown in SEQ ID NO:

4.

6. A composition or kit for detecting a target small molecule in a sample, characterized in that: Include: a. Cas13a protein, wherein the Cas13a protein is LwCas13a consisting of the amino acid sequence shown in SEQ ID NO: 1, or LbuCas13a consisting of the amino acid sequence shown in SEQ ID NO: 2; b. A modified crRNA (ap-crRNA) comprising a direct repeat sequence compatible with the Cas13a protein and a spacer sequence comprising an RNA aptamer sequence for the target small molecule; c. RNA reporter molecules.

7. The composition or kit according to claim 6, characterized in that The RNA reporter molecule is a FRET probe with a fluorescent group and a quenching group.

8. A modified crRNA (ap-crRNA), characterized in that The ap-crRNA comprises a direct repeat sequence and a spacer sequence compatible with the Cas13a protein, wherein the spacer sequence is integrated with an RNA aptamer sequence for a target small molecule; Among them, when the target small molecule binds to the RNA aptamer sequence, it causes the ap-crRNA conformation to change, thereby regulating the non-typical activation of the Cas13a protein bound thereto that is independent of the target RNA.

9. The modified crRNA (ap-crRNA) according to claim 8, characterized in that The ap-crRNA sequence is shown in SEQ ID NO: 3 or SEQ ID NO: 4.

Images